Mus_musculus Locus Mono:388:SNORA17
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:388:SNORA17
Mus_musculus
Mono:388:SNORA17
12
SNORA17
1001..1129
2129
AGTCAAATGTGCCTGAGATTCAGCAGTTCAGCGAACTCCCGCTGATGCTTATCTTTCAC
AATAACATATTTTCAAACCTGAAAAGGGTATGTGATATCCATCTCAGGCCCATAGCAGGC
ACATCTAATAACCCCATCTCCGCACAGCCTCCTAACTGGAAGCCAGTGCTGCATCTCTTT
GAAATGAATTCTGTGTTAGTCATCTTCCAGACAGACTTCTTTTAAAGAATTCTTGGGCTC
TGCACATGGCTGCCATATCTGTTAGAGACTCTACAGCATATAGCTAATGAAGAGCCTTCT
CTGCTTCCTGAAAACCATATGAGATGCAGGAACTAGGAATATTTTCATTGGTTTCAAATT
TGGTTTATGCATTCCTCTTTCTTCATCATGTCAAGCTCTTTTGGATTGGCTTTTTATAAC
ATAAAACCACATGAAAATGTCATAGCTGATCTGTCACTGTCCATCCAGATGATGATGGTT
CCAGACTCTGGCCTGGAGCGGAAAGTATGTAGTCAGCAAGTATCCAAGTGCCCTTGGCCT
CTCCAGGAAATATGCCTTGGATGCAAGGGAGGCGAGACTCTGCTTCATCTGAGAAACAAA
GGACAGTTAACTTTCACCTTGTTGCTCTTCATGTTATTCTAACTTCTCTTGCCCTTCTGC
TCTTGTCATTCTAATCTACAAAACTCTGATTTTTGATAAGGATATCCTGCCAAAGAATTG
TGTCTTCAAAAACACAGGTCTGTAAACAGAATCCAGGTTTAAAAAGAAAAACTAGCACTG
AACATACTAAAGAGAAATAGAAACTAAGTAAGATTAAGTCTAGGTCTTTTGAATCTTCAG
CTTGTAGTAAATAAAAATAAAAGAACCCACATTTGAGTCCAACACTAGGACTCTGTATTC
AGGACTCTGACATTTAAAATAGTACAATTGAGGCTTAATTAAGTCCATACACCAAACCAA
TTATAATTTGCATTATGAAGTGAAACCTTAAAATATTAAAGCCTGCCCCCAGAGAAACTG
CAGGTGTGGCTGGTATGTCACATGTAACTAAGTAAGTAGCAGAAAGGAGAAAGGCTATGT
CTATGCTCAGTGTTTCCTATAAACATCCGAACGAACAACAGCTTAACATCCCCCTGGGAA
AAAAAAAACAGCAAGTATGAGATGACCACAAGCCCAGGACCAATAAGGTCTGGGTGAGCT
TCCAGGACAGGGAGCAAGCCTGAGACTAAAAGAACTCTACCTGGGGCTTCCAGCCCTAGG
CAAGAGTAAACATGAGACAGACAGCCCCCACAAGGGGTCACTTGTACAAGAAGCAAGCCT
GAGATGACCACCAGACCAGAGCCATGAAGGCCTGGGAGGGCAGACCATGCCTGAGACTAC
CCTTGCCTGGTGCCATAATGCATGAGCAAGGTATAGCACTCCTGAGAGGACTCCAGACAT
TCAGAGACTCCAGGCATCACTAAGAGGAACAAGTGGTAGCAAAACTGAAGAAAGGGAAAA
GAAGGATGTGGGCACAATGAAGGGAGGCAGAACTAGAAACTTGAGGGTAGAGAGGAACAG
TTGGTTGTGAGTAGCCAGTGATGCTATCTGGGACTGTGGTGAGGACCTGGCCTGTGATAC
CACCACAGCCTAGATCTGGGTTCATGGCTCTGCATTATCAGGGGTCTGCTACCACCAGGT
GGATGGATGTCCTGGTCTGGGCTGCTGCAGCGAACATGTTAATGTCTGAGGACTCTGGAA
AACTGGACCAACCCCTCACTTGAGCTTTGTGGGAGAGCTGCCCCTGAATGCATGAGAGTA
GGAGACCTGACCCCACTCCTAGTCAGCTGTAACACTCAGGAGAACAAGGGCAGCACAGCT
AGATCTGGACCTGAATGTGGGGTTTGCAGGTGAGCTGACCCAAGAACATGAGTATGAGAA
AGCCAGCCCTGCTTCTTATCTCCTCTACCCTCCATTTTGCCCTCAATACTCTTTGGGGGC
AGGAGAAAGAACTGGCCCCAATGGGGTCATTAATGTAGGAGAGCTGTCACTTCACCTCAC
CTAATGCAGCAGTGAGAAAAGTAGTCTCTGTACCTCACCTAAGCAGTACAGTACAACTGA
CCCTGATGGTGGAGGCAAGGGTGAGCCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved