Mus_musculus Locus Mono:176:SNORD86
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:176:SNORD86
Mus_musculus
Mono:176:SNORD86
14
SNORD86
1001..1086
2086
ACAAAGAGAGGCCTGGAGAGATGGCTCAGCAGTTAAGAGCACTGACTGCTCTTCGAGAG
GTCCAGCCACATGGTGGCTCACAACCATCTGTAATGAGATATGATGCCCTCTTCTGGTAT
ATCTGAAGACAGCTACAGTGCACTTACATATAATAAATAAATAAACATTTAAAAAAAGAG
TAAATCATAGTTGGAGATGTAACTTAGTGGTAGAACTCTTGCCAAGACTATAACTGTGTG
CGGTGCTGTGCACCTTTAATGCCAGCACTCCCTATCTCTGTAGTTCCGGGAAGACAGGAA
TACATAGTGCAAAAAGAAAGAAAAGGAAGAAAGAAAGGAAGGGAGCGAGGGAGGGAGGAA
GGAAGGAAGGAAGGGGAGAAGGAAGGTTGGTTTAAGCTCCAGCATTGAAATAAAAAAGAA
TAAAATCATAAACAAATCATAACCTTAGGAGATATTTTCAAAACATATCCTTGATACTAC
AATCTTTTTTACTTTTATTTTTAATTGATTTTTCTATTCTTTTGGTTGTCATCTTCCTCT
TCCTTTTCTCCTCCTCTTCTTCTTCCTCCTCCTCCTTACTACAAAAGGGTTTCTCTGTGT
AGCCCTGGCTGTCCTAGAACGCTCTGTGTAGACCAGGCTGGCCTGACAAGAACCTCCTGC
CTCTGATTTCTGAGTACAGGGACTAAATGCATGTGTCACACCTTGCCTGTTTTTTGTTTT
GTTTTGTTTTGATTTTACTATTCTTTAACACGGGGGCTCCCTGTCTCTCAGTATGTCCTG
AAAGCCACTGTGTAGCCAGACAAACTTTAAATATATACCAAACATCTTTTCTCCATCTCC
TAAATGCAGGCATTATGTGTACCACCAAGGCTGGTTTGACAGAGTATTGGTTTTGATTTT
GTTCTTTGTTTTGTTGGTGGTGGTTTTGTTGGTTGGTTGGTTTTTAAACAGAGTCTCATT
ATGTACCCCTAGCTGACCCAAAAGTGGACACACGAGTGGTGATTTCATCAGAGAACACAA
AAGAACATTCTTAAAACTAAATAGCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTG
AGTGATTCCCAGGGCCCAGCAAAAAGGGACCGAGATTCCAGAGCCCTGAAGACAAGGGGT
AACACACCAAAATATGAACTCATTTTTCATTCCACCTTCATTGGTCGAGCAGCTGCAAAG
AACAAAGGCCGTATCTCCCAATACCTAGCAAACAAATGCAGTATTGCCTTGAGAATTGAT
TGCTTCTCTGAGGTATTTTGGAGGAAAACTCCAAGAACAAGTTGAGGAACGGCTGTCTTT
CTATGAGACTGGAGAAATCCCACAGAAGAACCTGGATGTCATGAAGGAAGCCATGGTTCA
GGCAGAGGAAGTGGCTGCTGAAATCACCAGAAAGCTGGAAAAACAGGAGAAGAAGCGCTT
GAAGAAGGAAAAGAAGCAACTGGCTGCACAGGCCCTGGTCTCGTCAGAAAACAGCAGTAC
CCCAGAGGAGTGTGAGGAGGTACATGGAAAACCTGAGAAGAAGAAGGAGCTAAAACCCCA
GGAGACCCTACAGGAAAATGGAATGGAAGACCCACCTGTCTCTCTGCCTAAAACCAAGAA
AAAGAAAGCTTCTCCCAAGGAGGAGTTGACCAGTGACCTTGAAGAGATGGCCACTAGCAG
TGTAAGTGCTCCTAAGAGAAAGAAGTCCTCACCTAAGGAGGAAGTGACCAGTGAACCAGA
AGAGGAGGCAGCAAGCCCCACCATCCCTAAGAAGAAAACGAAATTTTCTGAGGAGCCTGT
AGTTGCTGCTAACTTCACAAAGAGCAGCACAAAGAAAAAGAAAAAGTCCCAGAAAGCACA
TGAGGATTAGAACGGACCTGCTTGATGGGAGGGGCATACCTTATGATGGCAGCTCCTGCC
CATGATAAAACCCCAATAAAAACACAAAACCAGGGGGGGGGGGTGGAAACCCTGAATAGA
ACGTATGCATTACTGGCTAGCAGCTACACAGGGAACTTGCCTAAGTGATGCAGCACAAGC
CTTACCATTCTTTGTTATGCACAAAATCCACATTCTGGTTGGCACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved