Mus_musculus Locus Mono:212:SNORA63
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:212:SNORA63
Mus_musculus
Mono:212:SNORA63
X
SNORA63
1001..1119
2119
TCACAATGGGCAGTGGCACTTGGCACAAGCAAGTGTGGAGATGTCAGTTTTCCCTTTAG
GGCATTGTTCTTAACATGTTTGCATAATCTTGCCAGGTTTATTGGTGAAATCACAGTTGA
AGTACTTTTTTTTAAGTTTAAAATCTTTTCTAAAAAAAAGATTTATTTACTTATTTATAT
GTTAAGTACACTATAGCTGTCCTCAGACACTCCAGAAGAGGGTATCAGATCTCATTATGG
ATGGTTGTGAGCCACCATGTGGTTGCCGGGAATTGAACTCAGGACCCAGGACCTTTGGAA
GAGCAGTCAATGCTCTTACCCGCTGAGCCATCTCTCTAGCCCCTAGTTCAAAAATCTTAT
TGTGTGCTCTTTAAGGTAAGTCTACCAACCAGACTTGAGCACAAGGAGGAAGATACATAA
TTTGAGATTTATAGAACATTTGCAAAGGTAGTGAAAAGAATCTCGAATATAATCTTCGCA
CACATTTTTCTCAATTTAACATTTTATCGCATTTGCTTTATAATTGTCCTTAATTATAAC
TGTGCATATTTGATCTGTTTGAAAATTAGTTCTCCTTTATCCTTAAATTAGTATGTGTTT
TTCATAAACAAGGACATAGGCTTATAAAACCAAGTACAATTATCTAAAATGAACATTAAC
ACCACTCTTTTCTAATCTGCAGCTTTTAATCAAATTTCTGAATTATTTCTCTAACATCTT
CCTTTACAAATATAAATCCCGGTCTGGTCTAGCATTACTCATTGTCCCCTTCTCTCTGTG
CATGCTGAGTATGAACCCAGGGCTTCAGACACTCACAGAATCTGTTAAAGTGTTCTAAGA
ATGTTGGTTACAGCTCTAGCTTCTTTGATATCACTCTTTTTATTAATATTTAAATAATAT
TTTATTTATTATCTGAAAATCCTAACATGTACAAAAATGTTATGTCTCTCTGACCCTTCT
TTAATTTGAAATCTTCTTTCATAACTATGACATTTTAAAAATTTCAGTTACTATACAACT
GAAGTGTTTTATTGCAGTTCCCTCTGCTTAAAGCACTCAATACATTACTATCTCAGCCTA
GCTCTACCATAGCAAGACAGAGACACTTGGCTTCAAACATTTTTCCCTGTATAGTAGCTG
AAAGTTTACACAAAGGAAACAGATAAAGACAAGCATTTCTTAAAATAAAGTAAAATCTTC
ACGCGAGCTGGGTAGATGGCTCAGTCGTTAAGAGCACTGGCTGCCATTCTAAGGACCCGG
GTTTGATTCTCAGTGCCCATATGATTGAGAACAGCTGTCTGTAATTCCAGTCTAGATGTG
ACACCTTCTTCTCATCTCTGTAGGCATCAGGCATACTTATAGTACACAGATATACATGCA
ATCAAAGCACACATACACATAAAATAGTAAAATGCTTTCAACTTTTCATGTTTAAAAATA
GCAGGTTATGTTCAAACATCACTTACCAGATGTTTGAAAATGATTCCCTGGAGATTTCAC
CCTCACTACTAAATGTGGAAAGCCTTGGGTAAGAGTTATCATGCAGATAATACTAGAAAT
AGGACCATAAAAAGAAAAAAAGAAAATGTTAAAGAAGGGGAAAAATAAAACAATAAAATG
TGAAAGGGTCTAGGCTAGTTTTTTTTTTTAAGAATATCACTGAATCTGACTGTTAGATAT
ATACTCATGATTAGAATAATGTTATTCATTGTATAATATCACAAAAGTGACATTCTTTTC
TTCTGTTAATTATGTTTGCTATACATACATATATACATGCATATATGTATAACATGAATA
TATATATATATACATAGATATATAACATATGTATACACACATACACACACACACATATAT
ACACTTAAGATTTGTTTTTATTTTATGTGTATGGGTGTTTTGTCTACATATATCTCTGTG
TACCTCATGCATACAGTGCTCGCATAAACCGGAATAGGGAATTGAATCCCCTGGAATTGG
CATTACAGATGTCAAGGTGGCCTTGGGAATTGAACCTGGTCCTTTGCAAGAGCAGCAAGT
GCTCTTAATTGCTGAGACATCTCTACAGCCCCTATATTGGGTATTGTTTGAGAGAGTGTC
TGATGCTGTGATTTTGCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved