Monodelphis_domestica Locus ENSMODG00000014054
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000014054
Monodelphis_domestica
ENSMODG00000014054
X
SNORD61
1209..1285
7781
GTGGGCGCCATTTTAGGTGGCTGGTGGAGGGAGAAGGGAGAAGAGGGAAGGGGGGGAAG
GCTATGGCGGGGGTGGGGTGCGGCTCAGGCCTAGTAGCGGCCTGTCCGAGCGGCGCGGGA
CCCTGCTCCCCGGGCTCGAGAAACTCCTGCCTAGTGGGTTGGGGGGTGTTGGGGGAAGGA
GGCTGACGGTCCGGGAGCGGGAAGTGCTAGGGAAGCGGCTGGGGCCTCTGAGGCCGCTCC
CTGACCGCTGGCGCGAGGAGGGGGAAGGGAGGGGAAGCGGGCCCAGGCGAGGTGCCGGGC
TGTTTCTAGTCGGGACTGCGGCCATTTTGTGTCACAATCACGCGGTGGCGGCCCGAGCCG
GCCAGTCGGCCCTCCCCCCCCCCCACCAGCAGTGGGGGGAGAGGGTGGAGCTGGGACAGA
GCCCAGGCAATCCTTTATTTTCTTCCTTCCCGGCGGGGGCCCGTACTGCCGGGGCCCAAG
AGATTCCGGGGCCGGGGCTGCTCCGGGAAAGCCTCCCCCTCCCCCCGCTCCCCGTTCCCT
GATCCCTATTTGGCCCGCTTTGGGGCCTTACTCAGTTGCAGTCTAGCCCTGCTGGGGCCT
GGGCGCCCGCGTTCTTGAGTCCTTGGTGTGCCCTTGAACCGTTTGGCTGCCTGCCTTTTA
ATCCGGCTCAATTTGGGACAGCTGGGGGAGGTGCCCCATTAGCTCTGGGGTGGGGCCTGG
GGGGGCGACGAGGGGACTTGGCTCGGACCAGGAACTTGGGAGCTATGAACAATGCAGGGA
GGGGGCTGCACGTGACGGGATGAGCTAGTTTGTTACTGTTGGGAGAGTTTTGAAACTAAC
TCATTTGGACAGCAAACTTTCAGGCTGCAACAGTCTCCGTTTTGTATCTTATTAAAGAGA
AGTCAGAACGGTTTAGTTTTTTACTCTGCGTGTCTGCAAGTTTGGAGAACCTAAATTGTT
TTCTCTTGTGTGTGTTTTGTTTTGCTTTTGGTGGACAGAATATAACAAAGTCAGAATGGT
TGAAGCAGATCGTCCTGGGAAACTGTTCGTAGGGGGTCTCAATACCGAGACCAACGAGAA
GGCTCTTGAAGCTGTATTTGGGAAGTATGGGCGAATAGTGGAAGGTGAGATAACTAGTTG
AAGACACATTTATTGTTTTGTTTCTTTCCCTCCCCCCCCAAAAAACCTCCCCAAACCAAA
ACCGGCTGGGCGATGATGAATGTCAATTCTATTGAACTTATGAAGTGATGATGTATTTGT
TGTTTACTCTAAGAAGTTCTGAGCTGCTGCTTGCTGCCTTTAAACGGGGAGGGGGCACAG
CGGCCGCAACAGCAGCATCGGTTTTTATGGGTTAATATCAAATTAGAATGAATCCTTTAT
TTCTCACTCCCGTGTAGTACTCCTGATGAAAGATCGTGAAACCAGCAAATCTAGGGGGTT
TGCTTTTATCACTTTTGAAAGTCCTGCAGATGCTAAGGATGCTGCCAGAGACATGAATGG
GAAGGTGAGCTATAGTCATAATATACACATAATGGTTTGCATCAAACAGAGAAAATACTT
TAAACTGCACTTAGTATTTCATTTGTCTCCGTTTGCCAGTTACATAAGTCACCAGAGCTA
GAAATGTTATTTTCAGACCTGGTTTATAAGCAGAAGCTGGTAATTTTCTGCATGCCTCAC
ATCCAATTTTCCAATAGTTTTGTCCTACATAGTAAAACTAGCATCATGGGGGTGGGGGTC
AATCACAAAAGATATAGAATGTGGGTTTGACTATCTAAAGTTACATAACCTAAATACCCA
TTTGTTACATAATCTTAGACTACTTGGAGGGGGAAGAATAGGGAAAGAACTGCTCTTTTT
TTAACTACTATTACATCTGCATTACATGCATAACATTATCTACAGTTAATTTTTAGCTCT
TAGGAAGCATTCAAATTAGATTTATCAACATCTCAAGGTGTAGGACTATAGATAATTCCA
TTTTCTGAGATAACATATATATTAAAGGGCAAATTAAGCCAATATAAAAAGCTTGAAAGA
TATAGGAGGATATTTTCTGGGTGAATTGTTTTGACCAACCTCCATTTGCACAGTATTCTA
TGTTTAAAAGCTTGCCTAAAAGGGGGGCACATTGGAGAATACTACTTGGTTCCAGGTATT
GGTCTCATTACTTCAGAAAGTAGATCTAGCATTAATTAATGCTATATTTGCTGATCTGAA
CCTTTTTTTTTTTTAGCTTCTGGATGGAAAATCAATTAAAGTTGAACAAGCTACTAAGCC
AACATTTGAAAGTGGTGGTAGGCGGGGGCCACCACCTCCCCCAAGAAGCAGAGGCCCTCC
AAGAGGCCTTAGAGGAGGAGGACGAGGAGGAAGTGGTGGAGGAACAAGGGGGCCACCATC
ACGTGGAGGACACATGGGTATATTTTCTAAGCAGCTTTTTAAAAGTATATGGGCAAACAT
TTTGATAAAAAGAAAACACAAACTTGCACAGAAATTCATAAATGTTGTATTTGTACTTAA
GACTCCCAGTCTTCCAAAATGTAGTTAGGAGCCTAAACTGTATTCCTTTTTGGTCCAGTT
GTTCCTTATCTAACTGATAAGGTCCAGAAAAACAAACAGTCCCTTCAACACAACCAATGC
AAACTTAAGAGCTCAATAACACATCTGTATGAGTGTTTGGAGAAGATAAATCAGCCTTAC
TATGCAGCTGGGGAAAAATGGCTAGCATTTCACCACAGGGAAATGAGAATGAATTTTCCT
TTTATGGTGCTATAATGAGTTCACACACTCCACCCTCTTTAAAACTACTTGAGCATGCGT
TTAATGGAGATTTAAGATTCACTAACTAAGAATGGAAAAAATCTGCATGCGAAAAGTATG
TGGCTGAATGAATTAGTCTAAAATTCCAAATTCCATCTAAAATCCTACCACAGCTCTTGG
TAACATGGAATAGTTGATAGTTTGTGGCTGATAGCCAGGTTTTATGGCAGACAATGTAGA
TTCTTCAGACATTATTTGTGCTATATCATAGCACATGGGTAATTGTCAACTGATTTAACT
TTTACTTTTTTTTCCTAATATAGATGATAGCGGATATTCTCTTAACTTCAACATGGGGTC
TTCCAGGGGACCTCTTCCAGTAAAAAGAGGCCCACCACCACGTAGTGGCGGGGGTCCTCC
ACCTAAAAGATCTGCACCTTCAGGGCCAGTTCGTAGCAGTAGTGGAATGGGAGGAAGAGG
TCAGTTCTATAGGTTGCCTTTCTGTAAATTTTGTTGCTCAAATAACATAGTTTGGATTGG
GGGATCATTCAGATAACAAATAGTTCATCTGCATAGTTCTTTCACAGTGAGGCTCTTGAA
ACGACTAAGTCCATGAGGTGTTGGTTGGCTTAGATAGAATCTTCAGAATAGGAAGGGATT
CATCTTAATGAAATCTGTACCTATAGACTGAGAAGAGACTAGATGAATGCTTGTAGATCA
TTCTATTTTGGGCTATCTTTTAATTGGTTTTCCTTATTGAACTGAAGGCTGCCTCTGACT
TCCATCCATTGTTCTTAGTTCAGCCCTCAGGGGCCAATGAAAAGGAGCCAAATCTCCTCA
CATGAGAATTATCAAATATTTGGAAGACTAGCACATAGGCAACACCCCTCCCCCCACCCT
CAAGACTAGGCTACATATTAGATGGTTCAATGGATCGTTGTTTTTGACTTTGCTCTTTAA
CAATGTGCTTCTATTAATAGCCTCTAAGATCTCAGTTGGCTGCCACATCCCCTTTGATTC
ACATTGGGCCTGAGTCATATCTTCCCTATCCTGTACATTTTTGTACACGGTTGACCACAA
ATTATGAGACTTGAACTAAGTGCCTACTATGTGTCAGGCATAGTGCAAAACAAGTAAAAA
TAAGTTATCCGCTGCCTTTTAAGGACCATCATTCTTAGCAGTGGTTACATTCTTGACCCC
TTGGATCCCATTTCTATGCCTTCATGTAATAAAAGAACAGGACAGGCTCCAGTTTTCAGT
TGACTAGGTCAACTGACTGATAAGACTTATCAAGCCAAGGTTATCTGGGTGGCATCACCT
GACAATAATACAAAAAAGAGAAACTTAATCTGTCCCTTTTCTTGCTGTGAAACTTATCTG
TTCACAACTTATCTCTTTAAGAAGACATTCTAGAATTTTGCTAGAAATTGACTCTCAGCT
GAACTTTGGATGGCTTGTGTTTTGAAGCTACTCCTATTTGTATGCCATTGCACTTTTCAT
GTACAGTGACTTGACAGTCCCCCTTTTGCATATATATAGAGTAGCTGGAATTGGGTGTGT
TAAGAACAGCTAGAATCAACCACGTCTTACCTTGCTTGATGAGGAAATGGAAGCTGCCAT
TTTGAAGCTTTGTCCTTTGGTATAGAGAAAATGGAGGCAAATAGGACTTGAGCAGTGCTT
CTCACTTTGTTCATCTGCCTTTGATCCATGTCTCTTGCCCCTTTTTGGGGCTCAAAAGTC
CTTACAGCTAAAATACAGATAAGGAAACAGGTTCAGAAGACTCCCTGCCCATAATCTCAT
CTCAAGTTATCAATGGCAGGATTTCAAAAACCCAAGTTTTAAAAGTCCAGTCTCCTACAA
ACTCATTTTTATGAGTCTTAATGTGCCAGAAATCAAATTAGGGGAAACATTTCAAGTGCT
TAATTAGCAAATTTAGACCAAATCTGTAGGTCACCTGGGCCAAATCTATACATAAGTGAT
AAGAGAAAACCAAGGTTGGGGTGACATTTGAACTCAAATGTTAAAAGCCCAGGCCAGAAT
ATGTGATTTGGATGATGAATGTTGTACCTGTTGTACATCTTCTATGTGCATTTTATATAG
CTGGATATAACGTGGTAGCCTTTCCAGAATAAAGCTGGATATTTAGGTCATTTCAACACA
TTTCTAAAATGCTTAAATCTTTATTCTTAAAGCCATGCCATCTGTTTTAGAACCAATAAT
TTGTTCATAGGTTCTGAGGCAGAAGAGCAATAAGGGCTAGGCAATGGGAATTGTGACTTG
GCCAGGATCACACAGTTAGGAAGTAACTGAGGCCATATTTGAGCTTAGGACCTCTTGTCT
CTAGGCCTGGCTCCACTGAACCACTTAGCCATCCCCTCTTATGCTTAGTCTTTAACAGAA
TGTCATTTCAAGGGGATTTAGGAATATGTTGAACTTTAAAAAACTAAATTAAAAACTTAG
AAAACAATTTGATTTTTAGGTAGCATTGCTTTCAATTGAGTATACTGCCATTGTTTTAGA
TAAAGTTTTTTGTTTAAAGCTCCAGTTTCACGTGGGAGAGACAGTTATGGAGGTCCACCC
CGGCGGGACCCAATGCCATCTCGAAGAGATGTTTATATGTCACCAAGAGATGATGGATAT
AATACTAAGGACAGGTAAAAGAAAATCCCAGTTATAACTTCTGAAGAACCTTTTTTGTTT
GTTTTAGGCACTCGGATAACACATAGTTGTTTTATTTCAGCTATTCTAGCAGAGATTATC
AAAGTTCACGGGATAACAGAGATTATGCACCACCTCCAAGAGATTATGCATACCGTGATT
ATGGTCATTCCAGTTCACGAGATGACTATCAGTCTAGAGGCTACAGGTATAGGCTTGGGG
ACACATTTTACTCTTGGGGTCTTTAACTAAACTTCTGGGACTTGGGAGTTACTCCAGTGA
GCTATTCCTGAAGACTCAATACTTCTGTATCTTTAATTTAGTGATCGTGATGGCTATGGT
GGTCGTGATAGAGATTATTCAGATCACCCCAGCGGAGGCTCCTACAGAGATTCGTATGAG
AGTTATGGTAAGAATTGAGTTTGAGGGTCTCTTTAAGATAAATTTATCTGTGCTTAAAGT
CTGTAGACCATGTGGACCAGTTTCAGGCTGTGCTTGCTTTCAAGGGATTTTTGTTTGCAT
TGTGGGGTGAACTGGCACATTGACATCTTTTTTAGTTTGAAGGGCCTTGAAGTTTTTTTA
AGGAATTTAATCTTCAGGCTTTTTGCTTGCTTTCAAGGGGATGGGGGATTTGCTTGCTTT
CAAGGGTAAATTGGCAGTATTATGTGTTTTCCCCCCCAACAGTGAAATCAGTACTTTTTA
AAATGCTAATTGACAAGATCAAATATTTACCATTACAATATGAAGCAAAGTCTACAGTTG
CAACTTACCACTGGACAAAATGGCTGAGTTTCTACTGTAAAATAAACAACCTGTTCTGGA
ATGTCCTTAAACGATGCCTCTTGAAATACTCTACAGTTTTTTCAAACAAACGTAAAGCAT
TCATTATTTCGGCAGATGAGCAATCCCCACTATAAATTACCAGCAGTGGCAGATTTTACA
CCTCCACTTGAAAAAAAAAGTAAACATGTAATACAGGAATTCTTTATAACTATTGTGTAT
ATATAAGATTTATAGTGTTGCCATATTACCTGACCATTGACCCTGCAGGTAACTCACGTA
GTGCTCCACCTGCCCGAGGGCCCCCGCCATCTTATGGGGGAAGCAGTCGCTATGATGATT
ACAGCAGAGATGGATATGGTGGAAGCAGAGAAAGTTACTCAAGCAGCCGAAGTGATATCT
ACTCAAGTGGTCGAGGAGATCGTGTTGGCCGACAAGATAGAGGGCTTCCCCCTTCTATGG
ATAGGGGATACCCTCCTCCACGTGATTCCTATAGCAGCTCAAGCCGCGGAGCACCAAGAG
GTGGCCGTGGTGGAAGCCGATCTGATAGAGGAGGAGGCAGAAGCAGATATTAAAAAGAAA
AACCTAAGTTTTTGGACCAAAACCCCCTTTCAAAAAACACAAAGCAAGTGGAACTTGTTC
TTTACTACCAGAGGACTACTAAAAAAGAAAAAAATGTTTTTACTTTTTTTTTAATTGTTA
AGTTTCCCCTCCATGATTTTTATGCTTTTGTGAAGAACAAGTTAAAGCAATGTTTAATTA
CATTTGAAATTTGTTTATTTCTTTCCAAAAATCAGATGTTTAAAATGTGTGAAATTTGAG
CTCTGTGTTCTAGTGTTGTAAGTTTCGAAAGTAAAGTTTCCCTGAAAAGCTACTTCCCAA
CTGATTTCCTGACAATTGAGACAAGCAGTTCTTAAGACCTTCCACAAACATCCAACCATC
TAAAATGGAAATGGATTCTTCTACTTGTTCAAACCTATCATTCTAAACCAATTAGCTATT
TTCTGGAGGGTGGTTGGGGGTTGTCCTGCTCCTTAAGATTTCAGGTTATCCTTTTGAAAA
CTGAAATCTATACAAGAATTCCCAGTATATCAGATGCTTAGTGAGGAAAAAACACTCAGT
AAACTTGAAACCACAAATGGATAGTCATGACTATACTTTGCCTTTCTTCCATTTCTTGTG
AATCTGCAAGACCAACCCCCCCAAATAAAAAAGCATTTACATGTATTAAACAACTACAGA
ATTCTAAATAAAAAGGTTTGACCGGTTCCAACAACGAAGCTTCAAAAAATGATACTTGCT
CTTACTGTTTCAAATTTTTGCAACTCTGTAGTGTCTCACTTTTAAAGGAACAGCTTGATT
CCAAAGGCAAAGGAGAAAATAGATAAGCAAAGAAGTTTAATCTTCAACTTCTCAAAGGCT
AATGACTTCTAAAAACAAGTGACTCTTTCAGCATTCCACTTCAGATATAAAGCATCAAAT
GCCTGTGAAACAGCAAAGATGGTAAGCAAAGCAAACTAGTTTTTCCGTCTAAGTCAAAAT
TGAACCAAAGTATCTTCCTCATAGTACAGCGAGACATGGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1123, 1397..1503, 2236..2416, 3083..3238, 5299..5413, 5500..5625, 5741..5826, 6468..6781
1015..1123, 1397..1503, 2236..2416, 3083..3238, 5299..5413, 5500..5625, 5741..5826, 6468..6769
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved