Mus_musculus Locus Mono:196:SNORA25
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:196:SNORA25
Mus_musculus
Mono:196:SNORA25
X
SNORA25
1001..1127
2127
CCCCTACTTGCCTGAATTATTATCTAGCTTAATCATATGCATTCAATACATTTGCCTAT
TTCTTAAAAATGAAGTGTTCCCTTTCAAAGGAGAGCTGTAAATGGTATAAAGAGAGAGAG
AGAGAGAGAGACAGAGACAGAAAGCAAAACAGCCAAAAAATAAGAGGCAAAAAGAAATGT
TTTCACAGTCCTAGAATATAATTTTGGATGAAAAGTGTCAGAAATAGTTTGAGTAATCAT
CACATCCAACAGAGCCACTGCCTCTGAGTTAATGAGGCTTATCTATGTATAGATATTTGC
ATGATTGTTTCAAAATCAGTCATTTTAGTCACTGTTTGCATAGTAACTGATATAGAATGC
ATTTAATACCTTCTGGTTACTGCTTTACTAAGTAAATAAAAGAATCTCATCTGTGGACTC
TGCCCCGCACACATACTAAGGATAGGACAAGACATCCTGTCAGTTCTAAAGTCTTTTAGT
AAACCTTCCCCACAGGTTTCATATCTTTCTATGTGTTCTCATCATACTTTTTCCAATAAT
GCTTTTTAAAAACTCTCCGACTCTCTCTTAACTCATTCACAAGGTTCCTCTAGAGAGCTA
GCACCTCACCTACCAACTTGAAAAACCTCATTTTGCTGTAATTCTTTCCTATCATGCTAA
GTTGATGTAAAAACAACAGGCTGAGAAGATTTCTGTGATATATTCAAAGGCAGATTAGAT
GAATGCCCAAAGAGCTTCACTGGATCTGACATGTAGGGCTATTAATGGGATCAGAGAACT
TAGAGGTTGAGTTTTGTTATGAATTAAATATAGGCTCTAAAATCTTGGCTCTATCATATA
ATAGCTGCAGGATTTGGGAACCTCAGATTCCTCCTCATTTTTAAACTAAGGACCTAGAGA
CTAGCCTTTTAAAGTTGTAACGTAAATATACATATGTAATTTTCATAAAAGATACAGAAC
TATAAATGCCTTTGCATTTCAGAATGTTAAGTACTCCCTCTATACTTTAAAAAAGGCTTT
AATGGGGCTATCAAACCAGAAGTTCTTAAGGGCATGACTAAAGATTACAGTTCTCCACAG
GATGTCAGTCACTCAATAGTGCTAATGTTTTCCTAAGGAGAGAAGAGACTTACCCACTCA
TAATCATGACAGATCCAAAGACTGCTATTTAGGAAAGTAAATGAAAGTCTTAATGGTCAA
ATAAAGGCTTAAAAAGTAAGATAGAACAAGAAAGGGATAGTCCTACAAAATTACTAAATA
ATAATGGTTACTTTCACTCTAGAAAGGAAAAAAAAAAAGCTTTAGGGTTTGAAAGAAGTG
ATTAAAAAAAAAAGCAAAAAAAAAAAAAAAAGCAGTGACCAAAACACACTAAGGTTGTTC
ACCAGGGGAAAAACAGAAGTTTTAAGTCATCATAGCATCCCTTCATTTAATTACAATTGG
ACCAAGTCATAGTCCTGAGGATATATAAAAACCAAAACTATCTAATGCAAACACTGCTTT
ATTAAAGCAGTACACAAAGGACAAAGAGTCCAGTCCTATTTGGGTAAACTTTTATTCCCC
TATCATGACTTCTTCACATATCTTAAGTTTTAAGATATCAAACTAGGGGTTAGAAAACCT
AGTACCTACATTCCAGCTCACAACCATCTGTATCCCAAGGAGATCTGATACCCTTTTCTA
TCACTTCCTTGGTGCACAGACATACATGTAGGTAAAACACTCATACACATAAAATAAGTA
AAAACTTTCCTCCTAGAGATAAATTATAGGGCCATATAAGATGTATAATTCAAACCCAAG
GCTTCATATATACATTGAATCTTTATTCTCCCCACTTTGTAAAACAACAACAGTTCTTCC
ATAAATTCTAAGAAAAATGATTCACTCTAACTAAAGACAACAGGTACAAAGAAAACAGCA
TCCACTGACTTGTTTTCCTGATGTTTATATACTGTTCATATAAGTTACAGTTTTTCAGGT
TTAGTAAGCTCCTAGGGTAACTAACAAAAGCAAGCTTTACAGCAGAGTAACCTTATCTTT
CCTTACTAAGAATTTATGGGAAAATATTTCAAGCCAGAAGGTTAATAAAAAAAGAATATG
GATACATAAACTGGAGATTACTGACATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved