Mus_musculus Locus Mono:205:SNORA16
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:205:SNORA16
Mus_musculus
Mono:205:SNORA16
X
SNORA16
1001..1133
2133
GCCTTTAATCACAACACTCAGGGGGCTAGAGGCAGTTGGGTCTGTGAGTTCAGGGCCAG
CCTGGTCTACATAGCTAGTTCCAGGACAGCCAAGATTACACAAATCCTGTCTTGAAAAAC
CAAAAGTAAAATGAGAGAGAGATACTATATAGAGATTTTGGCCTTCTCCTTCTCAGTGTG
GTGCAGATAATTTTTCCCTAAGAGATATTAGAAAGGAACCTGTATATAACCTTCCTGTCA
CCTAATTTATAAATAAGCAAAGGAACTCCCGTGGCATTATTAATGTACCACTTCTTCTCT
CCCCCCCCCCTTTTTTTTTGACAAGTTCTCTCCACATAGCCATGGCTGTCCTGGAACTCA
GTGTATATACCTGACTTGAATTCACAGAGATCTGCCTATATCTACCTTGAGTGCTGAGAG
TAAGGACTTAAAGTACCACCTCTTATCTCAGTCCTAGTTACATCAGAGTAGTGGGCTTGT
AAAAATTTAATAAGCTATACATTTACATAATGCATACCTTTCTGTCTTTATGAAACACTT
TAAATTTTTAGATTTCTTTTATTTTATGTGTATTAATGCTTTATGTTTTGCCTACTTGTA
TGTATGTGTATAATGTGCATGTCTGGTACCCTCAGAGGTGACATGAGATGTCATAGTCCC
TGAAACTGAAGTTACAGATAGTTGTAAGGTGCCATGTGGGTGCTAGGAATTAAACCCGGG
TCATGTATAATAGTAGTAAGGGCTCTTAATCACTGAGCAATCTCTCCAACCCCAAGTATA
TTACACTTTAATTAAAGGTTGCTTTTGTGGCTGGTGTTATGGTTAAGTGTGTAAGAGCAT
TTGCCACCAAGCTAGGGACCTAGATTAAGGAAGGACAGAACTGATTCCTGAAAGTTGTCC
TCTGAACTCCACACATGGGCCATGGCACACATCCAGGGGTAGGAGGTAAAGAAAAGATTT
TTTTTAATGTAGCTTCCAATTCCTTTCAAAAGAATTCAAGTGGCAGCCCTTATCAAAGCT
GCAGCTGTTTCCACATAGCTGATGTGGTCAAAAATAAGCCTCAAGTAACAGTTTTCCTTA
ACTGCCATGGTTCCGTTTACTGTAACACATCTAAGATTCTAGGGAAAGACAGGTCCATCT
TGACATTTCTGAGAAGGTCAGAGATGCTTGTTAACACTGGATACTCTACAAATGTTGAGT
CTCAAACATGGGGTTAGTTAGCAGAATAGGGCTTTCAGAAGCAGTTTGCTGAACCCAAGA
GCCAGCATAAAGGGGCAGTTGTAACTATGTTCACCCTGGAAAGCTCTAGCAGCACAGAGC
AATGATTTTTGGGTCACTGTCCTGTAAGCTAAGGCTAACCAGACCATTATGCTTCTGAAG
ACACTGTTAAGCTCATTGTAGATAACTGCATTGGCATAAAAATGCAATGAAAATTCAAAT
GGTATTTTTAAAGTTTAAACTATCATTTTTCAAATTAGAAAAATAAAAAACATTCAGAAT
TTAGATAAAATGAGTGGTAGTACAGTTCTTAGTTTCTCATTTGCCTTTTTTTTTTTCATC
TTTAAATTTATCTTACGTGCATATGTGCATGTGGGCCAGACATACATGCTCCAAGGAGAA
CAAATGGAAACCAGAAGACAACTTGCAAAATCTGGCTCTCTCCTTCCTCCATGGAGGTTA
CAGAAATGGAATGTGTTTGTCAGCTTTGATGACAACACCCTTAGCTGCTGAACCATTTTT
GCCTTTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTTTTGGACAGGGTAGCCCTGG
CTGTCCTGGAACTCACTCTACAGACCAGACTAGTCTTCAACTCCTACATCTGCCTGCCTC
TGCCTCCCAAGTGCTAGGATCAAAGGTGCGTGCCACCATGGCCCTGATCCATTCGAAAAA
TGCTGACATTTTATTCTGTATTTTATTTTATTCTATTTTATTTTGTTTTGAGACAGAATC
TCAGGTAGCCACAGCTTGCCTCAAACTCACTGTATAGTCAATGATAACCTTGAAGTATAG
TCAATGATAACCTTGATGACCTGTATAGTCAATGATAACCTTGAAGTATAGTCAATGATA
ACCTTGATGACCTGTATAGTCAATGATAACTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved