Monodelphis_domestica Locus DKC1
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica DKC1
Monodelphis_domestica
DKC1
X
SNORA36
4533..4661
8994
CAGCTGGAAGTCTCGGGGCCAGGGGCTGGCGAGGGAGATTAGTAAGCAGTTCATAAGAA
TGAGAACCTCAGCCCGTCATTTCCTAGCAGAGGAAAGTGCGGAAAGCACGCGCCGAGGCT
AGGCCAGGGTCACTCACACTGGGACATAGCGCCGAGTGTGTCAGAGCGGGAGCGAGCAGA
GCCTCAGGGCCCCGCCCGGCCGTTCTTCCGGCCGCGCGCCCCGTGCCCGAGCCCCTTGGC
CCGCCCTCGGCCGTGGCGACCAATCAGGCGGCAGCGTTCTGCGCCGTGGTCCCGCCTCCA
GCCGCTGGGACGTCACGCGTCGACCGGAGTGGGTGGGCTCGTGGCCCGCACTGCCTCACG
GGACGGAGGCGAGCTGCCTTCAGTCTTTTCCCTGTGCGCTGGGCCGTAGCACGCGGGCTG
GAGGTCCCTGCTTGTAGCCACCAACATGGCGGACAGCAACGGTAAGAAAAGGCCCCATCT
TGAGGCGGGAGGGGCCGCTGAGGCCTCCTGGTTCCGCGCAACGTTGGCGTTCGTGCGGGA
GCGGGTCACGCAGGGCCCTGCGCGTGGGGGGAACTGGGCCGATTGCCATTGGCCGGGGCA
AGGCCTGAGCTGGGCGCGCGGCCGGGGTGGGCCGCGCTGCTCCGCCTGCGGAGGGCCCGG
GGCCACTGTTGTCTGGATCCCGTCAGCAACGATGTGGCTCGGCGCGGCCTGGAGACGCCC
AGCCCCCGAACTCTATCGGGCTTAGGGCGCTGACAGGCGGGCCGCTGAAGCCGCGCGCGC
CGTGCCACGCCGGGCTGGGAGGGGGGAGAGGCGGCGCCCGCCCGGGATACATTTTGTTAC
TTTGACTCTGTTGAACTTGAGTGGGGCGGCGGCTGGCGCGTGTGAGCCCCGAGGCTACAG
CTGGCAGACTGGCTGGAGAGACCCGTGTTAGGGGCAGACACCCCCGGAAGCCGCCACGTG
GTGGCCCAGAGGAAGGGAGCACGTGCGGGTGGCCTGGGTCCCTGGGGACACTCACTGGCG
CCTCTCCTTTTCCGTTGAAAGTGGTCGGCGTGGCCAAGAAGCACAAGAAAAAGAAGGAGC
GCAAAGTCCTGGGAGACGCGGCTGTGGCGGTGAGTAGGGTCCAGGGCCGGCCTCCCTCCC
TCCCTCCGGCCCCCTGCGGGCCCCCCAGCCCTGCTGAACTTCCTCTCCTCCCTGCTTAGG
AGCTCCAGCACGAAGGGGAATTCTTCATCAAGCCCGAGTCCAAAGTAGTTCAGTTGGACA
CGTCTCAGTGGCCCTTGCTGCTGAAGGTGAGGCGAGCGGGCGGGGGTTGGGGCGGCCCTT
CATTGCCACTCACTCTGGGCCGGTGCTTACTTATCTGCTTCCTGTCCCGCTTTAGAACTT
TGACAAGCTGAACGTAAGGACCACCCACTATACTCCCCTCCCTTCCGGATCGAACCCTCT
CAAGAGAGAGATCACGGACTACATCAGGTAAGCCAGCCCTGGCACAGCCGCGCGCCTCCT
TCGGCTTGAAGCGGGTAAAAAACTGTGTGGCTCCACGCCTGACCAATATGGTGGCAAGAC
ACATGCTCTGCTTCCCCAGCAGCAGGCACCTGGTTCTCCTACTTCAGGGAGAGAGGGAGA
GAGTGAACAGCAATTGCCCTGTGGCCATTCTCATCTCTGCACACCTGAAACATTCCCCGG
CACACCCACTCACCCAAAGGGCCCAGGCCTGGGGCGGGGAGGGGCGGGGCGGGGTGGGGT
GGGGTGGCATGGCATGGCTGGGCGGGAGGCATCAGGCACACTCCTCCCCATGCTCCAGCA
GGCCCAGTGACACAAGCCATTTTCTTAGGAGGGGTCTGTTCCAAAGCAATGGCAGACAAG
CACCCACAGCAAGCCAGTCGACAACGTGTGCGTTCTGCATTGGGCGTGCACAACGTGTGC
ATTTTGCCAGTGCGGAGTTTGGTCAGAGTCCATGGAATGCCCAGCTTACTGCTTGGTCTA
GACTCGATCTTGAGTGCAGCCCCTTGATTGTTGTCTGTTCTTGGCACTGTGTGTAAAATA
ATCTGTCCATCTCTATTCTTTTTTTTATTGTAAACACATTTTTTGTACCAACGCCCAATA
AGGATAATTGGGTAAAATCGGGACCTTGAAGAGAGACAAGGAAGCAAAAAGCGGTGTTAA
TAGCCGACTGACGATGAAACAAACCATCACGAACTAGTCCAAGTACCAAATCAGAAGAAA
CGAAAATCTGACGCTAGCTCCCTCCGCTTTGGGTTTGCTTCTAGTCGTCCCACCTGCCGC
TAATGTTCCCGATTCTTTGTTTAAGTAGTGCCTTGAGTTTGGGGCAATTGCAAAGGCATT
TTCAAACAGTTCAGCGAAGTTAGAGACCAAACTCCAATTTTTAAAAGGCGATGAGCTGAA
AGAGTTTCCCAAATACTGGCTTGTGTGAGTAAAGGGGAAAGTGAGAGTTGTTCTGAATCG
ACCTACAAGGTGAGCCCTCCCCCGCAGCACAGAATTCTGGCTAGCCCGTCGTTTCCCTGC
CTAGTTTTGAGCCTTTACTGCAGACCACTTCTCTTCTTGGCTCTCTTTGGTGCCTTTTGG
AGCCATTTGGTCTGCCAACTAGCGGGTGGGCACAATTCAGGTCTTGGGGTGGTGGTTGTC
TCGGGAGCCTTGTGCTGTGTGTGGTAGGGGAAAGCGGCGGTTATACTAATGTCTTAATGA
TTAAAAAATTCTCATTCTAGGACAGGTTTCATTAACCTTGACAAACCCTCCAATCCCTCT
TCCCATGAGGTAGTTGCATGGATCCGGCGAATACTCCGGGTTGAGAAGACGGGCCACAGT
GGTACTTTGGATCCGAAGGTGACTGGCTGTTTAATTGTGTGTATAGAACGAGCTACCCGC
TTGGTCAAATCTCAGCAGAGTGCAGGTGTGTTGGTTTGTTTAGAAGCTTGCCTTCTGCTG
GGGGGGGGGGGGACCCCAGGACTGCCCCGAATGCCTCCCTCTCCCACCACCAGGAAGGGG
GAGGCCCTCGCCTCATTGCTGCCGCCTCCTTTTTTCCAGGCAAAGAGTATGTGGGAGTTA
TCCGACTGCACAATGCTATTGAAAGTGAGGTTCAGCTTTCCAGGGTAAGCTTTCGTGGGT
CCAACTGCTCTTACTGGGGAAAGGCAGGCCCCTTTTTCTGATGCCCTGCAGTTGGCTCCT
GGAGGTGTTTGCAGCTCTCTGAGCCGTGTCTGTGACTCTATACTTTGTATTTACTGTGTC
TCTGCCTTTATTTGGCCCAGTGCCTGGTCCCTGTTGCTGCTTTCTTGGCTTTTCCCAAAG
GGCATCTGTCAACTGGAGATTTTGTTTCATTTCTCCAGCTGGCTGCTACTGTTACATGAG
AATCGCTGTTGCAGCACACAGGCGCACGGTTACATTGTCTCAGGCCCCTCCACCCCCGGG
CTTCTCGTTCACCTTCCTGGGCCCTCTAGGCTTCTAGGCCACAGATGTATCATGGGATGC
CAAAGACCATTGAACCTTAGGTTACTGAGCTGTAAGGCCCAGCCTTTGGCTCTGTTTTCC
TTAATGACAAACAGACATCAATGGCTTTTTCCAGAGCTCTTGGCATGTGCATATGATGAA
CAGTTTTTCTTTCACCCATCCCTTCTGTCTTAGTATCAGTTCTAAGGCAGAAGAGCAAGT
GTCAAGGGCCGGGCAATGGGGGTGAAGCGATGTGCCTAGGAAGCATCTGAGGCTCCCTTT
GACTCTGGGCCTGGCACTGTGTCACCCAGCCGCCCCCTCGCTGTAGCTGAAGAGAAGAGA
GGGTGCTTTAAACTTGCTGTCTATGCAAGTGACCTGGTCTCCATAGTAGATGGAGACACC
CAATGCGATCAATTACACTTCCAGTCTAAATTGTTCTATTTGGTTGGAGTCAGAGATGAG
CAGATGTTGAGGAGGTCATTGGTCCCTGCGGATTGGAAGCTTCCACGGGGACGTGACCCT
TTTCAAGGGTGCTCTGGATTCAGATCAGCCTCTTGGATGCAGGAGCTGAAATTTTGGGGG
GTGGGATCTGCTGCTTGTGTGTTGTGCTTAAAGCATCTTTTCTTTTCAGGCTCTGGAAAC
TTTGACAGGAGCTCTGTTCCAGCGACCACCTCTCATTGCTGCTGTCAAGCGGCAGCTCCG
AGTGCGAACTATCTATGAGAGCAAGATGTTGGAGTACGACCCAGAAAAAAGATTAGGTAA
CTAATCAGCCGTCGCTATGCCTTCGGCTCTCCTTTGGTCACTTGCAATGGAAAATAGTGG
GGGAAACCCAAGCATCATCAGTGGATGCTGCAGAGGCAACAACCCAAAAAGGCCATTGGA
TTATGGACTTTGCTCATCTTACCTACATCGCAGGTATCTTCTGGGTGAGCTGTGAGGCTG
GAACATACATTCGCACATTATGCGTCCACGTGGGGCTGTTACTGGGAGTTGGAGGCCAAA
TGCAGGAGCTCCGTCGGATCCGCTCTGGAGTCATGGGGGAGAAGGTAGGATGGAGATGTG
CCCAGGAATCCCATTTCCTCTTAGGGTGGAGCCATCCAAAGTGTTGAGTTCAGCACAGGG
AAGTTCCCCTGTTCTGTTAATTAACTTTGGAACATTAAGAACGGCCGGGGAAAATGAGGA
TAGAAAAAGACTTCTATCCTTTTTGTCACCCGGCCTACAGTCTGCTCTGGTGTCCTTGCG
GTGTGCCCTTAACTAGGGTGCCTGCTAGGTGGATCTGGGACCCTGGGATACTCTGCCACT
TGGCAGTGTATTGGAGGTAAGTACTTTCTCACAAGGGCCACGAAGTTGGCTGTGAGCCCA
TTTGTCATCCCCTTCTGTCTTCCAGGACCACATGGTGACCATGCACGATGTATTGGACGC
CCAGTGGCAATATGACAATTACAAGGATGAGGGCTATCTGCGGCGGGTCATTTATCCTCT
TGAGAAGCTGTTAACATCCCACAAGCGGTTGGTCATGAAGGACAGTGCGGTATGTTCTGC
TTCTTCCCAAGTTGGTCTGTGCTTAGGGCTGCTGGGGCCAGAGCCTCTAGAGGTACCAGA
CATGCACCCTGAAGTGGAGCTGGGGTGAAATCAAGTGTCAAGCAATCTGACCAAGCCTTC
CAGCTCTAACCCTGCCCCCCCCCCACCCCCACCCTTTTTTTAATTTTTAAGAATCCTCAG
AATGAATGCTTTGCTATTGGGGTTAAGTGACTTGCCCAGGGTCACAGCTAGGAGATATCT
GAGGTCAGATTTGAACCCAGGCCTGGTTCCCAATCCACTTTCTTTCAAAGAGGCTGATGA
AGTTTCTTTGCTTAGGAAACCTTTTGGAATGTTCCTCATGTTGTCACCTGACCCCCTAGC
TGAGAAGCTGGTCATCTTTATGGTAGCTGAATCTCCCCACCCCTGAATTCATATCTGAAT
TGGAGCAGCAAAATCCTCGTACCTGGGACGGGCCTTGGGTTGGAGCCAGGGAGACCTAGT
TTGGGGTCCCTGCTGACTAGGCTCACCCCAGAGTCTAACCTGCCACAGAGAGTTGCCTCT
TGTCTGAGGGAAGATCCTACAAGACCCGGTTTTTTTCAGCTCTCGGTTCCTTCCTCCAGG
TCAATGCCATCTGCTATGGAGCAAAGATCATGCTTCCTGGGGTTCTGCGCTATGAGGACG
GCATTGAAGTCAATCAAGAAGTTGTAGTCATCACGACCAAAGGGGAAGCCATTTGTGTGG
GTAAGAGATGGGAGAACTTTTGCTGCCAAGAGACAGGCTGAAAACCTTTGCCCACTTCTG
ACTCCACCAGATTGCAGTTAGGTTGGTGGAGTCCCTAGTAGAGACAGACTTTGGAAGCGC
TGCTCTTCCCTCCTTCCTGTGTAGCGAAGGGGCAGCGGCACACTCCCGGCAGCTTGCCTG
CTCCCTGCTTTGGTTTTCAGGGACAGATCGGGGAGAGTTGTTGAAGGATCAGAAATGAGT
CTTTGTCAAAACGTTAGAGCTGGGAGCTCCCCACAGTGCCTGAAGAGAGGAGCCGTCTGT
CTATAGGCCGGAACGTTGTCCAGAAGCGTTCAGCGGGTGTTGGCATCCTGGCTGTGCTTC
TGGTAGTCCCTGGCATTGCCCCTCTTCCTTACAGCTTTGGGGAGTGAGCCCATAAAATTG
GGACTAGGATGTTGTCCCCTTCTTTGGGGGCTTTCCTTAAAGCCCAGATTCTGCTTCCAG
GCTCCTCTGAGTTCCAAGATAGAAGAGTGGTAAGGGCTAGGCAATGGGAGCAGCCAGCTG
GGAAGTGTCTGAAGCTAAATTTGAACCCTGACTTCTCTTCATCTTAATGTGGTGCCTGGG
GGCTGGGAGCTTCTTGTAGGGAAAGGAGATACAGCTAGATAGATATATACTACTACTACT
CCTACTCCTACTACTACTACTATCATCCACAGAGGTGGACCCCTGTATGGAAGTGTGTCA
TCTGGTAACTGCAAGGGGGAAATCTGGTCCTGTATTGTCACCTACATCGCCATGGGCTCT
GGTGGCAGTGATAGGAAGGAACGAGTGTCATCCATGGAGGGTTTGCCTCCAAGTGTGTCC
TCTGAAGGGCTGTCATTCCAATTTGAAGAGAGGTGCTTAAGGTGGTTGCCAGGACAACCC
AGTTTGGGGAGGTTCTGAACTTGGGAGTGCAGTGACCGCCCCCCGCGCCCCTCCCCCCCC
CCCATTCTCTCTCTCCTCTTTCCATAGCCATTGCCTTGATGACGACCGCAGTGATCTCTA
CCTGTGACCATGGTATCGTGGCCAAGATTAAGAGAGTTATCATGGAGAGAGACACTTACC
CTCGGAAGTGGGGTCTGGGCCCAAAGGTGAGTTGGATCCAGTGGCGGCCTGAGGGACACC
ATTCTTTTGGGGACCTGCCAGCCAGCCCTGGTGAGAAATAGTGGCATCTCTTTGGGAAGG
CGCTCCGTATAGGAGGAAAACCACTGGTGTTGATATTGAAGCTGGGCAGGTTCCTCCCTG
AAAGCTTTCCTTGGGCTGCTGTTCCTCTTGGTGATTAACTTGGGAGTTGTGCGGCTGCTG
GGGGCAGGCTGGCAGCTGGTAGGCTGGCCTGGGTTTGATGCCCGCTGAGTAGAACAAAGG
AGCTGTGAGGAACTTGACAATAAGGGAAAGAGGAACAGTGACAACATTGCCAACATTTGA
CTGCTTAGAATCCAGTGGCACAAGGGGGGAGGAACACCCTTAGTTGTGTGGGTTTTGTGT
ATATAAATGGAGCCCGGTGTCCACGGGACATTGGCAACTGATGGGTTTCCTGATTTGGCT
TTGAAGCACCTCCATTGTCTTGGTAGCTTGGGATGGATGGGAACATGTGGGCTCAGTCTG
ATTGGGCGGCGCCAAGTCTGCTGGCAATCATTCAAGATGCTGGAGAAAAATGACTGCATC
TTCAGGCTCCCAGGCTCCTTTGCTGCTCACTCACTCAATCCCTCTTTCCTGCCCCGCCAA
CTCTTGGTTTGGCCGCTTCAGCTCCTTCTAGCCAAATTCCTTGAAGGTGCCTCCTCTCTG
TCCTCTTCTTTAGCCTCTTATGTGCCAGCTTCCACCCAAACAACTGGCAAGTTGCCAGAT
CCATGGCTTTTTCTCAGTCCTCTTCCTCCTCCTCCTTGCCCTTGGGCTAGAAACAGAAAG
TGCCTTTTGGTGTTCCAAGGCCCTACCAGCCCATGTTCTCTCTTGCTGTCCCGCAAGACA
CCATGAATTCAACAGGCCAAACCCTTCCCTTCTGTCTTCTCTTAGAGGAGCAGAAAGGCC
TAGGCAGTTTGGGGTTAAGTGACTTGGCCACAGTCACACTGGAAGTGTCCGAGGTCAGAT
CTGAACCTAGGACCTCCCAGCTCCAGGCCTGCCACTAAACCAGCTCTCATTAATGATGTG
ATGGTGAAGCTTGACTTTTTCTTTCTTCATGAGGCAAGTCAAAAGAAGATGATGATCAAG
CAGGGTCTTCTGGACAAGCATGGAAAGCCCAACGACAGCACGCCTACAGCCTGGAAGGAC
GACTATATTGACTACAGGTGATTGGTGGCCTGTGGAGGGCAGCGACTGGGAAGCAGACAG
TTATCCCTTTCTGGTCTTCCTCTCGTGACCTTAGAGGGAGTCAGTCTGCAACATGAAGTG
ATGGCAAGCTGTTTCTGGCCAGCATCACAGTGTGTTGATGGTGGTTTCAGCCTTGCCAGA
CACCCCCAGGTGCTCCTAGAGCGGCCACTCCTGAAGGGGGGTGGCAGGGATTTGACTGCC
TCCTTTCTTTCAGTGTCACCGTGAAGACGGAGCCTGTCTCGGTCCCAGTGGTGCCCATGA
AGACCGAAAAGACCAGGAAGGTGACTGCTTGGTGGGGCGGGGCTTGGCAGGGAGCCTGGG
AATGGTGCTGGCTTGGATTCCCTTCCACTGGGGGGAGTTTAACCGGGGCTTTGTTTGGGG
AACAGAGGAAACTCGAAGAGGAAGACGAAGGCCAGGGCAGCGATTACAGCGATTACGGGG
ATTATGGTGGCGAGAATGGTGATGAGGAGGAGGAAAGCAGCCAGGAGGAAGAGGAGGAGC
AAGATGACAGTGAGGAGGAGGTGGAAGAAAAAATGGAGAGTGAGGAGGAAGAGGGGGAAA
TTGCGCCAGGTGGCCAGGAGGAGGAGGAGGAGGAAGACAGTAAAGCATTTATTGTTCCTC
AACTGGAAGTCAGCAAAAAAGGCAAGAAGAAGAAGAACAAGAAAGAGAAGAAGATCAAGG
TCAAGGTTGAGAGTCCGAGCGGCAGATCCGTGGATTCGGTATGTATTCCCTCTGGAGGCT
TGTCTGTGGGCCCTTGGCACACTGTGCGGTGCCAGTGCTAGCTGGCCCAGTGTTCACACT
GACTGTGTGTCTCCCTTCAGGGCACTGACAGCTCCAAGAAGAAGAAGAAGAAGAAGAAAG
CCAGACTAATGGCCGAGGACTCGGAGTAGTGAGAGGAGCTGGGCTGGCCGGGGGAGACCA
AGAGGAAAAAAGGCGACTGCAGTGGTTTGGGAAAGGACAGTGCGCCTGAGGGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 1199..1285, 1375..1466, 2720..2904, 3039..3103, 4069..4195, 4353..4483, 4825..4968, 5579..5699, 6687..6805, 7893..7994
1001..1108, 1199..1285, 1375..1466, 2720..2904, 3039..3103, 4069..4195, 4353..4483, 4825..4968, 5579..5699, 6687..6805, 7893..7994
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved