Monodelphis_domestica Locus Q0QEQ0_MONDO
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica Q0QEQ0_MONDO
Monodelphis_domestica
Q0QEQ0_MONDO
Un
SNORD59, SNORD59
1765..1839, 3320..3392
7828
AGTAAGGGCTAGGTGATGCAGGGTAAGTGACTTGTCCAAGGACATAAAGCCAAGAAGTG
TCTGAGGCCACATTTGGACCCTGGACCTCCCATCTCAGGCTTGACTCACCATCCAGAGAC
ACCTACCTGCCCCTATCAGCCCAAAGCTTTTGTTTCCCTCCCCCTTTCCCAATTTCCCCT
CTTAATCTGTACCTAGTGGTTTCACTGTTATCTCACCCGTTAGATTGTGAGTTCCTTGAG
GGAGGAGATTTTTCATCTTTTTTTCCTTTCTTTGTATCTCCTGGGCTTGACCTGGTGCCT
GGAGCATAACATTTATACAAACTTGTATTATTTATATTAAATATATTTATGCTATGCTTA
TCGACTTGCCGTGAAAAAGAGGAGAAATTGCAGGGGGGTAGCCCCAGCCAGGAGACTACA
GATTCCCTCATACAGGTCCATTAGTGTGGCCAAAGCTCTAAAAGCCCCCTGAAGAGAGGC
AGGCTCTCAGCTCTCACTAATGGTACGTTTAAAAATTAGATACCAGGCCCTGGAATAAGG
TGGGGAATTACAGAAAAGACGAAGACCCCAGGAGGGCTCAAGGATCCAACCTAGGACAGC
CTGGCTGCTGTCTCATTCTACTGCCTTATTTCAAGGACCCGATCCCCTAAGAACGAAGGT
CTCTCAAAGGCCCAAGGGCAGTCAAAGACAACCTGCGAGTATCCCAGAGGCGCCCTTCCT
CTTTCACAGTAGTCCCTCCCACTGCAACTGACACTCATCTGGACCAATTGCCTTCTCAAG
CTCAATCGCAAGTAACATCCAATGAAACTGAGCTACCTGAGAGTGGCAGCGGCTCTGACC
AACGAGAGAAGAGCTGGTAGACTTTGCCCTATGGAAGCTTGGGCTAGAGTAAAGAGCACA
GCACTAACCCAATGCTAGCACCGGATCGGGCCAGAGTTCCACCCCTACTGCTGTAGAGTC
GGCTTCCTGAGAGGGGTGCTGCGCTCAGTCTCTCCCCAGACTCCGCCATGTTGGGGCTCT
TGGGCCGCGCTGTTGCCACCTCGGCCTCAGGGGCCCTGCGGGGCCTCGGCGCTTCGGCGC
CGCTGCCCCAGGCTCAGACTTTGCTACGGGCGGCCCCGGCCGCGGTCCAGCCGGGTGAGT
GTAAGCGTTTTCGGAGGCCAGGCCCATCCTAGGCCGACCATGACCTTGAGGCGCGCTGGG
CCTGGCGGCGCCGGAGCCCGAGGGTTGGAGGGAGGGAGCGGAGGAGCCCATCACTGCCCT
CCCCCTATTGGGTGAGGAGGCCGAGAGGGCGCCGGGACCCTTGCTCCCCTTTCCAGGACC
TAGGCCCAGGGCGCCTCAGTGACCTTTCTGCGGCCCGCGGGGATGGCAGCTGGAGAAGCT
GAGAGTGCGCGGCCGCGAGCCCACAGGCCTGCCCCATCTCAACCGGGAGCCCCTTCCCTG
CAGGCCTGCAGACAGGAAGCCCGGCCTGCATACGCTCGCCAGGACCCTCGGGTGACCTCT
AACTGTCCTCCGTCCCCTCCCCAGCCCGGGACTATGCTGCTGCGGCCCCCAAGGGCGGGG
CCGCCAGTGGGCGCATCGTAGCGGTCATCGGGGCCGTGGTAGACGTGCAGTTCGACGAGG
GCCTCCCCCCCATCCTCAATGCCCTCGAAGTGCAGGGCAGGGACACCCGGCTCGTTCTGG
AGGTCGCCCAACACCTGGGTAAGTGCAAGTTTTCTTACTGCGGGGCTTGACATTGGTTGC
GGCATCGAGGTGTCACCTAAGCTCTCTTCCATGATGATTTCTAACTAGATGACTTTCGTT
CTTCTGAGTTTGCTGAAGCCATGCTTAGAATCTGAGCAAGAGAGTTCCACCCGGCTTGGT
GGGCTTCCTCATTTACTGGGGTTTGGGTGCTCCTGGCAGAAAAGACCAGGCAGAATCCCC
GGGAATAGGATTAGATGAGTCTGTGTAACTGGTTTTACCCCAACTGACAGGTGAGAGTAC
AGTCCGGACTATTGCTATGGATGGTACTGAAGGATTGGTGAGAGGGCAGAAGGTCCTGGA
TTCTGGTGCTCCAATCAAGATTCCTGTGGGGCCTGAGACTCTAGGAAGAATCATGAATGT
GATTGGAGAGCCTATTGATGAAAGGGGTCCAATCAAAACCAAACAGTGAGTGCTAGGAGC
TCCAGTTTCTTTAGAGACCTGTTGCCATACTGTTTCCCCATACAAATTACATTTTAATAT
ATAATGCACTGTGTTGCATTCCCTCCTTAAGTAAATTAAGTCAAGTAAATATTTTAACAG
TTAAGTAAAGAATAGAATTTCCAGTGAGGAATGTTTATTTTAATTTATATCGTAATTAAT
GTTAATAGTATGTGTAAGCTAGATGGTCTAAGTATATAGAGTATCAGGCCTAGAGATGGG
AGGTCCTAGGTTAAATCTGGCCAACACTTCTGGCTGTTGACCCTGGGCAAGTCACTTAAC
CCTTACTGCCCTTCTGTCTTAGAATTGTACTGATTCTAAATCAGAATGGAAGGTTGTTGT
TTTTTTTTAATAGTGTATAGTTGATTTATTAACATTGAATAATTATGATAAAATTCAGAA
CAAAGGTGTGGAAACCTCAAGAACATAAGCACCAAAGATGTGATTATTTTTTCCTAGCTG
GAATTAAAATATAAATTTGCATTATTTATCTAAATTCCCAGGACTTTGTGAGAGGGGGGA
ATACTGGTATACAGAATAAGGGAATTTCTTGATGTGTAGTGCTTGGAGAATCCTTAGCCA
GGAAGGATTTCTGTATCACTAGAGAACAACTCAAACTGATCTTTTTCTATCCAGGTTTGC
TGCTATTCATGCTGAGGCTCCTGAATTCATGGAGATGAGTGTGGAGCAAGAAATCCTGGT
CACTGGCATCAAAGTTGTGGATCTTTTGGCTCCCTATGCCAAGGGTGGCAAAATTGGTAT
GTTAGATGTGGGGAGTATTTCAGTGTTTTATATATCTGACAGAACATGCTGTGGATAGTG
TGGTACGGGTAGAGTAAGAGACGAGTTCTGACTTTGCCACTAGTTAATGTCTTTACAAGT
CACTAGTTGTCTGAGCTTTCATATACTTGTTGTTTTTAAAGTTGAGAGTTACATTCTGTG
ATTTATGATCAGGGTGATAAAAAATGGATTAACAAGCATTTTCTCAACCATAGCTTATGG
CTCACATAAGCAGTGTTTGATATGACAAAGGTTCCTGAGAACTTAAGTCAGATTCTTTCC
ATTTTGGTGATGTTGTCAAAGACAAGTTCTGTGTAGCTGCTCTTTCTGGTTTTGTTAGGC
GTTATGTTTTAGAGCAGCATCCTTCACTGATGAGTAGCTTTCTGACTTTCGTTCTTCTGA
TTTTGCTGAAGCCAGATGCCACTTCTGAGAAGGAAAAACAAGGATCATTTAGTGTTTAAG
GTTATACATCCTTTTAAAATTAGGGTATCGATCCTTGGAATTTAAGAATTGCATCTAAAA
CACTTGGGCGTTCATCTCTCCACAGGTCTATTTGGTGGTGCTGGTGTGGGTAAGACTGTG
TTGATTATGGAGCTGATCAACAATGTTGCCAAGGCCCACGGTGGTTATTCTGTGTTTGCT
GGTGTTGGTGAACGGACCCGAGAGGGCAATGACTTGTACCATGAGATGATTGAGTCTGGT
GTCATCAATCTGAAGGATGCCACTTCCAAGGTGATCCAAACGAGGCCCCCCCCCCCTTTT
TTTTTTTATAAAACCCTTACCTTCCGTCTTGGAGTCAATACTGTGTATTGGCTCCAAGGC
AGAAGAGTGTTAAGGGCTAGGCAATGGGGGTCAAGTGACTTGCCCAGGGTCACACAGCTG
GGAAGTGTCTGAGGCCAGATTTGAGCCTAGGACCTCTCATCTCTAGGCCTGGTTCTCAAT
CCACTGAGCCACCCAGCTGCCCCCAAACATTGGAATTATTATTTTTTTTTAAACCCTTAC
CTTCCATCTTGGAGTCAATACTGTGTATTGGCTCCAAGGCAGAAGAGTGGTAAGGGCTAA
GCAATGAGGGTCAAGTGACTTGCCCAGGGTCACACAGCTAGGAAGTGGCTGAGGCCCAAT
TTGAACCTAGGACCTCCCGTCTCTAGGGCTGACTCTTAATCCACTGAGCTACCCAGCTGC
CCCCGAGGCCCCTTTTTTTCCTTCACATTTTATAGAACTTATCTGTCTTCTATAGTTTGG
AAGTTGCAGATGATCCATTTTAAAACATTTTTCTTAGAGGGATTTGGTTTGGATCATATA
AAAAATAATAGTAGCTCAACCTCCTAACTAACACTCAGGAGCCTATGCCACATAGACTTT
TCTTGACTTGGTCTTGGGCCAGAGAGTCTTAGGTTTGTATATTGGCAGTTTTTGGTGTTT
TCATGAGTTGTATGTCCATCACAGGTAGCGTTGGTGTATGGCCAGATGAATGAACCACCT
GGTGCTCGGGCCCGGGTAGCCTTGACTGGCCTCACTGTGGCTGAATACTTCAGAGACCAA
GAAGGTCAAGATGTACTGCTTTTCATTGACAATATCTTCCGATTCACTCAGGCTGGATCA
GAGGTAAGAAAGGAGATGGGAGATTTAGGGTGGGGGAGCGGTTAGAGGAGAAAATTAAAT
GGAGCTACAGCCGTTTTGAGCCTTGGTTTTCTTCCCTTCTCTCCTTCCAGGTGTCTGCTT
TACTAGGCAGAATCCCTTCTGCTGTGGGCTACCAGCCCACCTTGGCCACTGATATGGGTA
CCATGCAGGAAAGAATTACCACAACCAAGAAGGGCTCTATCACCTCTGTGCAAGTAAGAG
AATTTTAAAGTCTATTCTATATGCTATTTCTCCACCTCCCCAGCCCTCCATAAAAACATG
AAGACTGGAAATGACTTTAGGTCTGCTTTTTTTTAAAGCTCTGTAAACATTTTAATTACA
CTTTGGAGTGATTTATAGCTTGAAGGAATCTTAAAGGATCTAATCCAGTCTTCACCTCAT
AAATGAGAAATAGGCCCAGAGAGCTGCTGAGTGTCTTAACCTGAATTAATCTTGGCTATT
AGAGCTAGGATTTAACATCAGAACTAGTGTTCCTTCATAGTACTGTGCTGCCTACAAAGT
TTTGGACTCCTGTAAATCTGGGACTATTCCTAGGTTCTTATAGCCTTAATGCACAAGAAG
AGGGTACGTACTCTACCTAAGCTGGGCCACGAATTCTGTGCTGCATAAAAGTGAGGAGGA
GAGAGAGTCAAGGGTAGCCATTGATTCTTTCTCAGATAAGTAGTAGGAAGGGCACTTGAT
GGCCTCCTGAAGACCTAAATTCTAGGCTTGACTCTACCATAATCTGCTGTGTGCCTTTTG
GACATTTCTGCTGTAGCACATGAAGGAAGTGAAGTAGATCTCCATCAGCTTCTCTCTTTG
GTGAAATATTAGAAGAATTTGAATTATTCTGGGTTTGAAAAAGGTATCCCACTTACTAAC
AGTGTGAATTAATCCAAATTAGGCCATCTACGTGCCTGCTGATGACTTGACTGACCCTGC
TCCTGCCACCACCTTTGCCCACTTGGATGCTACTACGGTGCTGTCCCGGGCTATTGCAGA
GCTGGGCATTTACCCTGCAGTGGATCCTCTAGATTCCACTTCCCGAATCATGGATCCCAA
CATTGTTGGTAACGAGCACTATGATGTTGCCCGAGGCGTGCAGAAGATCCTTCAGGTGAG
CACTCTTGGAAAGGGATGTAGAGTAGAGACTTGGAGTGAGTAGAAAGAGATCAGTGTCAA
ACCACTAATGTTGGGAAAGGAATAAAATCTCAATGCTGTGCAAGCTGTGCTGTAGTACTG
TAAAGTGCTGGAGCCTGGAAGGGCCTTTCTAAATAAAAGCCCTTCTACTAGAGCAAGCTC
CAATGGACATTTTTCTCCTAGGACTACAAGTCCCTCCAGGATATCATCGCTATCCTCGGT
ATGGATGAGTTGTCTGAGGAAGACAAGTTGACAGTGTCTCGTGCCCGGAAAATCCAGCGT
TTCTTGTCACAGCCCTTCCAGGTTGCTGAGGTATTCACAGGACATATGGGGAAGCTGGTC
CCCCTGAAAGAAACCATTAAGGGATTCCAACAGATCTTGGCAGGTAAGAAAACTGGAGTG
AATGATCTTTATGTATGGAGGCATCTCCCAGAGACGCCTGGCCTTTTCCAATGAAGGCAG
CCACCATTTTCCTCTTGAGCTCTGTGACTTATTTTCCAAGCGACTCCCTGGACTTAGTTG
CAATTCACTCCTCTTTTGGGCATATCTCTGAGCCTCTCTGGTGGCCTCCATTCTAAATGA
TCTGACTCCCAGGCTCTCTTTCAAGGGACACTCCTTAAGAACACCCCAAACTTCCAGAGT
GCAGCTCAGCTCAGGGCAGAACGCTTCAGTGACTATTATCAGGGTTACTTCTAATTCCAT
TCTTTGTTTATTCTTTATACTATTTGCCTTCCTTTCCCCCTGCCCTGTGTTTCTGTGTCC
AGAGTTTCCTTCCACAGATTAAAAGACCCTCTTTTGTTTATGTTGTGCTGGACATGGTCG
ATGGTGGGTGGCCCCTTACCTTGCCTATGCAGTCTCCTCAGCTGATGTCCTGGGACCTGG
GTGTCCTTGGGTCCGAGTGGGCTGTGGTTGCCCTGTTCTCCCTCCCCCTTCCCGAGTTGA
GAGCTGGCCACAGTTCCTTCCATTTAGTGGGTGCTTTAACAGCAGAGCTTTCTTCACTCC
CGCAGGCCAGTACGACCATCTCCCAGAGCAGGCCTTCTATATGGTCGGACCCATTGAAGA
AGCCGTGACAAAAGCTGAGAAACTGGCCGAAGAGCACTCGTGAGGTGCCCCTGCACCCAC
CACCGTGTCCTCGCCTACCCCTTCCTCTGATTCCACTTGGCTCAGCAGAACTCCACAAGA
ACTTTATTGGGAAAGCTGTGTCCCTTCGGAGAATATTTAAATTTGGAATAAAATTGACTG
GTCGCCGCTGTGTGTGTGTGTGTGTGCGCGCGCGCGCCTGCGCAGAGTGGATATTGTGGG
TTAGAATCCAGCGCTAATCCTTCTGGGTTCTTTCATGCCTGCCCTCAGCTGGTGTTTGAC
TCCTGCCGTGCCTAGGGAGAGTCCAGGTTGCCTGTGGGATCTGAAAGGGTTAAATGAGGC
CGCGGTCACAAAGGAGGTTAGGGGCCCCGGGGGATGCTCCATTTCCCATTATTTCCCTTC
AGAAAGCTGCTCCACTTCCCATTCTAGCCTTGCAGCATCTTGGCACCCGGGACACCAAGT
TTGAGTCCTTCCGCGCCGAGTTAATTCTTCTAACTTGGTACCATTTAAGGAGCCTCAGTT
GCTTCACCTTTAAAAGGGGCCCCTGGCCAGGATTTCCCAGGGAACGCTAAAGCCCTTTGT
ATACAAAGCGCCACCAAGACAGCATGTTGGGAGTGCGGTTCCCGGAAGAAGCCTCTAGGT
GGGACTAGTGGTCAGGCCCTGGGTGTTGGGGAGGGAGCGCCACCCCGCGCTCCTCCGCCC
CTCCATGGACATTGGCACAGGCCCGGCAAGGGTGACCCGAAGCGCCCCAGTTATATCACC
CCGCCTGCAGTCCTAGCGTCGGCTGAGGACGGATAGAACGACCGAAGGAGGCCTCACCGC
AGCTGCTCGGGCTGCTGGCTCCGCCGCGGCTCACCATTTTGAAATCTTGGAAGAGCCATT
TGCTGGGCTCGGCTAATGATTGTTTACAGACCAGATGGGGCTCTTATCCCGAGGCGGAGC
CGGGTGAGTGCAGGCTCCGCCCCCCGAGCCGGATGACCGGGCCGCTCCGAGCTCCCTTCC
AGTCAGTCCGCGGGGACCCGAGATGGGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 1524..1697, 1970..2144, 2814..2935, 3505..3689, 4404..4562, 4670..4792, 5482..5694, 5901..6102, 6725..6828
1001..1133, 1524..1697, 1970..2144, 2814..2935, 3505..3689, 4404..4562, 4670..4792, 5482..5694, 5901..6102, 6725..6819
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved