Monodelphis_domestica Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica EIF4A2
Monodelphis_domestica
EIF4A2
7
SNORA63, SNORA63
3833..3963, 4770..4904
8802
GCAGGGGATAACTGCAGACAAGAGTAACATAAACTCGGGCCTGCTCCATGACTTCCCTC
AGTGCTAAAATCGCAGGGCTTCCTGGGGTTTCCCACCACTCCTCCTACCGGTCCCAGCCT
GGCCGTGAGGGGACAAGGATGGTTCAGGATTCGAATCTGACTGGATCAGGGAAGGCTCTT
TGGCTTTACAGGCCAGGAACAAAGGCCCCAGGAAGGGGCCCCACCTGGCTGGGCCTGGCC
ATGCGGTTCCGGCAGGCCTAGGGGAGGGGGCGGGGAAGCTGAAATTTTGTCCCCCGGGGC
CCCTCCCGGGGAAACTTGCATCCGGTGGGGCTCCCCAGCAGCGGGGAGGGGAGGAAGGAG
AGTGAGGTGCCCTTTGGTATCCCCACCTTCCCGGTCAAGGGTGCCTTTCCATTCCCATCT
CCCCTTTTCACCTCTCCTCCGTCTCTCCCTCCTCCTCTTTCCCATCTTTCCTTCTCTTCC
CTCCCTTTCTCTCGGTCTTTCCCCCACCCCCTACACTTTCCTTTCCTTCTCCCCTCCCCC
CTTTCTTTCTCAGCTCAAGGCTCCTCCTTCCTCCCTTCCCCCACGCCTCTCCTCTCCTCC
TCCCTCCCCCCGCCCTGGGCTCTGCGGCAGGGACTGGGAGGAGAAACCCCGTAGGAGGAG
GGAGGGGGGGAGGGGAAGAGGGAGGAGGGAACTTGGACAGGCTCGCCTCTCCAATTGCTG
CAATATCCTTCCGCCATAGGCCAAAGAGTCCCCCTGCCTCAAGAGAAACATGGAGACTTC
TCGAGCCCCTCAAACAGCCCCAAAGCATCAGTGTAAGATTTTGAGGCCCCTCAGTTCAGG
ATTTTACCTCAGGCAGTGCCTCGGCGGCGGGATTCGTGGTCACGGGCGGGTTGGACGGGA
GATATCCCTCCGCGAGAAACGCGTCCCGGCGGCGCGCATATAAAAGGCGGGTGGCGCGGC
GCGGCTGTCTTTTCAGTCGGACTCTGAGCGTTGGTTCGGTCATGTCTGGTGGCTCCGCGG
ATTATAACAGGTACGCGCCTGCGACGGCGATGGGGCCCGGGTTTCTCGGGTGGATCAGGC
CGAGCCGCGGGCACTCGAGAAGTCGCCGAGTTTTCCGGGCGGCTTCGGGGGTGCTGTTCC
GACGCTGCTTCGAGAAGCTTCCACGGCGCAGCCGCGGGGCCCGGGCCCGGCCAGCCTAGC
AAGGGCGAAGGCGGGGGGAGGGGGCGCCGCTCCGAGACCTCGGCCGCGGCCCTGCCCTAG
TACTAACAACCGCGGGCGGCTCCCTTCCGGGCGGGGCGGCGCTCGGGAGGCTGTGGGTGC
GTGTGTGCTTGGGTGGTTACACTCTGGCGGGGCGGGGAGGACGCGGCGGCCGCTCGGGCC
TCTTAGCCCCCTCCCCCCGGGCTCCTCGGCTCGGGGCCGTTGGCGGCCGTGCTGTGCTCG
CTCGCCCCGCAGGTCCCTCCTCCCCCGCCGGAGCCGGCGCCGGTGTCAATCACGGTGCTG
GCGCAGTGCGAGGGGCGGGGCCCAGCCGGCGCGCGCTGCTCTCGCGAGAGCGGAGCCGCC
GGAGCCGCGCAGGGGGCGGGGAGCCGGGGCCGGGCCGGGGGCAGGTCCTGGGGCTGCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAACTGGAATGAAATCGTGGA
CACTTTCGATGATATGATCTCAAAGGAGTCTCTGCTCCGAGGGATCTACGCTACGGGGTT
CGAGAAGCCTTCGGCCATTCAGCAGAGAGCCATCATCCCTGCTATCAAAGGTGGGCGGCG
AAGGGGCCGGGCGGGGGCGCCGGGGTGAGCCAGCCAGCAAGGAACCAGGGGCGTGACATG
ATGGCCTACCATCTTTCGGGACTGACCTGAAATGGAGAGAACCGCTGTGCTGATCACAAC
CCGAAATGCCCAGAGAGGAAGAGGGTGCACCTTCGCTATGGCTCTGGTGGGGACAGTAAA
TGTGTATCCTACTTTTTTTAGGGTATGATGTGATTGCCCAAGCTCAGTCAGGTACTGGCA
AGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGCTCAAGGAGACCC
AAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGGTATCCATAGTGTAGTTGA
AAGAAAACGCTTGCTTTTGTGGCATGGTTTTCAGGTTTCACAACTGTATCTAGAAGAGCT
GAAGTGTGATCCATGCTGAGCTACCCTTTTTCCTTGTGGAAACAGCTCATTGATAGGCAT
CTCCCATAGTATAGAAGGCGGGTTCAGGTATGGCGTGCAGGGTAGCACACCAGTTTCCCA
GAAAATAAGGTCATGAAGTTTTCAGTTCTCAATGGAAGATATGATACTTTTCAAGATAAA
AGAAATTAATATGCAGTTGTGTAACATGAAAACTGCGGTGCACATGTGATTTGTAGTCTT
GTGATTTTTGTGATTCTGTGTTTGTAACTTTGCATGTTTAACTGCCTTTAAGGCTTGCTT
GCTACATTGGCATTTAAGACCTGGCCATGCCGTTTTTGTTTTCAAATAGACTATTGGAAA
ACAAGTTAAAATACAAATGAGTTTTAGACTGTTCAGTAAATTAGTTGTAGTTTATGACAG
TAAGAATCACAATGTGCTTAAAATTAGGTAATTAGGACATTTTTAAGACTTCAAGAAAGG
TTATACATCTATTTCCTGACTTAGAGGTTGTTACAACTACTGCCTGAAGGTGGAATGACA
GCCACAAGTGCTACAAGCTGCATGGATTTAGATAACCACAAGATAACTGAATACTTTTGC
ACTTTTCACATTAATTGTGGACCAGCATGAATTTTAGGTGACTGCATGCATGCAAGACTA
GTTACAGATATGACTTAGACCATTTAGCTTTTGTCTGCCAAGTTTTAGTTAGATTTCTCT
TGGTAATAATGTAAAAATAAAATCTTTTTAAAACTTAGATCCAGAAGGTAATTTTAGCTC
TTGGAGATTATATGGGAGCAACATGTCATGCCTGCATTGGTGGTACCAATGTTCGGAATG
AAATGCAAAAACTGCAGGCTGAGGCACCACACATTGTCGTTGGAACTCCTGGCCGAGTGT
TTGATATGCTAAACCGAAGATATCTTTGTAAGTTTTGAACTTCTAATTTGAATCTGTCTT
GGTTTTAATACTCTGGCTAATTTTATTCTTATTTTTTTACAAGTAATGTATAAATGTTGC
TGTAAAATGTGGTTGGACTTAGACATTTATTGCTCACAGATTTCTTTTGATTAATAATAT
GTTAATAGTTTACTGGGGGAGAGGGTCGACTGGGTGGCTCAGGATTGAGCCAGACCTCAG
ACAATTCCCAACTGTGACCCTGGACAAAGTCACTTGACCCCCATTGCCTAGCCCTTACTG
TTCTTCTGCCTTGGAGCCAATCCACAGTTATTGACTTCAAGACAGAAGGTAAGGGTTTAA
GAGAAAAATGTACTTGGCATGGGGGAGAGGGAATAGGACTTCTAGCTATTTCTTGTTTTT
TAACATGGTGCTGTTTCTTTAACAGCTCCAAAATGGATCAAGATGTTTGTTTTGGATGAA
GCTGATGAAATGTTGAGTCGTGGATTTAAGGATCAAATCTACGAGATTTTCCAGAAATTA
AGTACAAATATTCAGGTACAAACATGTGACATTTCTTGCCAATGTAAGGGGTATTGCAGG
TTCAAGTTACAATATGGCTGTGAAAGTGCCCATATTGTCGTTCCCCCTGCTCAAAGCAAC
ATGTTTCATACTATCCCTGTCTAACTGATAACATAGTAAGACAGGGACGCTTGGTCTCAA
ACAAAATCATCACTGAAATCAGTTATTAAGTTGGGCAATTACAATTTTAAACATTATACT
TCTCTCCTTTTTTTCTTTTAAAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGT
TAGAAGTGACCAAAAAGTTCATGAGAGATCCTATTCGCATTCTAGTGAAGAAGGAAGAAT
TGACCCTTGAGGGAATCAAACAATTCTACATTAATGTTGAAAGAGAGGTAAATTAACCTG
TGATGGAATTATGATGGAACATAATTTTAATGCAAGGCTTGTACCTTCTTGTTTCAAAGC
ACTGTGCTAAAATTGCAAAAATTAAGGCAATGCCTTGGTCTTTGTAATAATGCTAGCACA
GTATATACAAGAAGAAGAACAAATGCACTAGATCGAAAAAAGACTTGGGTGGACCTCTTT
CTTAATGTCCAGTGTCCTGTGTCTTAAGATCCTAGTGCGATATCTACCAATTGATACTGA
TGTAAACTGGTTGACTTTCTTAGATTTCAATTGCTGGTGTAGGAATGGAGGTGGGGCTTC
TGCTTTATTTTGAAGTATTATATTATGGAGACTGCTTGAAAATTTGTTTTATTTTGCTTT
AGGAATGGAAGCTGGATACTCTTTGTGACTTGTATGAGACACTGACCATTACACAGGCTG
TTATTTTTCTGAACACAAGACGAAAGGTAGATTGGCTGACTGAAAAGATGCATGCCAGGG
ATTTCACAGTTTCTGCTCTGGTAAGAGGCATGGTATCTTATTTCAGAATATTAATAATAT
CTAGGTTTTTTTCCTTACAGCATTTAGTTGATGCAGGAACTAGTTACAATATAGCAGTGA
AGTGCTTTATTGTCGTTCCCCCTGCTTAAATCAAAATGTTTTTTACTATCCCTGTCTGTT
TTGCTATATATGCCATAGCAGCCAGGGACGCTTGATCTCAAACATTGTTATTGGCTTAAA
ACCTTGACCAAGATTTAGCTATGGTCAAAAGTCATCAGCTTTTCAAGGATTCAGGTTGAC
TAAAGCAGTTGTAAATCTTAATATGGACTAAATTTTTGAATGTTTACTTGGTAGCATGGT
GACATGGACCAGAAGGAGCGAGATGTTATCATGAGGGAGTTCAGATCAGGGTCAAGCCGG
GTTCTGATCACTACAGATTTGTTGGTAAGTACGTTTTAATTTTTAAAAATCTGGACACTG
CTGAAACTTCCCAAACCCTACTTATCAGGGGAAGGTCTTATTACCTTTTCCCAGTTCAAA
GTAGTTTGGGAGAAAAATAGACCACACTCCACAATGAACTACATTGTTGTAGTCCATTAC
TACTTTGTGGCCAACAGTTTAGTGCAGTGTGGGGCACACAAGAAAATGATGGGTTTGGAG
TGGATTGATGGGGCTTGAGTTTTATTTTTTAAAAAAACCCTTTTTAAGACAAGGGCTGCA
AGTGCTAGGGAAGTCAAGTCACAACTGGCACATATATTGAGGCCAGAAAACTTAGCTGGC
CCTAAAGACTACTGGTGTTTTGTAATGTGGAACTTGAATTGTGTTAACTGCTTTTTCTAG
GCTCGTGGGATTGATGTGCAGCAAGTATCTTTGGTTATAAATTATGATCTACCTACCAAT
CGTGAAAACTATATTCACAGGTTAGTAAGATGGTAAATGATTGGATTGTATATATCATGT
TTGATGTAAATTTATGTAATTCATTTACTGGCACTCTGTAGCTTCCAATAAAATCTTGAT
TCAGGCCAGACAGCCTTGAAAATAGGGAATGTATTTCAGGAAGAAACATAGATTGACACA
GTGCTGCTATTTAAATGCAGTTATGTTGGGGGAAAGAGCTCTTGGCTTAGTTTAAAAACA
GTGGGAAAACTTACCTTGAGTCTGGAATGTGGCCCAAATTTTGAAGATTTGTAAAAGGAA
AGGAAAAAAGACTCGCTTTAAATTGAAGTCAGAAATAGGGTTTAGGTCTTGTTGCATTTA
TATTTGAGCCTTAGTTCTTTTTTAAGACTCATTTGTGTTCTCATGTTGCTCCTGTGTCTT
TTGTGCTTTCTTGGTGATTTTTCTCTAGTGGGATTCTCTTGGTGTGTTCTGGTAGTAACA
GAGTTTTGTGTCCCTGGCATATAGTTAATAGTGGCTTGATCCCTAAATAAATTAAATTGT
GCTTTGTTACTTGATGTAAAAAAAGACTTTTTAAAAAATACAGGAGTCGATAGCAGCAGT
TGATGACGTGAGATGGCACTCAGAAACGGCGTGACGTAATTTAGGACGTGGATTCATAAG
CGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATATTTGTTTTTCTTTT
GTCATGATTATTTGATATTTTAAGTTCCCAACGTCCTAGCCAAAGCCATTTTGTGTATTA
GCCTCTTGTATGTTAGGTGGTTTGTATTGTCTGGTTTCTATGAAGGAAGGCAGAACTGTT
GGGTTTAAACCACATTTTTGTTAACTTTTAGTGTGGTTTGTGTGTGAAACTGAGCAAAAA
GCAGTGATAAGTTTGGGTTTCCATACCAAATACTTGGAGAATAAGGAGTTAAGTTTTCCC
ACTGAAAAGAATTGTAAGTCCTAGAAAAATAGTTAACCTTCAAGTTATTTACATTTACAG
TCTACAGTTCCAGAGGTGCGTCGAAATGGAGTATATAACAATTCTCTTTGTTTCATTCCT
GGAGTTTTACATCTGTCCCAGGCTGACCTTCGATCTTTGCCCACTTTGGTATGGGCTTAA
TTCACTACCCCAAACAGAATACTGTCATCTGCTTAAAATCACAATGCTCAAGACCTGAGA
TCTCATTTTGCAGCCAGACACAAGCCTTGATCTGCTTACTTTTGGCACTAACTGCTGAGG
AAGATTTTTTTCCCTCGTCTAGATACTTTGATTAGCAGCTAGTGCTCCAAATAGAAGCAC
TCTATTACCTTGGCAATTAAACAGCAAGCAGCTGGTTAACAAGTGGATCATCTCCTTGTA
GGTTAAGGAATATACTATAATTATTGCTGTTTTTCTTTTATGCAGAATTGGCAGAGGTGG
TCGTTTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCT
TCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAGATGCCAATGAATGTGGCTGA
TCTTATTTAATCCCTGGGATGAGATGGTTTTGAATGCAGTGCTCGCTGTTGCTGAATAGG
CGATTCACAACGTGCATTGTGCTTCTTTCTTTGGGAATATTGAATCTTGTCTCAATGCTC
ATTACGGATCAGAAATACAGATTTTTGATAGCAAAGCGACTTTAGTCGTGAGCTCTTGTG
GGGAAAGAGCTTATTGGCTTTCTCCTTTAGAGTTAGACTGTTGGGGTTGGGTGTAAAAGA
TATGGGGTCTGTAAAATCTTTCTTTATTAGAAATTTATTTCCTAGTTCTGTAGAAATGGT
TGTATTAGATGTTCTCTATCATTTAATAATTTACTTGTGGACTAAAAGATATAAGTGCTG
TATAAAATCAGCCAATTATGTTAAACTAGCATATCTGCCTTTATTGTGTTAGTCAGTAGA
CTGAATAGGAAAGGCTTTTCAAATGGACTAATTTTTTTTAAGAAAGCATTTGAATGCATT
TTGTTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACC
CTGTTGCTAAGCCCCAGCAAGCAATCATAAACTAGGTAGGGTTAAACCCAGTAAAATTGC
CATATTGCACATGTCTTAATGAAGTTTGAATGTTCAATAAATTACTTGTATATTCACTTT
GAATTCAAAATGGTTGCTCTTGTTTAACTTATTGCCAGCTTCCTTCAGTGTTGTTATGTG
GGCTGAGGAAGATAAAATATGGTTAGGGTGTCTTGAAGGGAGTTCTTCCCCCAGTAAGTA
GAGAGCAATCCAGAGATAGGAGAAAAGTTCATTCATCCTAATTTTATTATCATAAAAATG
TACAAAGGTTTTTTTAATTGACATTTTGAGTTAATTGCTGCATCACTGTAGCACAGAGAC
TGATTAACTGTAAATGTTCATCAGCACCATCAGCCAGGCACTTATCTACTTCCTGGAGGG
AAAGAGGGAAAAGCAAATTAATTGAGGCCCAGGGATTCCCTCAAGTTTTATTTAGCATCA
AGGGATGCTAACCTAACCCTACAGCTTGCTTACCGCAAGTTTCTCTGTGATAATGGACTT
CTGTTTGTCAGTGAGGTCATCTTTTTCTACCACCACATCATGAAGTTGGTTTATAAGTTG
AGTTGCTGCATGGCCCTCATCAATTAAATCCTATTAGAGGCACAGAAAGGTTAGCTTTTG
TCCCCAGGGTTCCCATTTGTATTATTAAATAGTTTATGTTTACATACACACCTTTACAAG
GGCTTCCAGTTTTTCAAAAGAACCACTCTGACAGGCGTAGAATATGCCAGTAATTGTTCC
TGTGGGAACCACCTAAAAGGAAAAAAGATAACTTGAGAAAGATTCCCCAAGAAATCCCTT
TTTCACTCCAAACTGCATAAGGGCTCCCAGGAAGGTAAATTCCTCATAAGACCTCATTAC
TATGCAAAAACCTTTATGCCCTAAAAGTCAGATATTAATGTATTTTCTTGTACTTAAAAC
TTATCAGGGATGATATAGGGTCACTTCTCAGGGATAGGTTGGAACAGATGACCTCTAAGG
TCCCTTTCAACTGAAACCTATCAACATTTGCCACCTGTGGGTCAAACCTCAGGCTATAAG
GCACAAATGAGTAAATCTGGCCCCTTACCACACTTCTGGTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1068, 1779..1909, 2121..2260, 3098..3266, 3685..3794, 4043..4186, 4562..4699, 5034..5123, 5520..5599, 7005..7802
1001..1068, 1779..1909, 2121..2260, 3098..3266, 3685..3794, 4043..4186, 4562..4699, 5034..5123, 5520..5599, 7005..7146
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved