Mus_musculus Locus Poly:14:SNORND104
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:14:SNORND104
Mus_musculus
Poly:14:SNORND104
11
SNORND104, SNORA76
1001..1070, 1253..1385
2385
GTTTGGTCTACTCAAGCAAGACATTCTCTGAATAAAAAAAGGAGCAGGTGAGATGACTC
AGTGGGCCTCTAGAAACTTCCAACCATTAAACCTATCAAAGGATTACTGTATTTTGTCAA
ATAGCATTTGGTTGTATAGACAACAAAATTTATATTTTCTCATAAGAGCCTTTGCATATT
CTCAGTTGTGGGGTACTGCTTTTGAATAATATGCTATTTACAATTATGCATGAGATTTTA
TGTGTGTACAGGTCTTAATTTCTCTTGAGTAAACTCCCAGGTATTAACAGGTCACCTGGC
AAGTGGATGTTTACAAGAAGTTAGTTGTTTAACTCCTTTTTCAAAAATGGTTTGCTCATT
CTATTCCCAAACATAACTGGGAGCAAAGCTCTGCATCCTCGCCAGCTTACAACACACACC
TTTCCAACCGAGCACACAATATACAGAATAAAGATCTTAAACTGGGCGTTTAAGCCTTTC
AGGTGCTGGAATTACAGATGAGTCATGAAGCCAGGCCGAGGGAGGATAATCTCAAACTGA
GGACCAGAAAGGTCCCCTCATCAAATCAGTATTCGCTCGCGTATTCAGTCTTTGCTCCTA
CGGCTGCGGATCCTTTGAACCCAAGAGGCACTTCGGTTCTTTTTCCCAACATCAACCTAG
GTGTAGGGATCCCACCCCCCCCCCCCCCCCCCCCCCCCCCCCGTCTCCCCGAAAAAGCAA
GACGCTGGAAACTCGCAGTTTCGTCCCAGCTCTATGGTTGGTGGACCTATCTACACGCTG
GAGGACTCAGAAAGCCCAGCCAATGAACCGTCGCTCTTGAGCACGTGACAAGAAAGCTGG
CTTCCTACTGGTCAATACTGCAGGAGCCCGCCCAATAACTTCCGGACGCTTTCTTTAAGA
CAAGGCCACACGTCCATTCCGGCCTCTTATCGACGGGGACTGCTCTAAGGTAATGTGTTC
TCTGAGGAAGCTGAGGCTGCACGGTTTGAGCTGGGTGGCCGGCGATGATGACACTCCATA
CATAGCACGCGTTAGACTGCTGATCCGGGTGATGCGAATCGTAATCTGAGCCGACCGCAC
CGGCAGCGGGAGGTGGCGGGCGCAGCCGACTTCGTACCCTCACCCTTCGCTTCTCTTTCA
GGTCTGCCCTGCGCAGGACAGCAGACAGCGTGGACTTCTACCACCTTTCCCCGAGCCTCT
GAATAAAGTGTTTAAATAACCCCGCTGGTGTCTTGTGTGTCACTGTCGCCGACGCGCTGC
CTTTGAGCCCCCGGCCCACCTTCTCGTGGTGCCGGGGGTTAAGCTGCGGCGCCATAACAC
TCTGCTAGCGCATAACTGGGGCCGCCTGCCCTTCGCGGGCGGCCCTTTTAACCGCTAGCT
ACAGGCTCAGAGCAGCCGACTACACGGCACTTCGGGAGTCGAGGGCAGATGGTGTTGGCC
CAGGCCATAGGCTTAGGTTTTGGAGTAACTGGCCCGAGTGATAACTTGATAAAGTAGGTC
CTGTACTGTCCTTTGTCCCTGCCCCAAGCGTGGGCAGTACTTGAGATGTCCTGCCTACAG
GAAAATGGAATGGGAGGAGCCCTGGAGGTGAATGGATGCCATCTGGCACACGGGCTTTGG
GGCGACTGAAGCCTTAAGGGGGGAGAGGCTGTTAATTAAGTCAGGCCTCAGAGTGCAGAT
ATGCCAGAGGTTGCGTCCCCAGTGTTTGAATAACTGAGACCACCGACCTAGAAGGAAACT
GAATTACAGAGGCTTCTTTTTGGGGAGGGGGGCTTCGAGACAGGGTTTCTCTGTGTAGCC
CTGGCTGTCCTCGAACTGAAATCCGCACCACGCCCGGCTTAAAGAGGCTTCTTAGTGTTC
CTGAGTGAAGTTGCTTAATTGGAGCTTACTAGTAAGCAATTAGAACAAAGTAGTTAGATG
AAACTTTGGATTAAAACAGAAAGGAAGCTTTAAGGGACAGGTTCCATAGACTGACCAGTT
TTTCTAGAAAACAAGGTTATCCCTCTGGTTCCATAAGAAGTAATAATGGATTTCTTTAGT
TCCCACCTCTACAGTGCTGGAGGCTAGCAAAGGTGGCTAAAACTAGCCTTGTGAGGGTCT
CTGCATTCACGGTCCTGTGGGTTTCTCTAAAAAATAACATGCTTGTCTGGTGTTTGACAT
GAATATTTATTTTGTGAGACAATGCAAGTGATTTTAAGTTCCCAAATTATTTTAAGCTTA
ATAAGTTCAGTCTCCAATTGTGTGTCTATCTAGTCTTGCCTTTAGTTACTGCAGAGAAAG
ACCAATGAACAAGGCATGTGGGCTCTTGACAGGCAAATGGGAGAAATTAAAGCAGTACAC
TGACTGGAATGGTCAAATAATTTGTCATGTTTTAATGGGATGATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved