Mus_musculus Locus Mono:300:SNORA75
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:300:SNORA75
Mus_musculus
Mono:300:SNORA75
16
SNORA75
1001..1130
2130
ATTGAGGCAGTCTAAGTGGGACAAAGTTCACGTTTCTGCTCATCTATTGATCGTAAACT
TTTCAGATATACATAATATATGCCTGCATAAGGCATGAAAGGAGAAGAGAAACCACCCTG
TCTAGGAAACAAAGAGGTGCAATTAAAGAAAAAAAGGAAGGGTGGAAGGGAATATTTTCA
ATATATGTTATATACTGGAATGAAAATAACCTAATGAAACACAGTATAATCAAAATTTTA
CAACCCAAAACATACAACAAGAAGACCCAAACACCCATGAGCCAATGAGAAATAAATTAT
TGTGTCAATAAAGGTGGAACTATATAGTAAGTAATCAAAAAGAACAAGGATATTAAATAA
ATAATCAACCATAAAAATAATAGGTTTCAGAATACAGTCTAGTGGTAGGCTACTAGGATC
GCATGTGTGAAGCCCTTAACACCTGAAGAGATACAGTAATTATTTTTAAGATTTCAAAAC
ATGTGCGATGAAAGAGGTGAGTAGGGGTTACGAGTACTTGCAAAAGACACAAGTTCATCT
CCCAGCATTCACATTGGGTGACACAACTGCCAGTAACTGCAGCTCTAGGGGTCTTACACC
TGTGGGCACCTGTACTCATGGGCAAAGGCACAAATATACACATACAATTTAAAATAAGAT
AAATATTTAAGATTTCAAAAAGTAAGAAAAGACTTTAAAATATAATTAACTGCACACATT
AAAAATTAAAGAGCAGGGCTGGAGAGATGGCTCAGCAGTTGTTGGGAGCACACATTGCTC
TTACTGAGGTCCTGAGTTCCAGTCCTACCACCCATCTGGTGACTTACAACCACGCATGAC
TCCAATACTCTCCTCTGAGCTCCTCAGGCACCAGGCACACAGATGGTTCACAAATACATG
TGAGCAAAATGCTCTCACATAAAATAAAAACGAATAAGACTTTAAAAACTCTTAAATGTG
AATATAAAAATAAAATTACAAAAAAAAATAAAAATAAAAAGGTCTTTTCACTGAGCCCCT
TTCTGTCAACCGGTGGCAGATTATGGATTCGCACAAGAGGAGAGAGGTCACAGAGCTAGC
ACTTATCTTCTGTTTTTGCAGAGGTATATTTGGTTGTTGTGTGAGACACTCTGAGACACT
GGGTCCTTTCTTGACCTAAAGAGTACTGTCTGTGTAGTCACTCTATGTGGGTGACTGGTG
CTTATTGTGTCACTTTAAAATGTGCTTACTTAATTTAAAATGGGTGGGAAATTAATAAAA
AAATTTAAAAAAAAAAAGAAAAACAAAAAGATACAGAAGTAGAAAAGGTGGGGATGTAAA
TCAGAAGACTAGACGATAAATTCACATGCTGACCAATCAAATAACAAGACCAATGAGGGA
AAATGATTTAAGAAACATTACAAGTAAAATTTCCAGAGCTAAATAACCAAGATTGAAGGA
GTTCAGGGTTCCTGGATGATGACTCACAATGAAAGACATAAAATCACAGTCCTGTCACAC
TGGGACATGCACAGGCTTGGAGAGGGTGGACGTTACGGCTGCAGATAGACATCACAACAA
TGTTTTAAAGCTTCTAAAAGGAAAGTGTTTCCTAATGTCTAAAGCTTTCCTAGATGTCTA
TCTTGGGGCATTAACATGAAGAACTAAGGACATTTTCATCACTCACAGCACTGAACATTT
TATGACCTTTTCAGGCATCTAAAGAAGTAGCAAAATAAGTTTTTTAACTAAAAAAATATA
TTGTGAGAGCCTCGTGACACAGAGAGAGATGAAAAGGTCCACATACCATGTCCAAAAGCA
AACTCACGATGACAACTCTGGAGAAGAGAGTCTCAGGTCAGACTTTCCACACTAAAGGCA
TTTATCCTTTCTTCTTAGGAGCCTGAAATGGCAGATTGCATGTTTGGCCACATGTATTAA
GAAGAACACTAGACAATTAGCAGATGTTGGAATAGATTTAAAAAAAAAAAATGAAAAACT
TCCAGAGATTCATTGGCATTAAAGGTGTGTACCAAGGGTGTGTCTGCATTGCAGCCAGAT
CACACAGACATAGAAGGTCATTGGATGTGATCAAAGCAGTCATGATGCTGGATTAAAATA
CCTCTACACAAACTACTATGTCCAAGAAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved