Monodelphis_domestica Locus GNL3
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica GNL3
Monodelphis_domestica
GNL3
6
SNORD19, SNORD69
5905..5981, 9033..9109
11281
CCTTCGGCCTCGGAGGTTAGGGGAAGCGGGGAGACCCCCAGAGTGGGAGGTAGGTTGAT
CCCAGCCTGAAATCCTGGCCTTTCGCCTCGACCCCAGGGCGTGGCTTTGGACGAGGAGCG
GACCACACGGAGGTGGGCCTGTCTTGAGGGCTCTGGGAGCCTCCCTGTTCTCCCTTAACC
TGGCGGTGGTGTAAGGCGGCAGGGCTGAGGTGGGGGTGCAGTGGTCACATCCGTGCGGCT
GATGCAACCTTTAAAGTGTGAATGATTCCTTGAAGAAAACTTTATGAAGCAGGGGCTGTG
GGCTTATAGGGATTTACATCCCTTTAAAATTTGAAATTCCTTTTCCTAACAGTCTTGTGA
AGACGGTAGACTAGTATTATTTAGGCTGTTTTTAAAAGGAAAGCAACATCTAAGATTCAG
GGACTTTAGAATGTGCTCCCAGAGCGGATAAGTAGCAGACTCCTATTGAGTCATCTTTTG
ACTAATGCTTTTCCCCAGTTCAGCCTAAGTGCAAAAATAATTTGTAGTCTTCCAGTAGGG
TAAATCAGACTTATTCAAATAAGTTGTGTGAAAATTAGAGTAGGAATATAATATAATAAT
ATAATATGTAATTTATAATGTGTATGATAGTATATTTAATAAACTTCATTTTTATTTAGG
ATGGATAATTGTTTAATGGGATTTGAAGGCCTTTCAGGTTTGAGAGGAGGTTGGAGTTAA
TATTATAGATGAAATAGCATAAGCAAAGGCATAGAGGGGGGAAATGGAAATGAATCCAGT
TCATCTGGTCTCCTGATTGAAAATAGACTTCTTAAAATCATAAATTAGTCCTTAGGCCTT
TTCCTAGTGATTTGATCTTGGCTATATATGGTAGTTAGGAAGAACATGTTTTATCTCTTT
TGTCTTTATTGTAATAGCTGATTTTGTCTCTGTACCTGTAGTGTACAAAATGGACCTGTA
AGAGCCCTCTATCTGATCTTATGAATTATTCTTTGTTCCTAGAATTAAAAAAAGCAAGTA
AGCGCATGACATGTCATAAGCGGTTTAAAATCCAGAAAAAGGTGAGTCTTCTGCTTCCGC
TTTTGAGAATATATGTAGGATGAACTCCTATTACCTACAGAAAATAAGCAACGAATAGGC
TTTTATCGCCTACAAAAACTGCTATTGGCAGGCAGTGGGCACTTGGCACTGTTTTAAAAA
AGACACTACAGGCATAAATTTATGTTATTAGCAAATAATCTTTTAGGTAGAGGGTAGTGG
GTCTAATCTTTGGTGTGAGAAAGAAACTTTGTTGGGTCTGTGTATGCACTGGGTTGTGAT
GGTGATACAGTGTCTGATTAAGTGTGACATGAGGCTTCTCTGATCTGCAACCACTTTTAA
CCTTACTTTGTTGCCTTAGTAAGTTCAGTTAAATGCCTTCAAAGGCCAATAGTGTTTGGA
ATATGACTTGGAGCTTAATGATATTTAAAAAAAAATATTTTCCTTGATTAGACACAACTG
GAAATTTATGTATCAAATTAAATGGTTTTATTAAAACAGGTCCGGGAGCATTACCGAAAA
GTGAGGAAGGAAGCCAAAAAACGTGGTCACAAAAGGGCAAAGAAAGATCCTGGTGTGCCT
AACAGTGCCCCCTTCAAAGAGGCCCTTCTTCGAGAAGCTGAGCAAAGAAAGCAGCAGGTA
AGACTTGAGTTAGAAAAGGAAGGTTTTTTTAGTCAGCTTTGAGAAGCCTCATCTAGGCAT
TCTTAAGGAGATTTAAGTAGTTATTCTTTTTAAATAGGGTAATAACATGATTAATGATTC
TAAACTTTTTTTTTTGACCTGAGAAAACAGCTTGAAGAACTAAAGCAGAAGCAGAAACTT
AATAAACAAAAGGAACAAGGACAGAAACGAAAGCGGGATGAAAACAGTGTTGTTGCATCA
AAGACAGAACCAGCAAAAACAGTAGGATTGGCTTTATTTTTGAAGGGAGGGAAGTTGGGT
TATTCGTTTTTAAGAAGAACATGGTGTCCCCATCCAGTTTAACAGCATTTATTTACCTAT
GAGGTGATGGGTTTATAATTTATCTCTTTAGAAGTTGTATCAAGTAGAATTTTAAGGCAG
GGGCTGTTTCAAATTTTTGTCTTATTGAGCCTGGCATAGCTTTTTTTTTTCACATAATAG
GTGTTTAATAAATGCTTGCTGAATTGCAGGCACCCCCCTCCCCCCATTAAAGATGACATA
ATTTTCACATTTTTCATTTTGGGAATTTGCCTGCCTCTTAAATCCTTTTTGATCCAAATA
ATAAAAAATATATGTAAATGGACAAAATTGATTATATTAGCACCTGGTGCTCAGATCCCT
CAGCTGTAAAATGTAGGACTAGATTGATTCTGAAGTCCCTTCTTGTCTCAAAGTCTGTGA
ACTAATGTTATATATGAAATGTGAAGTATCTCCAAAAGGCAATTTAGAGGACCACGGAAA
GTTGGTATATAGTGAAAAGATAAGATAGCATGCTACAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTGAAAGAGATACCTATTTC
ATTTGATCATCATACTGTAAAAGTAAAATAAATCTCAATAACAAAATATTATATTTTAAG
AGATTTATGAATATCATTAGAAATAAAGGAATAAAGAAGATATAAAAGAAGACTATGTGC
CCATGGCTGATCAGGCACTTCAAACACCAGACTTAGTACCACCAAGCTCAGGATGAGGAA
AGTAAGGAGGTGAGACCTTCCATGGCCCTGCCTAATATCCCTTATCTACAGGAAGTCAGT
GGACTCCCAGGAAATGTAATTCTATTTTAGGGTAACAGATTTTTCAATTATACAATACTA
AACATAAAAAAAAAGGCATCTGTCTTCACCAAAGGTACCACTGTCATGAAAGATGGTTCC
ACAAGGAGTCAAAAGGGAAGAGGAATCCCTCCTTAGATTAGGGATTCTTGCCTCTTTTTG
AATCATAGACCCATTTGTCATTCTGGTGAAGCCTGTGGACTTTTTGTCAGAATGTTTTTA
AATGAATAAATTGGAATATATAGGCTTAATAAAGATGTAATTTTCTCATCAATATTTATG
GACCCCATGGAGGTTGTCTGTGGATCTCAGGTCAAGGACTCCTGCCCTAAATAGTAAGAT
TTTCCAAATGATGTTTTTCATTTACAATTGTGATTAAGCATCAGAACAATATAGTGTCTC
CTCAATGAACTCCACAATTGGTAAAAAGAAATTGGTGTCAATAGTCCTTAAGGAAAACAA
ATGTATGGAAAATGCTTACTTTCTGAACAACAGTATATAGTTGGTTGGCCAGACCATTCT
CGTTTCTTTTTTTTTCTCCTATCAAGTTTTAATACATTGATAGAATCTAGACACTGCAAA
GATAAAATGCTGGACATATAGTCAGAAAAACCTAGGTTAAAACTCCACCTCAGATAGTGT
GTAACTGGGCAAGTAATTTCTCTGAGCTTTAGCTTCTCTGTCTGGAAAATGGAGGTGGTA
ATAGTACCTACCTCAAGGTTATTAGGATCAAATGACAATGAATTTTAAAGTGTTTGCCAA
CCAAAAGGTACTATACAAAGGTGAGCTTTTATTAGTCATTTTGTTTAATTTCTATGTAAT
TCTTTCAAATTCTGGTTTTATCTTTTTTTCCTCATTTAGGAATTTGTGAGAAGAAAGGCA
AAACTATCTTGCAAGACAATCAAGCAAGGTTCAAAGAAATCATTTTGTAGAGAACTTCAG
AAGGTATTTTTCCCAACAAGAGCTAGTTTTTCCTCCTAATTATTATATTAGAAGCAGCTT
TTAAATGTTCCCATGTAGGATTATACACTTTAGACTTACCAACTAAAAGTCTAGAGAGGC
ACACTCCTTTCTTGTGCTTGTTTCCCTAATTCATCAGATGGATCCTACTTGATTTTTAGA
GATTAAAGAAGCATATTTAATTTTTACTCCTTAACTTATCACACACGAAGTAGGTGGTAT
TGTGCTGTTTTTTTACTTCTAAACATCAGGAGAAAAACCCTTTGATGTCTCAGATCTTCC
CCTTTCCAGGTTTTCTCAATTGAATTAGCTGCTTTTTTAACTGCTATTTAAAAAGATAAA
ATTTGTACTGACTTACACAATGTAAAAACAGGCAATAGGTTTTCATATCCATAATAGAAT
ATCTGAATATTTTATAGTGTGACTGAATTCTTGACCTACCCAGCTTGAGTTGTCATAAGT
GGAGCTTTAAGTCAGTGCCATTTTGCAAATTAATTTAGATAGAAGGAGTTGGAACAGCAC
TTCTCCTTTTTTAAGATTATAGCTGATTTGTTGTTTGTGACCCATTTGTTGGGTGAAGTA
GACTGCAAAACTCAGTATGCATTAGAAGTTTGATGTGATAGTCACAAAAGATAAATGATT
TTAAGATATATTAATATGAATAGAGAGGTCTGACTTCATTTAGTCTACACCTATAATATT
TGGTTCTGGGTATCTTTTTTTTTTTATATTTTATTTGATCATTTCCAAGCATTATTCATT
AAAGACATAGATCATTTTCTTTTCCTCCCCCCCACCCCCCATAGCCGACACGTAAATTCA
CTGGGCATTATATGTTTTCTTGATTTGAACCCATTGCTATGTTGATAATATTTGCATTAG
AGCGTTCATTTAGAGTCTCTCCTCTGTCATGTCCCCTCAGCTGCTGTATTCAGGCAGTTG
CTTTTCCTTGGTGTTTCCACTCCCATAGTTTATCCTTTGTTTATGAATGGTGTTTTTTTT
CTCCTAGATCCCTGCAAATTGTTCAGGGACATTACATCTCCACTAATGGAGAAGTCCATT
ACGTTCGATTGTACCACAGTGTATTAGTCTCTGTGTACAATGTTTTCCTGGTTCTGCTCC
TCTCGCTCTGCATCACTTCCTGGAGGTCGTTCCAGTCTCCATGGAATTCCTCCACTTTAT
TATTCCTTTTAGCACAATAGTATTCCATCACCAACATATACCACAATTTGCTCAGCCATT
CCCCAATTGATGGGCATCCCCTTATCTTTTTTTTTTTAATAAGAAATGTCAAACTGGAGC
AACTTTGAAGGAAGGTGACTAGGATGCTGAAGGAACTGGGGACCATTTTGTTCAAAATTA
AGACTTGGACATAATGATCTAAGCGTGTGTGTGTGTATGTGCACGCGTTCTGTCTTGGAA
TCAGTCCTGTGTATTGGTTCCAAGGCAGAAGAGTGGTAAGGGCTAGGCAATGGGGTTAAG
TGACTTGCTCAGGGTCACATAGCTGGGAAGTGTCTGAGGCCAGATTTGAACCTAGAACCT
CCCGCCTCTAGGTCTGGCTCTCAATCAATTGAGCTACAAAGCTACCCCCCATTTGTATAT
TTCTGATCTTTGTTCTCTTAGGTGATTGAGACCTCGGATGTTTTGTTGGAAGTTTTGGAT
GCCAGAGATCCCTTAGGATGTAGATGTCCCCAAGTGGAACAAGTCATTACCCAGACTGGA
GGAAACAAAAAGCTACTGCTTGTCTTAAATAAAACAGGTAAATTGTAGATCTGCATTAAA
AATGACCTTTATGACTTGTAAATGTGAGGTATGAGGAAAACATCTAAACAGTCTGAAATA
CCATTGGAGACTGTAAGATCCAACTCTGACCTCAGCCTAGGCAAATAAATGTTCATTCTT
TTTCTGGTTGCCAAAGATGATACCACCTAATCATAGTAATATATTTGGCATACAGCTGCT
CACAGCACTTTGTGCTCTTTAAGTATAAATGAACCTGATTTTTTTTCCTTTGTAAAGATT
GTCTCTGACTAGATAGGTTGTCCAGGTCAAGGATAACCTGCACTTGTTTCATCTGTAGCT
TCTAGTAGATGGTCTTTTAATAGAGCTCAATAAATGCTTGTTGATGGCTGAATTCCCCGT
GTCTTTTTGGTGTTGAACATTCAAACCAAGAACTTAAGACAAACTAACCAAAATATTTCT
TAGAAAAGTCACCAAGTGACACTTAAAAAAAATCGTCATTCAAGGATGGTGCCAGGGTCA
GAAACTAGGAAGGGTTGAATCTTACAGGAAATACATATATCCTATTTGACAACTTCTAAA
TTTTCTCATGTATGTTTTCTTACTGCTTTCAGATCTGGTGCCAAAAGAAAATTTGGAGAA
ATGGGTTCATTGCTTGAAGAAAGAACTCCCAACAGTTGTTTTTAGAGCCTCAACATTTGG
AAAGGAAAAGATAAAGATGGTAAGAAAACCTTTTGTGTTATTGGGTTTCTTCAGTTCTCC
ATCTAATTGTTGTTTGGGTTGAAATATGATGAACACTGAAAACTAGATGGAATTGTGAAG
ATCACAAGATCCAACTCTGATTTCACCCAGAGAGATTGGAGAAATTCTCATTATTTTTGA
ATACTGTCAGTTTTCTGAAACTAGCTATGCTAACCTTACTCATGCTGGTATTGTCACAAT
TGTCCACTATTTGGGATCTGGCCTGGAGATTAGATGGATTGTGGGAAAGATAATAGTAAC
TTGTAAAAGGAATCATAGAATTATATGTCATTTATCATTCACAGAGGGGCCAGTAAGACT
AAATGAAACTGGCTTAGGAAGGGAATCATGACTACTTGAAGAGTGTAGGAGACTGAAATA
AAGGTTGTTCTTTTCAGTTCTGCAGTATACTATTTTAGAGTCAGGGTATTGGTGTATATA
TATGTATTAGAGAACATACATTTATTAAGCACTGTCTGCAACACAGACACTGCCAAGTGC
TTTGGCTAATATACACAGGATATAAAAAGGAGCAACCTGGGAGGTTGGTAGGGGGTACTA
TTATCCCTCTCCTCATTTTGCAGTTGAAACTTAGAGAGGTTAATTGAGTGACTTGCCATG
GGTTTACATAGCTAATAAGTGCCGGAGGCTGGATATGAATGCAGGTCTGCCTAGCTCTAG
GTCGTGTTCTGTCCACTGTATCAATTCTTTGTCTAGATAATCATTTTTCTGTCAGTTCTG
TTATTTCTTGCCTAGAATGTTTCCTATTCTTTACTAGAGAAACTTGTCAACTCAAGAAGG
TAACTAACTTGTTTGAACTTGAAGCCAGGGAAGAAGAAGCTGGACCTCAGCAGGCAAGGC
ATATGCTTGGGTGGAGCAAGCCTTTTGACACTCCTTAGTGGCTTTTGTGAGACTCAAAAC
AAAGCCATTCGAGTTGGTGTGATTGGTGAGTTTATATAATCATAATTTAACAACTTTTCT
ATGGAAATGAGCATCAGAAATTTGCTTGCTGACAAAAAGGTACTGGGAGGAAGGAATACC
ACAATGTAGGTGTGAAATATTAGTCTCATGTAACCATTCCTTACTAAGTTTGGGGAAAGC
AAACTATTTGGTACCTCAAAAAACGAGTAATTGAAATTAATATTAATCTGCCTTATTTAA
AAAAAATCAATTTTAATACTATCCCCCTCCAAGAGAACTATCACATAGGGCAGATTGTTT
TTAATTTTATTTTTTTAAACCCTTACCTTCCGTCTTGGAGTCAATACTGTGTATTGGCTC
CAAGGCAGAAGAGTGGTAAGGGCTAGGCCATGGGGGTCAAGTGACTTGCCCAGGGTCACA
TAACTGGGAAGTGTCTGAGGCCAGATTTGAACCTAGGACCTCTGTCTCTAGGCCTGACTC
TCAATCCACTGAGCTACCCAGCTTCCCCCAAATTGTTAAGTTTTTAAAGAAATGAAGAGG
GGGGGAAAATTAGCAAAAACAATACATTGAAAAAGTTTGAAAATGCATGCAATGTATTTC
CCCCTGCCCCCTATATTTCCCTCCTCTGCAAAGGAGTTGGGGTGGGGTCTAGATTTCTTT
GTATAGTTTTGTTGCATATTCCATTTTGATTCTTTTGTGGTTCTTTCCTTTGACATTGTT
GCAGCCTCTTTTCATCCTACTGGTTGGATTTTAGAGCATATCCCATGATGCTCATGTATC
ATAATTTAAGCCATTGCATTATCTAGTCTAAAGGCATCTAATTTGTTTCTAGTTCTTTGC
TACCACAAAAATGTGCTGCTATTAATGACCCCTTTAGTGCTTCAGACTAGTCTAGTATTG
AAGGCTCTGGCATAGTATCTGTTCGCACCATTGTTTGGGTGAGAAATGAAGATAGAAATG
GCCTTATTAAAATGATGATAAGAGATCCAACTCTGATCTCACTCTGAACAGAACTCTTAT
CCAGAGTACCATCAGACTGCAGTTTTATTTCATACTTCCATAAAATCTGTTTTTGTCGGT
ATGTGTTTTCTATACACAAATGCAGATTTCTTTCTATTTGAGTTTCTAGTGAATTATTTG
CATCATAATGAGATATTTCTATTTCTTTTCATTTGAAGGTTTCCCAAATGTGGGCAAAAG
TAGCATAATCAATAGCTTAAAACAAGCATATGTTTGTCATACTGGACCAGCCATGGGTCT
TACAAGGTAAGCATCTGAAAACTTTGAGAGCTCTTGGGAATATTTAAACAAGAACATTGA
AAGTTTTGATTTGATAGCCTTTTAATTAAGTTGATCCAATTTTTCTTCCTCTTTAAGGGT
TTCAGTTAAAGGGAGATGTCAAATATGGCTTTGGTAGAACTTGTATTTATTAAGCCTTTT
TGTTTACATGAATATCAGAAGACCTGGCATGTTTTTCCTTACAAATGAGATTTTCTGTGT
GAAAATGTATGTATGGATTTCAAATGTCATTCACACATGAAGCATATGATGACAAACTGG
ATCTGATATTCTATGTTGAATTTCTTCAATCCAACCCTGAGCTTCATGTTTGCTTAGATA
TTCATCTCTCTTCATTCTTTGAAGATTCCAAGTTTTTATGCCTTACTATTTCATCTGTAG
ATACATGCAAATTGTCCACATTGACAAGAAAATCACGATATTGGATAGTCCAAGCATTAT
TGCATCTCCTTGTAACTCTGCACTAGCTCTTGCTTTGAGAAGTCCCACAAATATTGAAGA
AAGAGAAACATTAGATTCTGTAACTACAATCCTGGAATACTGTAATAAACAGCAGGTAAT
ATAGTCTCTTCCATTTTTTTTTCCAGTAGCTTCTTCTTTATTGCTATAAATCTTTTTGGC
TAGAGAATAGATGTTCTTGAAATTTTACTAGTTTGATAGAGGATCTTTTTAGTCATTTTG
TTGTTTTTTATCTGGCACTGGAAACTTCTTGTTTGTAAGGAAATTTTAAAAAGGGGCAAT
CCTAGATAAGCAGATAAACAGTGCTGTCCTGTTTTGAGCCATTCATTATATTTCATCTTG
CATATCTAATGATATAGTTATTTGGCTTTAACAAACTTGTCATCTTAAAACTCATGCTAG
ACTAGATGAAGCAAATTTTTTTTTGTTTGTTTCAGCTAATGTTAAGATACAATATTCCAA
GCTATAGAGATTCTCAGGAATTCTTAACCCTACTAGCACAGAAGAAAGGGATGGTGCGGA
AAGGTGGCATACCAAAAGTGGAAGAAGCTGCTAAACTGTTTTGGTCTCACTGGACAGGGT
AAAGGCTTTAATTTCATCTGTTGAAAACTTGAATAGTATTACTTAGCTATTAAATTTTAT
CTTTTTTTTTTTTAAACTAGCCCCAAGATGAGTTACTACTGTCAGATTCCTTCATCACTG
ACTCTTTCTTCACATCTTACCGAGAGTATTGTAGCAGATATGCAGCAAGGTCTTAATCTA
GAGGAACTGGAAAAAAACAATGTGGGTGCCATTAGAGGTTAGTAAAATCTGTGCTTTCTT
GTTTTGTTTAGATTTCATGCTGCTCTATTAAGGATTCATTAGATTTCTTTTGCTAGCCAT
CAGGGGTCCCAGGTTGTCAAGTAGCATCCTTTTCCAAAGCTCTGGTCTGACTAATGGCAT
AATAGAGGAAAAAGATGTGCCTGAGGAACTGCCAGGACAAGAGAGTGAAGAAGAGGAAGA
GGATGAGGACAGTGATGATGAAAATGATCTTGAGGTAAAATTGATTTTAGATTAAGTTTT
AAGCAATTAGTAGAAGTCCCTATAGATTTTCAAAAACCCTTCAATGCCAAATTGTAAAAC
TAATATTCCAAAGAAAAGGAAACATGTAACTAGCTATGGTATTGTAGTTGTGGGTAATGA
TAAAAGATTTGCCTATGCCTAGTACACCCTTGGTTTCTTCCATTTACATAATGAGGGAAT
TAGATAATAGAATATCAGAAGAAATTATCTTAACGTAGGCTCTATGGATATATTTCAGGG
AGTCCTTGTACTTGGATGAGGAAAAAAATGACAATTTTTACTAACCTCTAAAGAGAAATT
GAGCATTTCCTTAAATTAAGCATAGGCAATGAAGGGATTCTGAAAGGGGGTCTGTAGCCT
TCACCAGTCTGCCAAAAGTAGTTGATGACACAAAAATGTCAAAACCCACTGATGTAATCC
AACCCACACATAATACAGTTATTAAGAGACCATCAGATCATTACTTGGCTTTCATACCCC
CTCAATACTTTCTCAAGGCGACCTATCCTACTTTGGAGATGGTTTTAATTCCTATTTCTC
CCTCTGGTGCTAGAGCAGAAGATGATGGCTACTGGGTGCTCCCTAGGCAAGCCCTCACTT
TTTCCAGACCATGCTTCCCCAGTTCCTAAAGTCTTCCTTCATATAGCTTAATCTCAAGAC
CATTATTCTGGTTGGTCTTCAACCTTACTTCAACCTGAGATACCACACCTGGGAATAAAT
GTAACAGTCAAGAGGTAGGAACTGCCTTTGGCTAGACTGTCATCTACCTTAACTGAATGT
TATTGCTCTTGAAGCAGCCTAAGATGACATTACTTTTGGGGGCAATTTTGCCACTTTGTT
GATTTATTGAATTTGCAGGCCACTGTATTTTCCATAGCTTTTTGTCAAGTTGATTTTTGT
AAAATTGAACTGTTATCTAATATATTCACTGTTCAAGCTTTGGGTCATATATATATACAG
TG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 1539..1676, 1830..1940, 3999..4082, 5721..5856, 6452..6573, 7404..7524, 8678..8765, 9180..9354, 9695..9837, 9920..10056, 10136..10281
1001..1060, 1539..1676, 1830..1940, 3999..4082, 5721..5856, 6452..6573, 7404..7524, 8678..8765, 9180..9354, 9695..9837, 9920..10056, 10136..10281
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved