Mus_musculus Locus Mono:372:SNORA2
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:372:SNORA2
Mus_musculus
Mono:372:SNORA2
3
SNORA2
1001..1128
2128
TAAAAGCAGCACCAGTTCTGGGCTGGGGGTCTTTTCGCCTCTACAATCAAGCTCTCCCA
ATAAACGTGTGCAGAAGGATCCTGTTGCAGCGTCGTTCTTCCTGGCCAGTCGAGTGCGCG
CAAGACTTTGTGTAAGCTGTTTATGAATTCTCAAACCACTGATGGATTTTAAATGAAGAA
TCTGGATGATCTCTCTGGTTCTTTCAATCAATAAAACATTCAAGATTAATCGGATCTAAG
TTTATAAAATGCATTTAAAACACAATTGGCTTAATGCTGGTTAGGAATATGGGCTGTATT
ACTAACAAGGCGGTGAGCAGGCAGGCAGGAAAGGAGCATCAGCAGCAAGGAGACAGCACT
GTCCTGTGAGCACGGCTACTGCCAAGAAGCAGGAAAACAGCAGTGGCTGAGATGGTGAAG
AATTGAAGCAGTGTGCACAGCTGCTATGTATGGAAACCTAACAGTGGTGTCCAAAACTTA
CAAGCATTGTCACCATGACTGGAGACTTTACTTTCAGGTGTTTAATCAAAGAGGAGAGAA
GAGATACAAGGGTTAATTGTACACTGATCATAGCATCTATGATGGAGGTGACTCAAGTGT
CCACAGACATCTCAGATGAAGGCATGATGGAAATGTGGTGTCACATTACTACTCAGCTTT
CAAAAGAAGCTCTAATACACGTGGCAAGAGGAATAAACCTTGAGAGAAAAACTGAAGGCA
AGCACAAAGAAAAACATCATGTGACCCACAGAGAGTGAAGTTCGGGGAGGCAAGGCTGGA
CGGCAAGTGCCTGGCGAGTGGTGGGATGTCCCTGTGTAACTAACGGGTATGGGGGGCTCA
GTGTGAGAAGATCAGAATGTTAGGGAGAAAGGGAGGCTCCCCAGAAGTATGTACAAGATC
CTGTCAGTTGGGAAAACAAGCTAATTAACAAATGGGGAGGGAGCATAGATTTTCCAAAGT
CAGAAGTCTGGGTGAAACCCACACATGCAGCAAGCCAAACACTGGCTCTGAATCAAGACG
AGCAGTTTGCTGAAGTGGTTGATTTCAAGCTGAGGCCTAAGGAATGTCTTGGAATTTCCA
CTGCAGAAGTTCTAGAACGTAACGCTTGATTCACTGGAGAGAAGCATCTGGCCAAAGAGA
AAGCCAACAAAAGACAAGGCAGGGCACTATCGCTGTGCTCACTGGATTTAATGGCGAGCT
GATGCGTGGTCCCTGTGTCCCCTCAAGCCTGGTCTTGTCACTTGGCAGTTTTTCTGTCAG
AGAACACACAAGGCTTGACTTCATAGCTTCAAATCCTTGTATGAAATTTAAGACTTAGTC
CAATACAGCTTAAATAATTAGTTTATTTCAAGGTTTCTTACAGTTGTGTTCATTGCCATA
GTTACTGCCACTACAAAACAATGTTTCCACCACGCATACTGTTTTACATTTTACTTCATT
GCTCATTCCAACATTCCCCTCTCCCTTTTTTTTTTTTTTTTTTTTTGCAATTCTGAACAA
TAAGCTAGTCATACATGGACAAATAATAAAGGCACTATTCTTGAATGCAATAGAAACTTG
TTAAGGTTGTACATTTATGCCACAAAACACACTGAAAATATGTACCCCACATCTGTTGAC
ACAGGATCAAGGGAGAGAAGCTGGGCTGCGATTTTAGCAAATCACTTAGCAAAGTGGCCA
AACAGCCTTCTATTTCTATACCTGTAAATTAACTACGTGCATCTTAACTATCTGCTGAAT
TCTTTCCGTTTAAGGAAGCTCATGAAGTTTAGAGCACTGCCCGACACTGAGCAAACACTG
TTTCCTTCTGTGTCTTCAGGCCCTGTATTGGGATTGAGAGGCTAACATTGACCTTAAGTT
AGGCTCTAGAGGAAGAACTGTCCTAAATGGTAAAATCAATACTACACTACAAAGCTCAAT
AAAACTAACAGAACATGTTCTCTCATTGCATTTTAACTATGAAAGCTATGGGGACGAGGC
CTAGGTTCCTTCAATACTTTGATGAGTAGGATTTATAGAAACATGAACAGAATTTCCCTG
TAAATCTACAAGAATGCACAATGGCTAATGGTGATTCTATTAACTTGACAGAACCTAGAG
TCCATGGAAGTATACGTCTGTGATGGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved