Mus_musculus Locus Mono:495:SNORA29
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:495:SNORA29
Mus_musculus
Mono:495:SNORA29
2
SNORA29
1001..1143
2143
ACTTGGCCATGGAGAGACTGTTTAATGGCTTGCTTCCCCTGTGTCTTAGTTTAGTTATG
TTTCTATTTCTGTAGCAAAACACCATGGCCAAGACAACTTATAAAAGAAAGACCGGGCCT
GCCTGGGCTTCTGAGATTTTAAAACTCATCCCTAATGAAGTACCTCCTCCAACAAGGCCA
CCCGTCCTAATCTTTCCCAAACAGTTCCTCCAACTGGGGACCAAGTATTCAAATATATGA
CCCTCCCTATGGGGCTCATTCTCATTCAAACCAGCACATTCTGACTTGCTTGGTGACCCC
CTCTTACATAACCCAGTGCCACTACCTATTCAGGGGTGTCGTGCCCTCAGTGGACTGGGT
CCTCCCATGTTAATCACCAATCAAGAAAATGCCCCCCAGTCTTGCTCACGGGCCAATCTG
ATGAAAACAGTTCCTCAAACAGAGTTCCCTCTTCCAGAGACTCTAGCTTGTGTAAAGTTG
ACAAGTTAAAACAACAACAACAACAACAACAACAACAACAACAAAGAAGCACAGTGAGAA
AAAATTTGCATTACAAATTCAAGCAAACATTCTAAAATGGTAGAACAGAAAGAAAATAGA
AAAATATGAGCACTACATAGGGCTAACAAGGCAAGCAGATGGTGGGACACCAGATACTGA
CTCGAAAAGGAAGAAGTTTGGACCCTAACTTCATACAGTGTGTGTATGTATGTGTGTGTG
TATATGTATATGTATGTATATGATGTATGTGTATGTGTATGTGTATGTGTATGTGTATAT
GTATATATGTATTGTGCTGAAGGACCATAATCCTGCTACTCGGAGGCTGAGCCTGCCTCT
GAGGAATGAGCAGTGGCTAGCATCATGGGGAACCATCAACTTCACAGCCACCAATGGCTT
TCCATGCACACCCTGCTGAACTTGAGGTGGGCATCTTTCTGTGCCCCTTGAGAGCAGGCT
CCTGTTCTGTCAATGACTGTGTTGCCATGAACTGGCTTAGGCACTGCACATAAAATAAGT
TGTTTTCTCTTCTTACTACTAGATATGGTGGTTACATTTATGCAGTAGATTAAAATTGCC
ATGATATGAAGAGAGAGGGCTTTTCGGTGTTCTCTTTCTTTATAAAATGGCTGGACATAC
TATCATTGCTTCTGATTGTTTGACCCTATGTTACATGTGGTAAAACCCAGAAGTTTGGGT
AATGAACTTGTAAGGATTTTTATCCCCCATCCTTTAAACAGGAAATCAGCACACTATATC
AGTAAACGTAAATGTTAATACATCTACGTCTTTCCAAATTAGTAGGGTAAGTGATGAGTT
CTTCTCTAATATGGTAATAGATGTGGTGCTGCTGTTAAATACAATAGTTAAAACTTAAAT
AAAATTGATCCTCTCTTACACTGTAATTAAATTTGTATACATTTTGGTTTGTTTGCATGT
TTAAGCTTGGATAATTTCACCTCTCTTAAACCAAAAAAAAAAAAAAAAAAAAAGCAAAAA
ACAATGGTTGTTTTCTAATTTGAGGTGAAGTTGAGTCATATAATAAGTTGGCATATAATA
ACTGTGTCTCAAAGAATAAACGAAGACACAACACCCAAGAGTGACAGAAGAGCTGTCACC
AGGCAGATTTTCAGTGCTGCCTCTTTACCAGTGGCCAGCCACACCTCTGCAAAGTGACAA
AACAAACTGTCCACAGTTAAGAAAGGAGCCAAGCAGCCTTTACTCTCCAATCACAGAGAA
CTTTAAGAAACAGCACACACGTCTGCTCTATTTTAATGCTTAGATGAGTGGCATGACGAG
GTAACAGTTTGCAACTGTAGCACCTCTCTGATACCTCACAGCTTCACACGATGGTCCAGA
CTCCAGGATGTGCCACACTATGGTTTCAGGCTGGGACTTGCACTTGCCTTAAATTCTTTG
TTGTGAATCTGCTTGGTTCAAACAAAATGAACACATCACCCATATCCACAGGCAGGGAGC
CATCTGGAAGTTCCTGTGGAGGGCGGCAATCCTGTCAGGCTGTCCTTCACAGCTCGCTGA
TGGCATCTTTGTTGTTGTTGTTGTTGCTTTTCTTCAGTATTTGTGTTATTTACTGGCAAA
TTCCAAGTAAAATTAGCACTGAGGAATACGAAATGGCCAGTGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved