Mus_musculus Locus Mono:425:SNORA17
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:425:SNORA17
Mus_musculus
Mono:425:SNORA17
11
SNORA17
1001..1128
2128
TTTAGAAGATCACCCTTCTCAGGAAACAGAGGTTTTAGTGAAAGCCCCTCCCTGTTGCT
AATGGAGGGACACTGTGAAAATTTTGAGACACTGTTACTCCAAAATATTTTCTAAAGCTT
GCAAGTTTCTTTAATTCAAAGTCGCAGTGTGGCAAGATATGCTCTGGTGTATCTTTGTAT
TCTTCTGAATTCCAACACTGACTGTATAATTTTTAAATGAGATATGTAGAACCTAGCTGA
AAATTGAGACAGAAGCAGCTTGGGTGGGAGCAGATGCTATAATGTAAGGATGAGTTTAGA
AAACACACAGCACGGGATTTATTAACAGTAAAAGGACAAAACAAGGAAGCAATTGGCTCC
CCTATTACCATGTGAGCCTTGCAGCCCAAAGTGACACATGCTGTTGATTATATTTATATC
TCCATAAATGGTGGAGTGGACACAAAGCCAATGTTCAACAGAAGAAGAATGGACAGATAA
AATAGTGTTAAAATAGGGTTAAAACAACAAATGAAATTCCTATGCAACTCTTGAAAAGCT
ACAAGTACTGAAAAGCTGCATTAGACTGACTGTGACGGCTACCACCTATAATCCCAGAGT
CTAGGAGATTGAAGCAGGAAGATTGCTTTAAGCTCAAGGCCAGTCTGGTTAACACAGTGA
GATTGACTTGGTAACCTAACTACTGAGTAAGACCCTGTCTCAAAAAACCTAAAAAGACAA
TGGGAAGGAAGAAAAGAAGGAAGGAAGAAAGAGAAAGAAGGAAAGACAAGTTATAATAAT
GTGGGGAGATTAACAGGATATATAGATAAGAAAAAAGAAGCTGGGCTACAACAATGCAGA
AAACATATTATTTATAAACATGTAACATGTTCATAAAAGTAGAATACATGTTCATTTGTT
TGCATCTGAAAACAGAATAAGGAAGATATCAAATGGATATGTTTGTGGTCTTATGTGATA
TTAAAAAAAAAAAATTTAAAAAAGTGAGGTCCTGGCCTGGTCCTGCCCCTAGGGGCATTG
GTGGTGTGGCTGCTGTGTCACATGTCTGTAGGTGGCAGAGAGGAGAGAGGCTATGTCTAT
GCCCAGTGTTCTGACTAAAGAACATACAAATGAATAGTAACCTAAAATTTTCTGAAAACA
GCAAACCTGAGACAACCACCTCTCCCATACAGGGGCTCCAGAGACAGGAAGCTAATCTGA
GATGAATGTCAGTCTGGTATCATGCAAGCCTGGGGGGCAGACCATGCCTGAGATGACCAC
TGCTGGTCCACTAATGTACAGGTAGGGCATAGCACTCCTAAGATCACTCCTGAGATGACC
CCAGACCCTCAGAGATCCTGAAAGCCACTAAGAGGAGCAAGTAAGTGGTGGAGAAATGGA
GGAGAAACAGAAGGTTGTGGACACAGTGAAGAAAGGCAGAACTGTAGACTTGAAAGGTAG
TAAGGAGCAGCCTGATGTGAGTTGCTGGTGATACCACCTGGGATCACGGTGGGGTCCTGC
CACAATTGGGTTTATGGCCCTGAAACAACAGGGGTTGTTTCCTACCAAAGGCCAGGTAGA
TATCCTGGTCTGTGTTGCTTCTCAAAGTCATGTTGATGTCTGAGGGTTATGCAGAACTGG
CCCCATCCTTTAACTGGGGATAGTAAAGAAGGAAAGCTAACCCCAGGCCTCACCTGCTAT
AGTAGTCAGCTGGCCAGCACAGTAGAGCTGGCCTGATGGCAGGGGCCTGGGTGAGCTGCC
CCAAGGGCATGGGCTCAGGAGAGCCAACCCTACCTCTTGTCTGCTGGTCAGTGGTAAAGA
TAAGGATGAGATACCCCTCCTCCCCACCCGTATTCCTTACCATCTATGACAGGCAAGAGA
GCTGGACCAGGGGTCATAAGAGTGGGAGAGCTAGTCTCTCACCAGCTGTAATACTTGAGA
TAGCAGGTCCTGCATCCTTAAGGTAGGGATAACCCTTGTTGCAGGTTTACTAGGGAGCCA
GCCAGAGGGCTTGAGAGTACTACAGCCTGAGAGCTGACCAGCTCAGGTACCTCTCAGGCC
CAGATCCAAGGCTTTGAATTGGCTCACCCCAATATCGACTCAATCAGTGAACTGCTGGAG
CAAGAAGGGGGCTGGTCCTATAGATCCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved