Mus_musculus Locus Mono:221:SNORD23
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:221:SNORD23
Mus_musculus
Mono:221:SNORD23
10
SNORD23
1001..1109
2109
TAAACATTATCTTTTATAGTATTTGCCTTGGTCATAGTGTCTCTTCACAGTAATAGAAC
ATGACTAAGTATGTACACATGTACTTAAGCATTAGATCTATTCTCCTTTGCAGGTGACAG
GATAGGAAGGAAAGGCAGGTGACAAAAGGTAGAGGGATCCATAATTTAGGGCCATAGTTT
GGTCATTACAACAACAATAAAGTGTTTACAGGACACAGTTAGCTCTCTTGGGACAGCAGG
GTCTCTCTTTCCTCTTGAACTTTCCTTGTCATAATGAGACCATTAGCAGATAGGCTGTAG
GTTTGTATATGTGTGGCCCAGGAAGTGGCACTATTAGAAGGTGTGGCCTTGTTCGAGTAG
GTGTGGCCTTGTTGGAGTATGTGTCACTGTGGGCATGGGCTTTAAGACTCTCATCCTAGC
TGCCTGGAAGCCAGTATTCTGCTAGCAGCCTTCAGATGAAGATGTAGAACTCCCAGCTCC
TTCTGCCTGGATGCTGCCATGCTCCTGCCTTGATGATAATAAACTGAACCTTTGAACCTG
TAAGTCAGCCCCAATTAAATATTGTCCGTATAAGAGTTGCTTTGGTCATAGTGTCTATTC
ACAGCTAAGACATAGGCCTACTATCACCTCTGTTTCCTAAGTATCTATCTTGGTAGCCTC
AATACAAATGCTTTAAAAAGAAGTACAAGGTAGTTTTTGTTTTACGTATATCTTTATGCA
TCTCTTTGTTATGTCTTGCAGTGTTGGAGATCAGATGTGATACTTCATGCATCCTAGACA
AACCCTTTACTGTTGAGCTATATTTCCCACCTCCTTCCTTTCCTTTCTTGGTTTTGAGGC
AGTATCTCACTAGGTTGTCTCTGGCCTTGTAACTTGTTCTGTAGTGCAGGCAGGACTTGA
ATTTGAGATCTTCTTGTCTCAACCTTCTAGGCTGCTGGAATTAGTGACTATACTACCAGG
CCTGGATGTTTTTTGCTTTTTGTTTTTAAAGATGTAATTTTTGCCCAGTGATGATACCAT
CCTGGCTCCTTGTGCATTTTGAGGCTGGGGATGACAACATAGCTTTTCTTGGGACAGGCC
AGCTGGACAACTGCTTGAGGCTTGAGGGCACAGTGTCCTGAGAGTGGGTGGGGGGGAAGC
TATTTAGTTAGTTAGTTTGGTTGGTTGGTTGGTTTTGTGTGTCTGTGCATATGTGTAAGT
ATCTGAAGATGCAATGGGAAGTGAACTTGGGTTCTTGGAAGTGCTCTAAACCATTGAGTC
ATTGGACCAGCCCCTATTTCTGTTCTCTTCTTTAATTTTCTTTTTCCCTTCCTTCCTTCC
TTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCCTCCTTCCTTCCTCCCTCCCTCCCTCCC
TCCCTCCCTTCCTTCCATCCTTCTTTCCTTCCTTCTTTTCTTCCTTCTTTCCTTCTTTCT
TTAAACCAAATAGATATAGATTTATCTATCTGAGAAAGAGCCAAGAGGCTCCAGGAAGGA
AATATGCCCAATTATTTCTTATAGCAAAATAATCCTTGGTTTTATTAAATTAGTGAGTTG
ACTTCCCTCTTTTTACCACGCAATATTACTTGTTCAACTTTGTGATCCTGACACACTATG
GAAGTGGCTGAGTGCAGTAGGCAGTGTCTTTTCAAATGAATTCAATAAGAAGACAAATAA
TCTGGCCCAGTGAGCCTGGCCCTGGGCTCTGCGCGGGAATCATTGGCTCCCCCTGAGCAT
GTGAGAGGGCTGCACGGCTGCAGTCCCATCATCTGGGCTGCACTCTGGTAACAGTCGCTG
CCCTCCTCTCTCCTCTTATCTCCTTTAAGCCTCCTGATACTGGTTTCCTTCCTTTCTAAT
TGAATGTCTAATTTGTAGCATCTGATTGTCACAAAGAACACCTAAAACTTGGTTTGATCT
TCTTCCCCTCTCCCTTTCTGTGCGTGTATGGGTGTGCACACACATGGGTGGTAGACATCA
GATGTATCTCCTCTATCATTTTTTTTTTTAATTTAAAATACTTTCTTTGACAGTTTCAAG
CATATCTACAACGTGTTTTGGTCATGTCCACCCCAACTCTGTTACTACCCCAGACTCCAC
CAGCATGTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved