Mus_musculus Locus Mono:220:SNORA73
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:220:SNORA73
Mus_musculus
Mono:220:SNORA73
10
SNORA73
1001..1210
2210
GAGGAAAGCTCAAACGGTAGAGAAGCTCTTGAAGAAATGTTCAACATTCTTTGTCAACA
GGGAAATGCAAACCAAAGTGACACTGATAGTCCAGCTTACACCTGTCAAAATGATTAAGA
TCAAACACACAGTGACAGCTTATGCTGACAAGGATGCGGAGCAAGTGGAGCACCCCTCTA
TTGCAGATGGGAGTGCAAACTTGCACAGCTAACTTGGAAATCGGTATAGTGATTCCTCAG
AAAATTGGGAACTGATAATCTTCAAGACCCTAAAAGACACTTGATCCTACCACAAAAACA
CTTGCTCAATTACAGTCATAGCAACTTTTATTTGTAATGGCCAGAAACTGGAAACAACTG
CGATGTCCCTCAACCAAAGAATGGAGAAAGAAAATGTGGAAAATTTACACATTGGAGTAT
TACTCAGCTGTCAAAAACAATGACATCATGCAATTTGCAAGCATATCAGTGGAATTAGAA
AAGATCATCCTGAATGAGGTAACCCAGACCCAGAAAGACAAATCACGGCATGTACTCACT
TAGAAGTAAATATTAACTGCAACAAAAAGGATAAAATCATTTATAATCCACAGACCCAGA
GAGGCTCGCTAATAAGGAGTGCTCAGGGAGCATGCAAGGCTCTCCCTGGGCAAGGGAGTA
GGATAGATACTGTGGGAAGACTGGGGACAGTCAGCAAATGTTCTGTAATTTTACATTTTG
ATTGTAAATATTCCCTATGGCAGGGTTGAAGCAGGGCACATGATTTGTCTTGAAGGAGTG
TGGGGTCGTGCTGTTTTGTTTTAGCAATCAGAACTGAAAAAAATGTAAGAATTTATTTGA
TTGAGTTTTGGTTATTAGTTTTTTTAAAATGATTTATCTTTGTTTCCTGTGTATAAGATT
TGGCATACATATTTGTGGCCCTAACATGAAGGGTTAGAGTTGACTCTCTGAATTTAAAGA
AGGCAATTATGAACTTTCTTAAATGCCATCTGTGTTTTTCTCCAATGTAGTCATACTTGG
AAGAAGAGGTCATTCTTCCAGGATCTGTCCTAGTGGCAGAGAGGAGCACAGGGCTCTTCT
CTACCGAGAGCCATCCTTGTCCACAGTGTTGGTGAGGAAGCTAGGCCTGGAGTCTTTGAC
TGTATGTATCTAAGACTTCTCACAGTTCTGTGGACAAGTGACTAAGGACACAACCCTTGC
AGAAAACAATATTTCATCAATCCACACGAATGTAGGTGTTTAAGAAGAAAGTGCTTTGGT
ACATTACTGTATTGATAAAGATATTTCAAAATCTATGCATATCTTGTACCTTTTGTGAAT
TGATAGAAAGTGGTGGTGGTGGTAGTGGTGGTGATGATGGTGATGGTGATGAAGATGGTG
ACGATGGTGATCATGGTAACGATGGTGGCCTAAGGGCCACACTTCAAGGATCAATATTTA
CAAACAAGCCTGTACTACGACTGCAGGGTTCTGAAGAATCCTCTCATCCTGATCTTGGGC
TGAAGCATCCACTTCTTTGGTAATCGCTTTGTGTCTTCTATTTGACCACAATGATCTTAT
TGGAATAATAGTCCTAGGGAAGTTTCTCCAATATATTACACTACTACTTCTATCCCCTTT
GTTAAAACCCTACAACAGGGATGAAGAGATGGCTTAAAAGCCCAAGAGCATGTACTGTTC
TTGCAGAAGACCTACCTTAGGCCCCTAGTGACCACATGGCAGCTAACAGCCTTGCATAAG
TCCAGTTCTAGGTGATGTGCTGTCTCTTCTGGTCTCTGTGTATGCCAGGTTTATATGTGC
ACATACACATATGTATGCAAAATCTTATACACAGGAAATAAAGATAAATCTTTTTTTAAA
AAAACTAATAACCAAAACTCAATCAAATAAATTCTTACATTGTTTTTTTTTTTCAGTTCT
GATTGCTAAAACAAAACAGCACGACCCCACACTCCTTCAAGACAAATCATGTGTCCTGCT
TCAACCCTGCCATAGGGAATACTTACAATCAAAATGTAAAATTACAGAAAATTTGCCAGA
AAACACATTTACAGTGTACAACATAAAATTACAGTAAAGAAGTATGGTTTAAACATTATC
AGTGGTGTGTCCACTGGTAGGCTTTAATATTGATGCTTCTAAGTGTGAAGTCTACTCTTA
TGAAGAGTTGGGCCATTGTAGATGTAGACAACCAGGGCAGTTACATTTTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved