Monodelphis_domestica Locus TBRG4
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica TBRG4
Monodelphis_domestica
TBRG4
6
SNORA5, SNORA5, SNORA5
3278..3414, 6390..6526, 7440..7577
10829
TACTGGTTATTAAAACATTTTTAAAATCACTCTTCTGCACAGATATTTTTCATGACTTC
TTTTTTATTTACAAACTGTTTGAACCTTCTCTTTTCACCTTATCTCACTACTATCATCCA
TGAAGTCTACACACCAAATTAGGCTATTCAATCCCCACAGACCATCTGTTTCCACAGTTT
TAAAAATCCTGTGAAAGATAAGATTCTTGGCTGTTCTTTTTTCTTGTCTCTGCATTGCAT
GGAGATGGCTCTTAATAAAGTTGAATCAAATCCTTTGAGGTTAATAGTTTAAGAAGTATA
CATACGATGTCACAGGGATGATGGATGGTAAGCCTAGTTAGAAGAAATCTAGTTAAACCT
TCCTATTTGAAATGAGAAAATAGCCAGTTTTCCTGTGACCATGCATTGGTTAGTTAGGCT
TGGACTTAAATCAATTTTCCCAGCTCTTAAGTCCAGAGTTCAGTCTACTACACCACATTG
CCTCTTCCATTCCCCAGAAGAGGGCAGCCTTACCAGAGAAACCTGGTGAAATACCATTGG
AAGCAGTGGCTCTTCTTTGCAATGAGATATGCCTCAAGATTTCTAATAGATAACCTGTTG
ATCAAGCTAGTAGCTCCTATTACCAGCTGTATGTTCAATGCTAGAGAATAGAAATAATAA
AAAGTTCCTGCCCTTAAGGAATTTACATATACAAAACTTTCAGAAAAAGAAGAATTATTC
AGAGTATTAAATGACTGGATTGGAAATAGTCGTCAAGTGCCAAAATATTTATATAGGCAG
TATTCTGTGTGCTTGATATTGTTTGGTGGTGGCATTGGGAAAAGTGAGCTGTGAAGAAAA
TGGCCTTGAAACCCATCTTGGCCTTAATGCTTATGTTTCAGGAAAGGCTATTCTAAAAAA
ACATCTTGTTTTTGCAATGCTTTATGCTTTTTAAATCCTGGTTCTTTCTTTAACAGGTCT
TAAGTGACTGAGTTAAAAGTACTACACCTCTCCTGCAGCTTCAGTGTCCCTGCTCAGGCT
CAGAGGACATCATGGCATCTCGCCTGATGCAACGCTGCATTTGCCTCTTGGCCACCCATC
AGGTCTCACCCTTAACTGTAATTAGCAGAGTGAGACTGGCCAAGGTCCCCTGCAGCATGA
TGACCACCACACATGGATCCACTGTTTCCACTTTGGATAATATCTTAGATAAGGAGCCAG
TGTTCACTCCTTACCCTTGGCCTCAGAAAGTCGACCAGCAGATTGAGAAGGCCAGGAGCC
CTGAGGAAATACTAGAATTGCTTGATGGTAGGCACAAGTTACACCATAACCATACTGCCA
TCATGGTTATTAAGCTTTCTCGACTCTTGGCTGATAAGCACCAGGATAGAGACTTAATCA
TTAAAGATAACCGGGTTCAGAAGCTCTTCCACAGTGTGGACAAGCAGGTGGGTTACATGG
CATTATTTAATATAAAAGGTTAGAATGACAAAATTTTTGTTGTGTTTGTGAGGGCTAAAG
TACTCTACAAGGTATTTAGGATTGCATATTTAAGTACAATCACGCTCAATTAGTCTAAGA
ATAGTACAAAAGCTATGGATTATAGTTCTTTATAGCCTCCACAGTGCCAAAACTCTGCTG
TATCCTGAATTGATTGATTTCTCCCGATGTTTACTTAAGCTCTTCCATTGTGCAGAGCAC
TGTGCTGGGCATTGGGGGAGATGGATAATAATCTATCATTGTCGAACTTAGAGCCTAATA
AACTGCATGATTTGTATGAGAAGCATTCTAAGACATGAACAACAAAATGTGCTTTGAGGT
CTGGAGGCTGATGGGCTATTAGTGACAGGGTGATCAAGGATTTGTTGAAGAGATGGCATT
TGAGTTGTATGTGTTTTTTTGTTTTTGTTTGTTTGTTTTTTAAATCCTTCCCTTCCCTCT
TGGAGTCAATACTGTGTATTGGCTCCAAGGCAGAAGAGTGGTAAGGGTTAGGCAATGGGG
GTCAAGTGACTTGCCCAGGTTCACACAGTTGGGAAGTGTCTGAGGCCACTTTTGAACCTA
GGACCTCCTGTCTCTAGGCCTGACTCTCAATCCACTGAGCCACCCAGCTGCCCCCTGAGT
TGGTTTTTAAAGCATAGGAATTCTTTCAGGGTGGTGGACTGCTAGGTCATTAGGAATTCA
ACAAGGAACCACTAAATATTTTTGAGCAGTGACATAACCAAGTCTTTGCATAGGATTATC
TGATAATGATTTGATGGATAGATTTTTTTTTTTTAATAGTCAACCAACTGACTAAAAGTG
GAGAGTGAAAAGGGAGACTCAGAAATCCTGTGTTATCAACTTGTGCAACTGGATAACTCT
TGGTGCCATAGATGGAAATGATAAGTTAGGAGAAAGAATGATGAGCTCAGTTTGGTATAT
GTATATTGTGGATAGCTTTGCTAGTCTGGTGAAACCCATAGACTCAAGTCATTTTTAAAT
CAGCATAGGTAATTTAGGATCAGGTTGTAAGGGGCTTTAAAGCCAAACAGGAGTTGTATT
TGTTTTCAAGAGATACAAAAAGCTATAATGCTTTCTCACCATGTTATTTTCCAGTTGCTT
TTTAATTACATTTTAGACTGAAATTTTTTCTTTCTTCCTTGGCCCAGGTATCTTCAATCT
GGCATGGAACCCTTATGAGCTTACTCCGAAGCCTCTATACATTACAACTTCGAGAGAATT
CCAGGTGCCTGCGATCTGTGGAACAAGAGGTTCGCTGGAGGCTTCGTCGAGTTAAATATA
AGAACCTAGTTTTTCTGGCAGAGACAAGCATCCCCTACATGCAAGAGCAGGCTTCAAAGG
AGCTGCTTACGGAACTGCTGATGTACTTGGAGCGACGATGGACAGAGATTGATGACTGCC
GCACTGTAGTGACCCTCATGACTAAAGTAGGGCACCTCTCAGAGCCACTAATGGGCCGTC
TAGAGGACAAGGTATTGAGAAACAGGGACTACAAATTCATATCTCCCTTTGCCTGATAGT
TTGTGAGCCTTTGCTCAAATAAGGTTTCGGGGAGAATAGGTGCAGTTCAGAGCTTGCCAG
GCTATGCTTCTTCCCCTCCCTGCTCTAAGCATATATATAACTTCTGGGGCAGAAACTGTA
GGTGCTTCTGTCCAGGAAATAGTGTTCTTTAGCACATAGTCCCAGGTGGCATAGGCCTGT
GGTACAAGAAGATTTGCATTAAGAACTAAGCTTCTTCAAGCTTAAGTCTCATTAACTCCC
AGTCTGCTGTATTTACTGTTTTTTGCAACTTCAACCCATGCAGCCTTGTCAAATTCAGCA
CCTGCCTCTGTCCATGGCAAGGGCTGGCCCAAAAGGCTGCCACAGAAACACTGTGGCTCA
TGGGCCCTATGTCCTGTTTCCTGGGACCTGGGGATAAGTTTGGCTACAGACAATGAATTT
CTTCCGGCAAACCTTCCTTTCAATTGTTTGGGTTTCAGGTCCTAATTAGGCATAGGATTC
CCTGAGTCTTTGATAGCTTTTTATTCTTTCTGGGAGTTTGGGATATCCAGAAAGGTCTTG
CATATAAGAATCTTGACAGTTCAATTCCAGGAAGTACTCTATAGGGATTAGATCCCATGG
GGGGGAGGGGGGGGGGGTGATCATTGTTTTGGGTGCTGGACTGAAAACAACTCTCTAGCT
CCTCCCCCCATCTTGGTGCAGCAGAGAATGGCAGCCGCCCAGCTAGCTGACCTCCCTGGG
TGGCTGTGGTTGACAGTTCCTGGAGCTGGCAGAGCAGTTTGGCCCTGAGGACCTTCGGAG
AGTGATGCTGACCTTGGCGGCTCAGAACCGGCGATCAGTGCCCCTTCTTCGGGCCATCTC
CTACCACCTGGCTCAGAAACCTTTTACCCTGACAAGAGGAATGCTGATTGACTTCGCATA
TGCTTATGGTAAAGCAATGGAGGTAGTTGGAGGGGCAGGGAATGTAGGGGTCTTGGCCCT
ATTGTTAACCTCCCTTGTCATGTCTAGTTTTCCTCTCTCTTTGTCAAATCAGTATTTGTT
CTAAAAGGCTGCTATAGAAGCACTATAGCACTTGGACCCCGCATCCCTCTTCCTTTAACC
CAGGAAAAAGCCACCAGCAGTTCTGGATTGTGTGGGGATGGGGCCGTGGTTCCTGAGGTT
GGGGATAAAAGGGTGACTTTGCTGACTCCTGCTAAGGATTGCTTCAGCTCCTCCTCCATT
CCCTTAGGAGCTCTGTCATTAAGCTCACTATAGTCTCCTTTGCCCTAAAGGTAAACTAAA
CTTCCACCCAAACCCAGATATTCCAGAAACTCGCAGCTGAGCTATTGCCCCAGGTATCCA
GCATGACGCCCAGTGACATAACTCAGTGCTCTAAGTCCTTTGCCTTCCTCAAGTGGCTCA
ACTTGCCTCTTTTTGAAGCTTTTGCCCAGGTAAGCAGGGGTCAGATGGACTGTGATCCTA
GAGCTGGGAGGTACATTTTAGATGGGAATGACTACTATTTATATAAAACTTGAAAAAGTT
TTCAAAGATGAGAGTGGTTTGTGCATCGGACCTTGTTTAGTGACTGGCTAGGAAAGCATT
TCCTAGATGGATAGATACAAAACCAGGAGCCACCAATTATTATTACTGGTTTATTCATTT
TCTTGAGAGCTTTAAACATTAACAGGTCCACAGTCCCCTTATCCACCCAGGTTGTTGCAG
AGCTTGGGAACCCAAGGTCTGATGACTATGGCATATATGTATTCTGCCACTAGGAAGCTC
ATACTTCTGGAAGAGCCATAAGACTTAGATGTTTGGGAAGTGACCCATATCCTGGGGTGG
GGGTGGGGGGATAGACTAGATCTGTGTCTGCCAGGTATATTGGTTGTTGGATAATGGAAT
AAGGGATGAGAGGCTTTATCTAGGCTAGGAAGCAAGTTGGTAGCCTCTTCTCTCCTTACC
CCACCTCTTCTGGCCCCTAGCACATGCTAAACAAGGCAGACAGCTTTACCCCACTCCAGC
TGAGCAACATGATCCTGGCATTTGCTCGTCTGAACTTTCATCCTGAGCAAGAAGAGCAGT
TCTTCAGTTTGGTATGGCTTTTCCTAACCCTATTCTTCCTGGGGGGAACACTAGAAGCGA
GGTGGGGGAAGTATGCAGGCATGTGAATGTGATCTAGTGCTGGGGAATCGATGAAAAACT
AACTTGAATGGGGCCATAGTGCCCTTCTGAATAGTGGGAGAGGAGTTCAAAGGAAGAAAA
GCTGCAGCTATCTTAATTTTCCTTGTAAGTAAACCCTAATAATGAGTCTTGTGGTCAAGT
ATGTAGAAAAGGCAATAAAAGCAGGTGATGAGGGAAGGTAGTCTTAAGAGTGGCAATGCC
CAAGAAGGGAGAAGCAAGTCATTGGGGTTCAAGTGCAAAATGAAAAAGTCTTAAGTCTTA
GGTTCAGGCTCCTTAAAATAGGACTCTAAAAGGAAGATCTGTTTTAGGGAGGTGACAGAA
GGTCAGGAATGGACCCTCCCACTTTGTTTGCCTTCAGCCTTGGGTTGTTCATCTAATTCT
TTGGTCATATTAGTGGCTATTCTGCCTTGCCAGTGATTGAGAGAGACAGAGAGAACCTCA
CACCTATTCCCTTCCCCAGGTGCATAAAAAGCTGGAGCCAGAGCTGGCCAATCTGAGCCC
CATCCTGCAGGTTGATGTGGTGTGGTCCCTGTGTGTACTACAGCAAGTGCAGGAGGCCCA
GCTTCAAGGTGTTCTCTGCCAGGAATTTCACAAGCAATTTCTAGGTAAGCCGTTGAAGAG
CTGGGAAAGAATGGCTGGGGGAAATGGAGCCTGGCTTCTCTTGCGTATCTTTCTGTTCTT
GAACTGCCACTGCCAGGGTCAGATTCAGCCTTGACAGAATGACCTGCAAGCCCAGGTACA
AGATGCACTCCAGGCTTTCAACCCTTATTTCAACCCTCATTCTTAGCTTCCCACTGACCA
ACAAACTGAAGTGTTTGAACATTTCCTGTAGTGTCCTTTCCTGGCATGTGGCTCTGTTCT
GTTGCAGACAGCAAGTTCCCTCAGAACCAGAACATCTGCCAGAAGCTGGTCCATATTAAT
GCCACCGCTCAACTGGAGCATCCAAAGTACATTGGACCCTACTTGCCACTTGCCACTTGC
CAACAGGCCTTCCGCCTCCAAACCTCCACATCTAGGAAGATGACGCCCATGCAGAAGGAT
CTGCAGGACATAATGAAAGGGTGGCTGGGAAGTGAGGACAAGGTCCGTTTTGGAGAGACT
ACTCAGTATGGCTGGGAGTTGGGTGAGTCTACTCATTTTCCCCTCACCCACCCACCCCAT
CCTGTACTTGGGCTGATGGGGTTGGTTCCATAAATACCCTTCTATTTTTACTGCCTCCCA
TCTAAAACTACTTGGTTGTTCCTACAACCCTGCAGCTGTGTCAAATTCAGCATCTGCCCC
CTTTCATGGCAGGAGCTGGCCCAAACAGCTGCCACAGTAACACTGTAGCTCATGGCCCCA
AGTCCCTCTTCCTGGGATTTGGGGATAAAATTTTGCTGCAGACATTGGGCTGGGCTTTGC
TATGCTATTACTCTTCTTCGGACATTTTTCCCCATTTCTTTTTGACTTCCCCGAATAGCA
GCTCTGCCTCTTAACAATTAGCCAGCCTCCACTTAATTAACCTGTGTTTGTCATATCACT
AAGGCACAGGCCTTATCCTGCCCACTCTCAGTGTTCCCAAATCTGTTCAGGAAAGCTTTC
CTCAAGGGATTTGGATCTCATTTGAACCCCCAATTTGTTGACTCTCATTGTTCCTTGACC
CTTGCATCCCCTTCCTCATCTGTCCTGCTTTCCTGTTATTCAGATGCTGAGTTGGTACTT
GATGTGGAGAATCAGCCTCTGCCCATGAAGAACTTTATAGCACCTCACCTGGCTCAGCCA
ACTGGAACTCAGCCGTTACCCCCTGGTGCCAAGAGGTATGAATGCACTTGTTTTTCCAAA
CTCTGTGGACCATCACTGGGGTGGGGCAAGGACCATTCCTACATTGGAGGGCAGGTCTCC
TTTTTGGGCTTTCTTTCCACTCCCTGAGGCTTCTTTTCTGGTTTCCCTTTTGATCTTCCC
ATTCCTTTGTGTTTGAGAAAGAAAAGTGAATTTTTACACTGAGTAATGCTCAGCTTTCTG
CTTTTGCCTGGTCTCTAGGTTGGCTTTTCTTCGATGGGAGTTCCCCAATTTCAACAGCCG
AAGCAAAGATCTGCTGGGTCGATTTGTTATGGCTAGGCGCCACCTTCAGGCTGCAGGCCT
CCTGGTGGTAGATGTGAGTACTGGCTATGGGTGTGGTTAGCCAAAGCCATGACCCACCAT
GTGGACTGCATCTCCTGGGTTGGCAGAGAAGAGGGGCCAGATAAAAGGAATGGGAGGGTT
CCATGTGGGTACCCACATCTTGGACTTAGCTGTATCTGGTTTGTCCTAAGCTTTTAGACT
TGCAGCTGTGTCAAATTCAGCACCTGCCCCCTTTCATGGCAAGAGCTGGCCCAAACAGCT
GCCACAGCAACACTGTAGCTCATGGGCCCCAAGTCCCTCTCCCTGGGGCTCGGGGATAAA
ATTTTGCTGCAGACATTGGGCTCAGGGCATTCCTCCCCTCCATCCATTTCCTCTTTCTTG
ATGTTTGTTCAATTCAGCTCTGCTTTTAACAGCTAACCACGGTGTTCTCAGCTATTTTAT
CTACTTTCTGCCTGGTAGGGCCCCACCCTAACCCGAAGGCGCCTTCACTTAGTCCACTTT
AGTCAAAAAGAACAAATGTGGGACTAGAGATCAACTGGCAGAGAGAGAATGCTTCATCCA
GTTCTCAGTCATGTTGTGAGGCCCGTGAAAAACCACAAAGTGGGAGAGGTTGTCTCTAGC
TTAGGGAATCAGGGAAGGGTTCATAGAGGAGTGAGGTTGGCCCCAGATTACCAAGAGTTA
TGAGGAAATCACATAGGACATAAGTGGCATTATCAGGAGCTCTTGTGTGAGATCCAGCTG
ATGTCCTCCTCCCCCCCTCCCCCCCATCCTCTTACAGCCTTCCCTGGGGATCCTGAGGGA
AGGTTCCCACTAAAGGCTATGTTATATGTTCATTAAATGAGCTGCGGTACACACATAGAA
TTCATTCTACCCGTCTTTCTGTATGCTTTTTTGTTGCCCTTCTTCCACCAGAGCATGATT
GCTTTGCTATCAGAATTTGACTTAAGGTTTGACATGGTGGCAGACCATTTAACAGAGGAC
TGTTGGGTCAAAGCTTTACATTAGGAAGAATACTTGGGTCGTGATAGAAAAGAAACTGGA
GGCCACCTGAGTGCTGCTGCAGCTCAAATCCTTAATGAAAGAGTGAGTGAGGAGATAAGA
TTCAGGCAGTGTTTCAGAAATAGAATCAGACTTGAATGGGGCTGGGAGGTGGTGGGGAGG
CAAGAAAGTCAAAGCCGACTGAGTTCAAGTCTCAGTGACTTGGAAAGTGATAGTGCCATA
AATGGAAAGAATAAAGAATTGAGAGTGAATGTTTTTGGAAAGAAGGTAGGTTTAATATTG
GGTATATTAAATTTGAGGTGATGGTTATGTGTGTGTGTGGGGGGGTGTTCAGCAGATAGT
TGGGAATAGATGACAGCCCTTTCAGAAGAGCCAGACTTAGTGGATTTGTAAGTGCCCTGC
ACAGATGTCATCAGTGAAGCCATTAGTCAATAAGATTGCCAAGAGAAAAGAAAGCCCATG
CCAGAGACAGTGTGATAGGTCAGTGATCTTTAGGATGCGAGGAATGCCTTGGGAGGGGCT
TGTCTACAGACTTAACTACCGGACATCAGAGAGGATAAGGACAACAAGAAGAACTTGGGA
TTTGCCATAAAAGCTGCTATAGATGACATTAAAGAGAATGGAATAATGAAAGGAATTACT
GACAAGCCATTGATAGAATCTACTTTTCTCTAGACATTTGGGTGTCAGTGGATATTCAGG
ACAAGTTGGTATATTAGAGTGCTGGACAGGATTGAGCTAAATGTTCCTTTGGGGATTTTG
TTGGTTGATTTTTTTAGAAAAGCAGAGACCTGAGTGTATTTATGGGCCCTTAAAGGGGGC
GGGTGGCTGGGTGGCTCAGTGGATTGAGAGCCAGGCCTAGAGATGGGAGGTCCTGGGTTC
AAATAGGGCCTCAGTCACTTAGCTGGGAACCCCACTCCCACAACCACACCACAATTGCCT
AGCCCTTAACACTCTTCTGCCTTAGAACTAATACACAGTATTGATTCAAAGATAGAAGGC
AAGGGTGTTTTGGTGTGTTTTTGTTAAGTGTGTGGGAGTATAATTGCCAGGGACTAGAAA
GGGCAAAAGGTATAGAGTAAGGACTGAAACCAAATAGTTAACCTTGGAAAGGAAAACCAC
ATTATCCTCTGAAACCAGACAAAGAATGGGGGAGAAAAGAGGTTCAAATGAGCTGTGTTA
AAGGAAGGGGGCAAACAGATTCTCCAAAAGGATGGTATTGAACTTCAGAATTTTGCCTTT
GAAAGTGATTCTGTTCACCAGCTATACTTTAGTGTTTCCTCTGCCTTGTATTTAGGGTCA
TAGGTTAAATTGGACAGCAGAGCTTTGGAGAGCTAGTTAGTATTGACTGAAAGGACCTGG
AATACTTGTGCTGCCATTTTTTATGTATGACAGATCCTTCCCTTGGCAGGGCTAATATGC
TGATAGGAGGTACCTGTTCTTCCTTTGGCCACTTTGGGCCATCCTGACCTCTGTTTTGAC
CTCCTTAGGTTCCCTACTATGAGTGGCTGGAGCTGAAGTCTGAATGGCAGAAGGGTGCCT
ACCTCAAGGACAAGATGGGGAAGACTGTGGCAGAGGACCTGGCCAAGTGACCTTCCTTTT
CCAGCCTTATATTAGCTCCAACCCTGCAGAGGAAGCACTTATGTTGAAGGGGATCTTTTT
TCCTTTGAGGCAGCCGGAGCTTACTCCCAGATACTTGGAGCAGCACTGGCTCAGCCTGAC
AAGAGCATGACTGGGTACAGGATGCCAGTTGTTTTAGAGCCTCTCTTTGATGACTTGGTT
TCTGCTGCTACTGAACCGAAGATATTGGATAACTCAGTCCTATTGTGGGGGTGGGGAGGG
TCTAACCTATATTTCCTCCTTGTAAAGGACATTTCCTCAATAAAGGTTTCCCTCTGAGCG
GTGAATCTGGGGACATAAATTGCAGGAGCTTCCGGAAGGAAGGCTGCTAGTGCCCAATCT
TGATTTAGGATTGTTACCCCACTAACATCTTTCCTTCATCAGGAAAGGCAGAGGGAGCTT
GTCTGAGAGGCAGTAAAGTAATGCAGTCAGTGGATAGTGGTGGTTCTGGAGTCAGGAGGG
CTAGAGTTGAAATTTCCTGGCTATGTAATTTTGGGCACAAATCACCTCTGCCTTCATTTC
CTCGTCTGTAACATGGAAGTAATAAAGGCCCAGCATCCCAAAGTTGATGGTAAAAAACAG
GTATTTGTAAAGTACTTGGCACTGTCCATGGAACATAGTAGGACATTATACTTAATACTT
AATGATTGCATATTCTCTCCACTTCCATGAAGTGCACAATGCAATAGATCTTCAGGCCAG
GCTTCTGCATGGAGGGAAATCTTGGCATAGAGCAGGCACATAGGAATTTTTAAGTGAGTT
AAGAAAATAGGCCCAGAAATGATGACTTCCCCTCATCTGGAAAGGAAGGGAATAGGACTG
AGAAACCTCTAGGGGTCCCTTCTAGCTATGGCTTGGTCCTCACTATTGTCATTAATACCA
CTCCCTGAAGTTTATCTTAGTCTAATATTCAAGCATTTCTTCCTTTGGAGAGGCATGTCC
AAATTGGATGTTGCACACACCCTCCCATCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1426, 2627..2950, 4940..5050, 5599..5743, 6007..6261, 6823..6934, 7158..7272, 9728..9829
1001..1426, 2627..2950, 4940..5050, 5599..5743, 6007..6261, 6823..6934, 7158..7272, 9728..9826
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved