Monodelphis_domestica Locus ENSMODG00000016294
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000016294
Monodelphis_domestica
ENSMODG00000016294
7
SNORD70, SNORD70
7820..7907, 19442..19522
30135
AAGTGGCTCAATGAATAGAGTGATGAGCCTGGAGTCAGGAATACCTAAATTCAAATATG
ACCTCAGGGACTTAGCTGTATGATACTGGGCAAGGCACTTAACTTATGTTTGTTTTAATC
CACAAAATGGCAAACCACTCCAGTTCTTTTCTGCCAGGAAAACTCCATAGACAATATTAG
TGTGCTATGACCTTCAAGTACACTTAAGAGTCGGATATGACTGAATAACATACAAATATA
GTTCTATATACGCATACAATATTTAGTATAAACATTTTTCATGTAGAAATCTCGGGGCAA
TTTGTCAAAATCACATATAAATAACAAGTCTTGAATTACAGTCATCAACAGGTCCCCGGA
AACTGCTGGAACACACATGTTGAACGGAAGACTAAATTCCAGTTCAGCTTCTACATTTTA
AGACTACTTTACCCGTAATGGGGCACACTCCGTGTCACGCGCCCCACTTTAATTCTTCAG
TGTTTTTTTCCTACTTATTCAGCCTATCTGGCCACGAGACTCTAACCTGCCATATCCTAA
ATCCAGTTTTGGGGGAGAGGGACGTACGTTCGCTCTTGAATACCCGCGCAAGGCGGATTT
CCTTCCCTGCAACTAAAAAACGGTTTAACCGTAGCTGTCTCCAAGTCCCTCGAGAGCATC
CAGTCGGCCGATACTGCGCATGCGCAAGCGTATGCCCCTCCTCTCCCGGAAGTGGAAGTG
ATGGGTGGCATCCCAGAAGTCCTTGTCCTTCTATCCGCTCTAAGCTCTTTCCCCTCCTTT
GCCTTCCTGTGGCCTCACGTGTTCGGGACTTGGAGGTCCTCTGAAGTTTGCGCGCGCTTA
GCTCACCAGGAGTTTGCTGCTTACTCTGCCAGTTTAGAGCTGTGCGACTAAGGGGCTCCC
TAGAATCCGCTGCATCTGCCTCACCTTTAACCCGCCCCCAGCTTATTCGTGGTTTCGGCG
CGCGCGGGGGGCCGTGTGGCCTCTCGCGCTCTGGCCTCGCCATGTTGGTGCTGTTCGAGA
CGGCGGCCGGCTACGCCATCTTCAAGGTAGGCCGCTGAAGCTAGGTGCCTTTGGGGTGGC
GGCGGCTGCGGCGGGTCAAGATCGACCTCAGGCGCGTGGAGCGAGCGGCTGCGAGGGATC
GCAGAGGAGCTGTAGCATGAACACGTGGCTCCAGGGGCTGCGCACCAAGGCGTGGGGGAA
GGGAAGAGGCCGCTCTCCCTCGTGGAGCTGAAGGGATTGCTCGCCCCTGGAGCCCATGTA
GGGCCCTACGGGACTATTTCGCCCTCCATCCGGGCTTGTGCCGCTTGTGGGAAATTTCCA
CTCAGAGGGTGACTTTTTTAGGCCCCACTCAGTTGGACGCTTATTAAGTGATAGTCCCAC
GGCCAAACTCATGAACTCTAGTGGAATCAGTGACTGATTCGGCGAGGGAGGGATCAGTGC
AAAGGAGAGGGAGGCCCCAGCCCAGTGTGGGGAATTCTTACGTTAAAGAGAAAGCTCATT
TTCAAAAAATAATAATATTTATATGGTGTGTATTATTGCTAGTCATAATGCTAAGAGTTT
TACAATTATCTCACTTGATCCTGACAGCTCTAGGAGGTAGAAGTTTTTTTGTTTTGTTTT
AACAATTCACAACCTTCACATTCATAACAGCAGTATATTTCAAGTTTGCAAGTACCTTAT
CGGACCTCTCATTTGAGCCTTACAACAATCCAGTGAGATCATCATTTCCATTAAGTGACT
TGTCCACCATCATCCATTGTCAGATCCAGGATCCAAACCTAGCTGTCAAGACCATATGCT
ACCATCCGATTTGCTCAGTCAGCCAGTTAATAAATGTCTGAGGATGGCTTTGAACCACAA
GTCTATCTGACTTCAGGCTCAGCCCTCTGTCCACTCTCCTACATTTATAAAGAGCTTTTT
ATAAGCCAGGAACTTTACCAAGTCCTGAGATTAATTCTATAAGATAAGAGCTTGAGGGCA
GGGACTGTATTGCCTCTTGCCTTTCTTTGTATCCCCAGCATTTAACACTGTTCCTGGCAA
GTAGTAGGAATTCACAGTGCTTATTGGCTAGGTGGGGTGGAAGGAATAACCAGGGTACCT
AGAAGTCAGGTAACAAGATGAATGTTTACATTGCCAAAATGCTTAACTTCTTTTTTATAT
ATTTTACATCTTAAAATTTTTCAACATTTTCTAAATGTTTTCTAAAGTTATAACAATAAA
ATATAATAATAAATAATAATAAAGTTATAATAATTATAATTTTCTAAAATTATAATATCC
AAATTATCTTTCTTCCTCCTCTCCCCCATCCTAGGAGATGGTAAGCAATTTTTTCTGAAT
TATACATATGTTATACAAAACATACTTCCACATTGGTTATTAATTCCATATAATACCAAA
GCCCTACAATAAAAATACAGACTAAAGTGGAAAAGAGTATGTTTTGATCTGCATTCTGAT
TCCCAACAATTCTTCCTCTGGAAGTGGATAGTATTCTTTGTCATAAATCCTTCAGATGGG
GGCGGCTGGGTTGCACAGTGGATTGAGAGCCAGGCCTAGAGACTATAGGTTCAAATCAGG
CCTCAGACACTTCCCAGCTGTGTGACCCTGGGCAAGTCATTTAACCCCTATTGCCTAGCC
CTTAACCACTCTTCTGCCTTGCAACCAATACAGAGTATTGATTCCAAGGTGGAAGGTAAG
GGTTAAAAAAAAAAGTCCTTCAGATTTGTTACTGTATACAATATTATCCTGGTTCTGTTT
ATTTCACTCAATATTAACTTTTTTGTTGAAATTAGGTTGGTTGAGTAGGGGTTGCATTAA
AATGGTTGGAATTAAACTACAGAATTTTTTATTTTTTAATTCATGTGCATTACCTATGAT
AAAACAGTGTGGTAGGAACCATGACTAGTTCTACCTCGGACACACTGTTAAGTATGCACT
GACCAGTCCCTCCTTTCTGAGGGGTGGGGGAAAGATAGGACAGGGGGGCTATGAATTGTT
GAGTATATTCTAAACTTTATTCCTAATATCTTTGTCAATAACTACAGAAAGGCTTTGAGA
ATTTTGGTCAGTGGTTTTCTGTTCTGAGATTAGCAAATAGCTTTGCTTTTTTTTTTTTTT
AAGGATATTAGAGGATTGAAATGAGGGATGGAAAAAGCCACAGTAGATAAGTAAGAGAAT
CTCTCTCTTTGAAATGTAGACCAGGCAGTTAGGCTTAACCTCCCTTTTCAAGTATCAGTT
ACGCATCTCATGCATTCCAATCCCGCCTCTGTGACTTTGTACAAGTACTTTAACCTTTTG
GGGCTTTAGTTTCCTCATCTATAAAATGAGAGAGTTGGACCCAATTCTAAAAATTCCTCT
ATCCTAGCCAGCCAGGTCTGAAAATTGGTGCCCTCCACAAAAGAGGATAGGGTAAAAAAA
GATATAATTTGCTTGACACTAATACATGTCACAGCTACTGTAAGGCATCTAAAAACACAT
ATTTTACTGGCAGTGGGGTTCAGTATTATCTTACATCATTCAGCAAATACTTCCTGAATG
CTTTATGTGCATAATTATCCTCTGTCTTATGAATTAGGACGAAATTTGTAAAGTGATTTT
GATTCTTTGGATTTGTACTTCAGCAGCCCCAAGAATCAGTAATTTCATCAGTATGGGTAG
TCTCTTCCACAGACACATATCTAACCATTTATAACTTAGTAAATAGTAGACTCTTGTGGC
CAACTTGGTCCCTGGACAACAAATATACAGTCTTATCATTGAGTTCATTTTTGAAGCCTT
TCCAGCTTGAAAAAACCTGCTTAAATTTCCACTTAGTCACCTCTATATTGAAATTTTTTT
TAAAAATCAAGGTAGAAATTAGTGAAGGCTTTGGAATGGTGGGTACACAGTAAAATTAGT
TAATTTACTTGAAAAATAAGACCAAGGAGGCAGCTGGGTGGCTCAGTGGATTGAGAGCCA
GGCCCAGAGATGGGAGGTCCTAGGTTCAAATATGCCCTCATATACTTCCTAGCTGTGTGA
CCATGGGCAAGTCACTTAGCCCCCATTGCCTATCCCCTACTGTTCTTCTGCCTTAGAACT
AATAAATAGTATTGATTCTAAGACTGAAGGTAAGGGGAAAGAAGGGAGAAAGAGAAAATA
AAAATATGATCAAGTAGAGAAGAAATATGAATATCCTGTTTGCATTTATGGAAGAGGGAA
GTGGTGATACTACGAATAAAGCACTGGGCTTAAAATCAGAAAGACACTTCTCCCTCAGTT
CAAACCCAACCTCAGTCACCAGCTAAGTGACCTGGCAAGTTACTTAACTCTTACTCAGTT
CCTCACTGTAAAAATGAGCTGGAGAAGGAAATGGAAAACTAGTATTTTTGAGAAGAAAAC
CCCAAATGGGGTCACAGAGTCTGATGAAACAACATCATCTTTATATTACATATTTAGTAG
TATAAGGGAACAATGTGAGTGTATACCCAAAATCATGGCTATTGCATTTTTTAAAAATTA
ATTGAACTGATCTTTATTTCAGGTTCTGAATGAGAAGAAATTACAAGAAGTGGACAGTTT
GTGGAAAGAATTTGAAACTCCAGAGAAGGCAAATAAAATGTAAGCATTCTTGGTGGGGGG
ATGGGGAGGGGACTTAACCAATAATTTGCTTTTCCTTAATTTCAATTAATGCTTTGCTTT
AAAAAAATAATAACCTTACCTTCTGTCTTAGAATCAGTACTATGTATTGGTTCTAAGGCA
GAAGAGCAGAAAGGGCTAGGAAATGGGGATCAAGTGAATTGCCCAGGGTCATACAGCTAG
GAAGTATATGAGGGCATATTTGAACTTAGGACCTCCCATAACATGGATTTTTAAAAAAAT
TTCCTGTATTGACATCACCTAAATTTTCCCCTCATTTACTTTCCTCCAGAGAACTAGCCA
GAGTTTTTTGGAAAAGATAAGAAATAAGCAAAGCTGATCAATATTTTCAATATATACACA
ATATATGAAATGTTAGGTTACTCTGTGTCCAAGTTTGTTCTTTATATTTTTAATCAGATA
CTCTAAGACTATACCCAACCATTTTGAGCTTAGGCATGTCATATGTAAGCTGTTGTGACA
ACTTTAAAACTGACTTGATGAGACATGGTTCTAGTATTCATACTTTTATCCAACCTTTTT
TTTTTTTAAGATCTATACTTGGAATATCTGGTTTCATAAGTTTCCTATCATAGGTTGATC
TATAAAGTAATTCTCTTTTATTCATAAGAACTTCTGTTCTGCCATCTTTGTTCAAATTTT
CTTATGAAGTCTTATCAAAGTTTCTCTAAAAGTCCCAAGTCTGATGGGGAATGAGTCAAG
AACAGGAAAAATATAAAAACATTTCTTGAGTTCCCTCCCCCCTTTTAAAGATGGTGGAAT
AGCTCACTTACCTAATACTGAAATGAATGGGAAATGTAAAACTGTTTAATAAACATAATG
TATATATTCATGTGTGCTTAGGGCGTGTTGGAGCACAATAGACAATACGGCCATCCAATG
CAGCTGAGGAAATCTCCAGGTGTAACGACTTTTCGTGCCACTGGACCCAGGCTTCCAACG
CCGAGAGAGTGGGACTGTCTCTGTGCATTGACTTTTCCACTTAAATCTTCATGCACAAGT
GTCTTTGTGCACAAAAATGCACAAAGACAATTGTCATCCTTGGTTACCGAGAGACTACTA
CTATATATTCATGTCCTTATTGTGGCCAATTGAGTTCAAAACATGGAGGCTTAACAGAAC
AGAAATGAGTATAAATCTAAATGGAATCAGGATTGAAGGATATTCTGAGGCATGTTAAAC
TGCTTTGGTTCATAGTTGGCTATGGAGTCTAGTAATAATTTAGTTGTCCAGGGTGTATCT
TTGGCTCCCTTCTTGCAAATGTCTTAGATGATTAGCTTGTAATTTTTATACAATTTCAGT
TTTGGAAAACAATTTACATAGATTTAATCCTCAAAACAACTTGTGATTTGGGCACTATGG
GTATCATCACCATTTTATACCTGCAGAAACTAAGGTTCAGAGATGAATATCTTGACTTAA
GGTTTCTTCTCCAAATAAATGTGGGATCTGTCATTTAAATTAATCAGTTTCCTTTTTTTT
TTCCCTAGAGATAAAAGCTTAGTGTCTAATTAGCTGCTGGTACTGAATAAAAGTAACTAA
ATTGAATTTTCCTTTTTAAAAAATTAATTGTTATTTGTAGAATACTTTTTAAAGCCATCT
TTGTTATTCTCCTAGAATACTCCTGACCCTCTGGAACAGGTGAAGTAATAGTAACTAGGT
TTCCTGGCTTCATATCTTAGATTCAGATGTTCCTCATTGCAAATTACTTGATTCCTTGGA
GGATTTGCCTCTTCTGACCAATGTCTGTGGCTTAGAGGGGGAAAGGCTTATTGTTCTTTA
GAACTAACAAGGCATCATTAGGAGCTTGATGTTGTACAGTGGTTAGAGAACTGGATTTGT
AATGACTTACTAATCGTGTGGCTGGGCAAGTCACTTAATCTCTGCTACTTCAGTTTCTTC
CTTTCTAAAATAGAGACAAATATAATACCCATCTCCCAAAGTTGTTCTGAGGATAAAATC
ACTTGTAAAATGTCTTGGAAACCTTAAAATTATATATAAATGTTATTAATTATTTATCAT
TTCATTACTGTTGTAGTAAAAATTATATGTTATAACAAATTTCCACTTTTCTCCCAGAGA
TGACAAGCAATTTGACTTGAGTTATACATGTATTATCATGAAAAATATATTTCCATATTG
CTCATTTTTACGGGGCAGCTGGGTACCTCAGTGGATTTCCAGCCAGGCGTAGAGACTAGA
GGTCTTAGGTTCAAATATGGCCTCAGACACTTCCCAGCTGTGTAACCTTCAAAACACACA
CAGAACACACACACACACACATGCACAGGCACGCACACACGTTGCCTAGCCCTTATCACT
CTTCTGCCTTGGAACCAGTACAGAGTATTAACACTAGCCTTTATAAGCTAATTAGCAGTG
AATTAAGATCTGAGTCACTAGGCTGTTGACTGTCACAGCCAGTAAACAACTTTTTTTTTT
TAAGCCATTTGGCATTTGTAATAGGTGCTTCCATTTATTTACCAGCACAAGTTTCTGAGA
AGTATGTGATTTTGTATTTATGGTTACAACATAGAGGCAGCTTTATCATAATTGTCTCTA
GATTCTATTTCAATATTCCCTGAGAATGACTGTAAACCTGTGTTCACAAATGCTATATCA
GCAGAGCACAAACGCAGGCCAGATACTACTAAAAGGAAAAGTTCCAGATATGGGCTGGCA
ATGAATAGTTTTCTGTTCTCCAGGGAAAGTTTTTGACCACCAGGCCAAAGAGTATCTGCA
AAGATATGGGGAAAGTTATATGTAATAGAGCATTGGAAGTCAAGGTTCAAGTAAACCAGA
AACAGACTAACTTTTTAACCATGAGGAAGTCATTTTAGCACCTTTGAGTCTCCTTGTTCT
CTTTAAAACAGGAAGACTGGAGTATGTACTTTTCAGAATCATCTTGGGACTCAGAGGAGA
GATGTGATATATGTGAAGTACTTGGCAGACTTCAAAGTTCCATAAATATATATCAGTTAA
TAGTGGGGCAGGACCCATCCAAAGTTAAGTTATGCTTGTAATAACATAAGTATCTTTCTC
CTTTCAGAGTAAAATTAAAGCATTTTGAGAAGTTCCAGGACACAACTGAAGCATTAGCAG
GTAAGAAAAAAGGCTAGTCTGACTTTATTTTTATGATCTGGTTTTTGTAGTAAAGGTTTA
TTTGCATTAATAAGTAAGAGTTTTGTTGTCAGTGATGTACATATGTTGGAACTGAATCTT
AAGTGATATCATTTACCAATTCGTCACTACCACTGAGACAACACTGAAATTACAATAAAT
GAAATGTAATTGACTTAAGAAATAATTCACAGTATGTGAGCTTTCTGAGTGCCAAAATGT
TTGTATGTAGTATAGTTCAATATGACATATTTAAGTTCTGCAGAAAAAAAAAATTCTAAA
TCAAATCACACCTTGATTTTCTTTTGAGTAACTGAAGTTTCATGAATGGCTTCCTTTACA
TTCTTAACAATTTCTTTCCTCCTGGTTCTTAGCAAATTACTTAATGCTCTATAAACAAAA
CTGAAATGGGAGTTCTGTCCCATTGATGGTCAATCCTTTTCTGATGAGAATCACTATCTA
AATGACTTATTGTTTCATCTGAAGATAAGATCCTAAATAATGGCTTCCTTTTTTAAAATT
TCATAATTGAAACTGTTCTCTTCAGTTAACCCAATTGAAAAGAGTTACTAAAATGTCACT
TGAATTAAGTGATTAGAGGTCATTAGCCATCAATTGTACAGCTAATTAAAAATATTGACA
AGGAAAGGTGAAAGTATAAGAATAATAATCAGGCTTAAAATGCTCAGAAATCAAAGTTAA
GGTCAAAAGAATAAAAATTGTTTGCTATCACAGAAGCTTTTGAGTAGGTGCAGCATTATT
ATTTCCTCCCTCTGCTGTGAAAAAGAGATACATATTTCATTAATACTAGGAAGTGAATGT
GTAGAACAGAATAGTTGCGGATTCTAAAATGGAGGCAAACAAGTTGAATGGTAGTATCTG
TGTCATGACTAGAACACTAGTCATGACAGCTAAGTTTGGATCCTGCATCTGACAATCAGT
TACCTTGGACAAGTCACTTAGCCTTGTAAAATCTATAAAATGGAAGTGATGATATCACAG
TCCTGAGAGGTTTGAAAAGCTACTTTGTAAATTTGAAAGTAATATAAATGTCTTGTTATT
ATTTAGGCTTGACTTGAACCTGTTTTTGTTTTTGTTTTTTCAGTATAACCTTTCATCCTC
CACAATAGATGTTATGGCTTGACCCTAAGGGGTTTCCAACCAACTGTTTGGGACCAGAAG
ATGGGTCACATTTTCTCCTTTCCTCCATAGTCAGCCTAGGCTAGCCTCCCCATAAGTATA
TCATTCCCCTTCAACCCTTGCACACACACTTCCTTCAGTGGCCCCTCAGGGTGATTATAA
CCTAACTAGACTCCAGCATCAAAAGCATCGTGCTTCACCACCCCCTCCAGTTATCACCCT
GTGGCTGCCATCTGTGCCAGCTTTCACTAGTGGTTCTGGTTTTTCTAACTAGGGGCTAAA
GTGAATGGAAGGTCACACACTCCTCTTCCTTATACATATTTTCACATAGACTTTTCTTTT
TTTTCTGTGGGAAAATGTTTAGGGTATAGAGACAAATATACAGGATGTGTATGCTGAGGG
CATTGTCATCCTTCCAGCTTCTGTAAACGCCAAAACTGTAAAGATAATTTTTAGTGTTTT
GACTTACACTCTAAATTAATAAGAGAGAAGGAATTAAGGGAAGGAGAGAGAGAGAATGAA
TGAATGAATTTAAACTGCTCTGGCTCAGGCTGAGCCAAGCAGTAGTTAAAGGCCTAGGCC
AAAGTGGCCTCCCTGAGCCTAAGGGAAGAGTGAGTCAGTCTTATTACCACAAGACTGTCT
CCAAGCAAGCTCCAGTCCTCCACTGAATCTCCTAAACTGAGTTCAGAATCTAACTCAATT
CAACTCAAAACTCTAATTACCCTGAACTGACTTTACCCTTCAATCACAGTAGATGCTTTT
TCCCAGGACTGCCCATTCTTAGTTTTCACTACTTTTTAGTTCACACCTTCTCTGGTTAGA
TTATATCTTCTGAATACTTCACACCTCTTTGTTAAGCTTGCCTTTTGTAAGTTACTTGAC
CTTTTTGTGATTGATTTAACCTTTATAGGTACTTAACACCTTTTTTGTATTAGACTTAAA
AATAAACCTAGCTTAAGGTTCTAGCTTCACTATAAGGTATGAGTTAGGGACTTTAATTGT
TCAAACAGGAGTTTACAACTTTATCTTCCCCTAAGGCACTGTCTGAGTAGGGTGGAGTAA
ATTTAAAAGTTGCCAATACATTCTTGATTCTTATTAGGCCAAGTATCTCCGTTGTTACAA
TAATGGAATAGCTTAATAAAATCTTCTAAGGTACACTCTGAGTAGTTTTTAAGATTCACA
ATCCCCCCTGATAATCATTGGGAGACTAGTTTCCCCATTGATCATTCAACATAATCATCT
TGGAGTTCTAAACACTACAGATGTATACAATGTTCAATTTCCAGGTTCTTAATCTCTTTA
TTACATTTGACTCCTCATTTAACCAAAAGCCTTTACTCTCAAGTTATCAGTGATCTCTTG
ATTACAAAATTTGATGCTTTTCTCAGTTTTCATGCTTTGTGATCACTGCAATACTGTCTC
CTCGATATTACTCTCTTAATTTTCCTGTTGTCTGACAGATCCTTTGAATTACTATATTAT
GATGCCCTCTGCTGTCCTGGGCCTTCATTTCTTTTCTTTTTTTCTTTATATACACTGAAT
TCATTGGCTCCTGTGGTTTTAATTATCTGTGCAGGTTTATATGTCTAGTCTTAATCTCTG
CCCCAAGGTTCAGATCACTAAATGTCTGTTGGACTCTTCCTACTGGTTGCCTCTTAGGCA
TCTCAAATTACTCAGTTATAGCAACTTCGACATTATCCTTGCCCTTCACCTTTTTTTTTT
AATCCCTTACCTTCCGTCTTGGAATCAATACTCTGTATTGGTTCCAAGGCAGAAGAGTGA
TAAGGGCTAGGTAATGGGGGTCAGGTGACTAGCCCAGGGTCACACCCCTAGGAAGTGTCT
GAAGCCAGATTTTGAACCTAGGATCTCTCTTCTCTAGGCCTGGTTCTCAATCCACTGAGC
CACCTACCTGCCCATACCCCTGCCTCCTTCACTTTTATCTCACAAATACAGTTGTTTATC
AGATCTTGTCATTTCAACTCCACATTTCTTCCAATTGTCCCTTCTCATGCTTAAGAAAAA
ATTCTATTTTGTGTATACAGGATTTAGTTTATATAGATAATTAATAGGTAAATAAGACTA
TTTGAGTGGCATACTAGAAAAAAATTTTTTTCCTGATTGGGGAATACCATCAGAATTTTG
GATATGCTGCTAAATAAGATACCATAGGAGAGAGCAGCAGATTTTTTTTTTTTGCTTAAG
TAAAATGAGTTGCCAGTGCCTTGACCATCATTATTAAATTCTTTGAAGAACTTTTCTTCC
CCGACTGTGATATAAGACCAAATTAACATTATTGGACAGTTCTATTAAAGACATTAAAAT
ATGGACTCATCTCCCTAGAAGTATGAAAAATGGTATAATTTAATGAAGAATAAGGGAAGG
GTAGGCATCCATAAAATAACAATAATTCATATTAAAAGAGTTCAGAAAATTAAACTGTCA
TAAGGTATCTACAGTCCTATTATGAGGAAAGCCAATTTTTTAAAGGAAAAAAAATCGATG
TTAGGGCAAGAGAAAAAACCTGTAAATTTTTATTTTCCTAATTGTAAAATTCCAAAAGCT
AGGACAAGATTTTGAGTGGAAGCATTTATTGTCATTTAATTGGACTTTTTTTCCCCAAAT
GTCAGATGTTTCCCAACACTGAAATTTTCTGTAAAGAAAGGAACATTGCTTTGCTTTTAG
TAGTATAAAGTATATGTTTTGCTTGGTTTTAGGTTTTTTTAAACTTCTGGATTTTTTAAT
CTTCTCTTTCTATATCCCCTCCCCCTATCCAAAAAAAGCCTCTACAGCTTTGGTAGAAGG
TAAACTGAGTAAGAATTTAAAGAAAGTCTTGAAGAAGATAGCTGCAAAAGAAGCCCATGA
ACAGCTGGCTGTAGCCGACGCCAAACTAGGAGGCGTTATAAAGGTAAGACTGGATTTTCT
TACTTTGGCACAGTATCATTATCATTACTTGGTTTCTCCACACATACCTGTACCCCAAAA
TTAAAAGTCCTTCCTTATAGCAATTAAATATAGTCAAATCTGACAAATCACTGCATGTTC
AGTGTTTCTGAAAATATGTCTCCTAACCATGTCATTTCTCCTGTCTTCCAAAGAGATGTG
AAGCATGATTCTCCATCAATCCTTGGGAGTCATGACTGGTCATTGCATGGATGCGAGTTA
CCCATTCTTTTGGAGTTGTTTTCTTTACGATATTTGCAGTACAGTATATATAATACTATA
CACTTTGAAATCTTGTTTTCCTTCTTCTGCTTCAGGCCACAAAAGTCTTCCTAGGTTTCT
ATGAATCTGTCTCTCTTGTCTTAAAGCAAATTTCTTAAAGTAAGATTTGTTCAGTTTTGT
TTTTGTTTGTTTTTTTGAGTTGTGTCCAACTTTGTGACCCAATTTGGAGTTCTTTTGGTA
AAGATAATGTAGAGGTTTGCCATTTCCTTCTCCAGCTCATTTTACAGATAAGGAAATTAA
GCCAATTGAGGTGTCATGACTTGGCCAGGGTCATACAGTCTGAATCCAGATTTTAGCTCA
AAAAGAGGAGTCTTCCTGACTCCAAGCCCAGCACTCTATCCACTACACCCACAGCTTCCC
TAACATAAAATAATCCATTAAATTTATATTTTCATTGTTTAGTTATTAATTGAAGAAGTA
TACCCAGTTTTGTTTTCTGCTTTTAGTTAAATCCTCTTCTGCCAATAGACAGTGAGGACT
TTTTATATAGTTCTCTAGAGATTCAGGATAGTTTATATGATTTGTTTTGTTAATATAGGT
TTATAAATGTTGGTTTGTTGTGTCTTTCATTGTAAAATATATTACCTGTTTCTCAGGATG
TAAATTAATATGGAAAATGGGGAAAGTTATACATACTTGTGGAAAATACAGATTCTTTCT
TAGCCTATCATTCACTATTTAAAAGAAATAGTAAATCTGAATTTTATATTTCTCCCCTTC
CCCATCAAAAAATGGCAAATCAAATCCCTTTCCCTTTGCTTACCATATAAACAAATCTTT
GGCTTATAAAGTAACTTTAGACAGCTCTTCAATTGCCTACTTTCTCTGAAAGGAATAAAG
TTCAAAAATGCAAGCATTTCCCAGATTTGAGTAGTGGGATTAAAATATTAAAGTTAAATA
AAAAATTAAAATATTAGACAAAGAATAAAGTGATATGTAATATCTTAGAGACCACGGAGA
AAGCACTACACCGAAGCTCTGAAGTCATGGGTTGGAACCTTGGTTTCTGCTGCTTATTAT
ACTATGTGACCTTAGCTGAATTATTTAAGTTTTCTGAGCTTCTTCTGAAAATTGAGAGGT
TTAGTGTATGTGACCTCTAAAATCTCTTCCAGCTCAAAATTGGTGGTTTTATTAGGTTCA
TTAACATACTATACATTTTAACAAGGTTAAATCAGATGAAATACATTTTTGCTCTGACCA
TTTCTGTACAATTTAAAAAAAACCACTGAATGAGTGATAATTTAAAACATGCCTGTAGCT
AGTTTCAGAAATTTTTCACTCTCTTCATCAGCATTATCTGAAGAATATTATGTGCCCACA
ACCAGCATTTTCTATGGAATACTTAAAGAACTTGGGCTTAGAGAACATAGCCCTCATTTT
GCTTTCTGTATCTTCTAATGAATACCAATTGTCTTTCTCCATAGTCTAAGAAACTTTTTA
TTTCCCATTTTCAAGCATTCTATGTATATGTGTTTGTACTTCTGTTAACACAGGTTTAAT
TCCCAATGTAAGAACCGTACATAACATACAGTGCCACCTGGTGGTTGGATCAGGGATTTA
TTTTTAAACCCATACCATTCCAAGGCAGAAGAGTGGTTAGGGCTAGGCAATGGGGGTTAA
GTGACTTGCCCAGGGTCACATAACTGGGAAGTGTATTATGAGGCCAGATTTGAACCTAAG
ACCTCCGATCTCTAGGCCTGGCTCTCAATCCACTGAGCTACCCAGCTGCCCCCAGGATCA
GGGATCTTGACAGAAATATAGCATTGAATAGGAAAGAATTGGATGGAGCGTGGGCATGCC
TTGATTGTGATGGGGTTCTGCCACTTGTGGGACATGAATGGAAATTGTACCATAAGAAAT
GGTAGTATCTGAGAATTCAGAAAAATTTGGGAGGATATTAGAACAGTATAACACGAAAGG
GTTTTTGTCTACTAATCCCCAGGAATTGCTCTGAGGACTGGAGAAACAATGTAGGAAGGG
ACACAATCTGCATTCAGATGGGAGTAGCCAGAGTTAAAAGTGTGCTAGTGGTTGGAATTA
GAAGGATGATAAGCTAATTTCTAGTCAATTGATATATCCTGAGAAGAGAATTAGAAGGTT
CCTACTCAGAAACAGTGGATACAAGCACAAAGCCTCTATGGAAAGGCTGCTTATTAGCAT
TTTTCTGTTCTTTCTTTGCTCATTTTCAATTTGTGGTCTATTGGGAGGAGTTGGTCTACA
TGCAATACTGGTTTGCAGGTAAGGTCAGGAGCAACCTGTGATGTTTCTATAATTGAAAAA
TCTGTTACTTTCAAAAAGAACTACATTTCCTGGGAGCCTACTGACTTCTTTTCCTGATTT
CCTTTCGTTACTTACTTCCTGTAGACAGAGGATATTAGAGAGTGGGTGGTCCTCTTGGGT
CTCTTTCTTGGGATTACAGCCAGCATGGTGGTGGTGGTGGTAAGCTAAGCATGGGGATTT
TTTCCCCCTGTTTTCCATCTTGTGGTTTTTTTGTTTTGTTTTTAATTTTATTTGTTCAAT
TTCAAACATTCCTTGGTTACAAAAATCATATTCTATTCCTCCCTCCCCCCGCCCTTCCCA
TAGCCAACATGCAATTCCACTGGGTATTACATGTGTCCTTGATCAGAACTTATTTCAATG
ATGTTGTTTGCACTAGGATGTTCATTTAGGATCTATATCCCCAATCATATCCCCCTTGAC
CCATGTAATCAAGCTGTTGTTTTTCTTCTGTGTTTTTACTCCCACAATTTTTCCTCTGAA
TGTGGGTAGTGTTCTTTCTCGTAAATCCTTCCAAGTTGTTCAGGATCACTGCATTGCCAC
TAATGGAGAAGCCCATTACATTTGATTGTATCAGTGTATCAGTCTCTATGTACAATGTTC
TCCTGGTTCTGCTCCTTTCACTCTGCCTCACTTCCTGGGGGTTGTTCCAGTTCCCTTGGA
ATTCCTCCAGTTCGTTATTCCTTTGAGCACAATAGTATTCCATCACCAACATATACCACA
ATTTGTTCAGCCATTCTCCAATTGAAGGGCATCCTCTCATTTTCCAATTTTTTGCCAGCT
ATGAATATTCATGGCTGGATCAAAGGGCAGACAGTTTTTTAGTGCCCTTTGGGCATAGTT
CCAAATTGCCATCCAGAATGGTTGGATCAATTCACAACTCCACCAGCAATGAATTAATGT
CCCCACTTTGCCACATCTCCTCCAGCATTCATTACTTTCCTTTGCTGTCATGTTAGCCAA
TCTGCTAGGTGTGAGATGATATACCTAGGAGTTGTTTTGATTTGCATCTCTCTTGTTGTA
AGAGATTTAGAACATTTTTTCATGTTCTTATTAATAGTTTTGATTTCTTTGAATGAAAAT
TGCCTGTTCATGTCCCTTGCCCATTTATCAATTGGAGAATGGCTTGATTTTTTTGTACAA
TTGATTTAGCTCTTTGTAAATTTGAGTAATTAGACCTTTGTCAGAGGTTTTTGTTATGCA
GATTGTTTCCCAATTTATTACTTCCCTTCTAATTTTGGTTACATTGGTTTTGTTTGTACA
AAAGCTTTTTAATTTGATGTAGTGAAAATTATTTATTTTATATTTTGTGACTTTTTCTAA
ATCTTGTTTGGTTTTAAAATCTTTCCTTTCCCAAAGATCTGACATGTTATGTTCACATAA
TTTACTTACAGTTTCCTTCTTTATGTTCACCTAGTCTTGAGTTTATCTTGGTGTGGGGTG
TGAGATGTTGATCCAAACCTAGTGTCTCCCACACTGTCTTCCAATTTCCCTAGCAGTTTT
TGTCAAATAGTGGATTTTTGTCCCAAAAGCTGGGGTCTTTGGGTTTGTCCTACACTGTCT
TGCTGAGGTCACTTACCCCAAGTCTATTCCACTGATCCTCCTTTCTGTCTCTTAGCCAGT
ACCAAATTGTTTCATGACTACTGCTTTATAGTACAGTTTGAAATCTGGTACTGCAAGGCC
ACCTTCCTTCGCTTTTTTTTTTCCCATTATTTCCCTGGATATCCTTGATCTTTTGTTCTT
CCAAATGAACTTTGTTGTGGTTTAAGCATGGGGATTTTAAATGGGCTAATCAGCCATGGG
CATGTGGTCTTATTTTGTATTCCTCTTATTCCTTTATTTTTCATGATCATTAATAAATCT
AAAATATAATATTATTGAGATTTAATTTTAACTTTTACATTTTGGAGAACTTCTGTGGGT
TTAATAACTAGTTAGTACTGCTAGCCCCCAACCTGATGCTATTCAAAAGATTAGAAGTTG
GGCAAGTACCACTCTCCCCTGGGAATTATGACATGTGATCTCCCCAAATTGAAATATCTG
ACTGTGGTTGGTTCTCTTGAGACCGGACAATCTTCAGTATACCTCAGCACTGTGTGTGGA
TGACTATGGTGGTGTGACTATGGATTTACCCAGTCATAAACAGCTCTAAACTCCCATCAT
ACTGGTAAAGTCTCACATCATCCCTGACCTTGTTATATTTCATTGAGCCCTGGGGATGTG
CCTTCATGGAGACTTTCCCATAATGTAATCAGCACTCCACAGAAATAGACAGAGTGGAAC
ATGGGTGGTTTTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTTGTGGAACATGTTTGATAT
AAACCTGTGCACCCACAGCTACAGAGACCCTTCTGAACCCAGGAGCTCTAAAGAAGACTT
AGTCTGGTTTGTCCTTATGGCCAACCACTTACACAAGAAATAGATTTCAGATTATATTTT
ACCTATACTGCCATTGGGGCCAATCTTGAGGTGAAAATTTGTAAACTCAATCCAGGAACT
CAATTCTTTGTAGCACAGATCATGAATTTAAAATATGATGTCAATTGAATCTCCTAACAT
CTGGTGCTATTCATTTGGTGTTATCATTGTTAGTGTAAAAATTAAATCTCAAATAATAAA
ATATTATATTTTAGATTTATTAATCATCATTAGAAATAAGGAATAAAGACCTCATGCCCA
TGGCTGATCAAACCATTTAAAATCCCCATGCTTAAGTGTCCCTGAACAATCTGCAGGGAT
CTAAAAAACACTATCCACAAGCAGAAGATAAACTGTGGGAGTAAAAATACCAATGAAAAG
CAACTGTTTGACTACAGGGGTGGAGGGGATATGACTGAGGAGAGACTCTAAATGAACACT
CTAATGCAAATACCAACAACAGGGAAATGGGTTTGAATCAAGAACACATGTGATACCCAG
TGGAATTGCGCGTCGGCTGTGGGAGAGGTGGTGGGAGGGGGTGAAGGAAGAAAAGAAAAT
GATCTTTTTTTCCAATGAATAATGTTTGGAAATGACCAAATAAAAATTAAAAAAAATAAA
ATAAAATCCCCATGCTTAGCTTACCATCGCCACCAAGCTCCATGTCATCATGCCAAAGAG
CCCCAAGACAACTGCCCACTCGCTAATATCCTCTGTCTATGGGAAGTCAGTGGGCTCCTG
GGAAATGTAGTTCTTTTTTAGGGTAACAAGGTCAATTATACCCACCCAATACATCCCCTA
CCTACTTGTGCCCCTTGACCATTTGTCAGTTGGGGAATGGCTTGATTTCTTGTACAATTG
GCTTAATTAATTCCTTATAAATTTGAGAAATTAGATCTTTGTCAGAGGTTTTTGTCATAA
AATCTTTTTTCCTGATTTGTTGCTTCTTTTCTCATTTTGATTCCTTCCTTTCCCATAGGA
TCCCATAGATCTGACAGGTATACTACTCTGTTTACCTGATTTGTCAGTAAACATTTATTA
AGCACCTACTATGTGCTAAATCTCTGTAGTCCTTATATATTTCTATGATGATGTGCTCCA
GTGATGAAGATTATTTGCCTGTGACCTTTTTGTTTATTGTGAAATATTGTCAAAAAGCTT
ATTGTATTGCATTTAATCTTCATGATTTTCTTCATATAGGACAAACTGAACCTCAGTTGT
ATCCATAGTCCTACTATAACTGAATTAATGAGAGGAATCCGCTCACAGATAGAAGGATTA
ATCACTGGCCTTCCCTCTCGGGAAATGGCAGCTATGTGTCTAGGATTAGCACACAGGTGA
GTTGTTTTTTTTCTATGGTATCCTTTAGTACCATTAACTGTTTTTTAATTTAATTCCTAT
CCTAAAGACTAAAGTTTAGGATAGGGAATCACCACAAAGAGAGACTAGAAATTTAAAAAA
AAACTTTCCTCGCCTATTTCCAGGAAGGAAACATGTTAAAAGAGAAATTTCTCAATATTA
GGGGGTGGGGGTGGTTGTCAATTTGTAGTGCCCCACACTGTGTGCCCCCCACCCCCTTTT
TAAATACATGGATTGTTTCTGTATTAGCTAACCAGGCGTTTGATTTTTCTTTGCTATTTA
TATCTCTGAATCTCTGTCTTTCTTTTTCTGAATATCTTTAATTTTTCCTAGACCTACTAG
TACAGAGTGATATATAGAATATTAAGAATTAGGGGGGATTTTTGAGGGGTTACCTGGTCT
AACCTTCTATCCCCAGGAAAAATTTCTCCTCAGTATCCTTAACAGTCAGTAATACAACCT
GATTTTCTGTCATTCCCCAGTTTACCTTGAATCATATTTAACTTTTTTAGATGATGAATC
TTCCCCCAACCGAATATAATTTCCTTAAGTGCAGGGAATATTTTGTTTTTTGCTTTTGAA
TTAGCTACCTATGCATAGTAAGTAATTGATGAATCTTTGTTGAATTTAGATTTATATATT
TGATTACTAAGTTTATTTAGAATCCTAAATAAGGATTCTCAGCAAATGGATCCTTAGCAA
TAAGATGCTGTCATCATTATCAAAATGATTTTTTATGTGTGTTTCATAGAAGCATGCAGT
ATGTATATATTTGTGTTATCTGCTTTGTTTAAAGGGGTAGCTTTACTAACATTAAGTGGG
TTTTTGCATAAATACGAAAGCTGGTAGAATATGGCATGAACTGTGGGCATGATTTCTCTT
GTCTTATAAGTTTTGTTTTATATACTACTATATCCTGGTAATAGAATTACAAGGAAATGT
TTTTTCTGCAGAATAATTATTGATTTTATTTATTTTGCAGCCTTTCTCGGTACAAGCTGA
AATTTAGTGCTGATAAAGTGGATACCATGATTGTTCAGGCAATTTGTAAGTAAAAGTATT
TATGCCAGGCTTTTTTTCTTGATTATTATCTTATTCTATGTATTATGATATGGTGGAAAG
AACACATAAATCTGATTTCTGATCCTGGTTTTACCATGGATTCTATTTGTGATTCTCTTT
TTAACTTAGAATACTTTATAGTAGGTCATTTTCATAATATGTTTTAGCAGTCTTTAATTT
CCCTTATTGTTGTCAGTGATGGATTTTGTTGAATGAAAAACAAGTGATTTGACATTCGTC
ACTACCACTGAGACAACAGGGAAAATAATATATTGTTCCTCTACTTGTCAGAGTTGTTTT
CAGTAGTTTATAGTTGTAGCATAATGCCCTAAAGAATAGTATAGTATTCTATCCTTTTTC
TAAATATAACAGAATTTGTTGCTTTTTTAATTGGAAGGTTTTAGCTAAAATAATAATGGG
CTTGTATAATCTCAGAATATCAGTGATGCTTATCTGAACATAATGTTGCTTTTGGGAATG
AAAAAGTGGAAGTAGTATTCATATAAACAACTTGAGAAAGGGAAATAAAGATGTGGCTGT
CTGGGTAATGAAAATCAACTTATTTGATCTTACATTTCATATGCTTCATTCTGCTTTATA
AGAGCTGATATGTTTCAGCAATTGTGATATTGGGCTTTTCAGATAGCAACAAAGTTTTTA
AAAATAGCAATGATAGATTCAGTGAGGTTGGAAATATTTATCAAAGAGGAATTGATCAAA
TAAAAGAGAAAGTGATTTTTTTTTGTAATAGCTGACACCGAGAAGTTTTTCAAACCCATA
AGAGTAATATTGATAAAGAAGCCAAAGAATAGGTCATGTTCTAGAAAAATATTGAAATTT
TAAAAGTTCTTTATGTTAAATATGAACCTTGAGTAAAAAATGCTCCTTAAAACAAGTATT
GTTTATGCTTAAGGTCACTCTTAACATATAGAAGATAAGGTGTTTCTTCTGCAAATTAAT
AATATACTAGAAAATATTGCTGTTAATATTCTAGAAAATATCTCCATACAGTTTTTTTTC
TCACCTGACTTAAATTTTTCCAACAGTTATTAACTTCTCACCGATTTTTTGTACCTAAGA
AGTTATAAAGAGGTTGTCACAAATAATGAATAAAATGAAAAACAAATATGAATCAAAGCA
CACACAGTTAGTATGAAGTAGTCAGAAATGCTTTTCTTTCAGGGAAAGAGAATTCTTTGC
TATGGTAGATGTGGGAATTCAAATAGAATCTGTTGCTTAATAAACATCCGCTAAGTACAT
CTCGGTCTGTTTTTATATGAAGTAGATTCCAGTGTTCTGCTGAGTCTGAGTTTTCTCTAT
TGATAATAAGTGCAGTAAAGATTCCTTTTTGATTGAGAAAGAAAAATGGAGAATAGCCTA
AAGATTTCAAAAGCGATTTATAATAGTATTTTTTAATGGTTACAGCAATACATTTTAAAT
TTTGATAGCTTTTGCTTTTATATAATATTTATTTCTCAATATATCCTTCCCCTCCCCAAA
GGAGCCATTTAGCAGAAATAACACTTCAATATTGAATGCTATATTCAATGTCGTTAGTCT
TCTAGCTCTGTCAAGCCAATACCATCTAGTGACATTGCTGTTTCTTTCTTTTCTAATGTT
TTAACAGCTTTATTAGATGATTTGGATAAAGAACTAAACAATTACATTATGAGATGTAGG
GAATGGTATGGTTGGCATTTCCCTGAATTAGGAAAAATCATTACAGATAACTTAACTTAC
TGCAAATGTTTGCGGAAAGTTGGTGAGTATAAATCATTTATTATTTTTTCCTTTGGGTCA
AGAAGTGCATTCATATTAAAGTCTGACAATTGATTCCAGTAGTATACACTGACATTTAAG
ATCTGTGATGTGGGTGATTATGAGATTGGGGGGGCTGGGAATTACTCTTACTTGGGCTTT
TATTTAGGAATCATCATGCTGAATTACAATTTTATCATACATTGGAGTTATTTGGTGGTA
TTTTGATTCTTATTATGGTTTCATGATGCATTAGCGTCATGAAATATCTTGGCACCACTT
TGCTCACTGAAGCACATTCTGAGCTTTTATCTCTTGGAAGTTTACAAGTCTGCTTTGCCA
AAACAAACAATTCTTTGCTTACTGTGTACCGTCATACACTCTCAAATAGAGTCTGTTTTG
TATTTTGTTTGTGTGTGTCTGTTGTTTTGCTTTGCTCCAATTATATGGAATAAATTCTTT
TTTAAGTAAGTGTAAAACTAGAAAATCTCAAGTGTATCCAAAGCTCAATATCATAAGGAA
AACCACAGAACTGAATTTATTCATCAATTTTTTGTTTTATACTGTCATTTGGTTCATTAT
CTATTTTTATCTTTAACCTTTTTTTGCAATGTTGTGTGTGCACACATATTCATACACCAA
TCATTGGTTTTTCTTTTCTCCCTCCCCTGTTTCCCTGCCAGGGGACAGGCAGAACTTTGC
CTCTTCAGATCTTTCTGAAATTTTATCAGAGGAGGTTGAAGCTGAAGTAAAAGCAGCTGC
AGAGATTTCTATGGGAACTGAAGTTTCAGAAGAAGACATAAACAATATCTTGCACCTCTG
TAATCAGGTAAAACTTATTCTAGTGAGTGCTTGGCCATAATAAAGTTATAAGTCACAATA
GTGATGGCAGTGATGATGATTTTATATTGATTCTCACCCGATTTACAAATATGAGGGTAT
ATAGTCACTACCTCATCTGATGCCATCTTGAAGTGCTTATTTGGACAAAATCATATAATT
ATGGAAAGTCCTGTATAATTCTGATTAACTATTGGAAGTATCACAAGATGAATTAATTTC
AAACCTCTAACAAAACAGAAGTAAGGTATCCATGTAACCCACAATCTAGGTAATCAGCTT
AATTATAGTAGAGTGATTGGGATTGGGAGGTGAGAGGGGAGCAATATAGAACAGTGGAAA
GAGTCCTGAATTTGGAGCAAGAAGTTAAGTTTGAATCCCAGCTCTCATGCTCTTTAACTT
TGCAAGAAAATCAATTAACCTCTTAATGCCAAATCTTGTGTTTAAAAAAAAAAGTTTGAC
TGGTCTTGCCATTCTCCTCCAAATAACAGTTTTTTGATTATATAATTATGTCCCTTGAAG
ATTTATATAATAATCTTAATTTAGAAGAAGAAAATATTATCACTGAAATAGAAAGTTTTA
ATTTGAGGGGGTTAATACCAAATATATTTGGTAATGATATCATTTAATAGGAAGCTGACT
ACATAAGAGTGCTTTATAGACTGGATTTTTCAGCTTGTTAACAGATTCATGTCCCAAATA
AGGCCCAAACTTCTCAAATCACAAATGTTTTTCAATATTAAACCTAGACAGTTTCCTCTT
TTCTTCTCTGCCAGTCACTTGGACTTTTCTTATCCTACCAATATTGAGCCTCCATACCTC
TTAATGTTTGGCCACCCTAGATTATGTTGGTTATTTTTTTTTTAAGCCCTTACTTTCCAT
CTTGGAATCAGTACTGTGATAAGCTCTAGGCAATGGGTGTCAAGTGACTTGCCCAGGGTC
ACACAGCTGGGAAGTGTCTGAGGCCAGATTTGAACCTAGGACCTCCCGCCTCTAGGCCTA
GCTCTCAATCCTCTGAGCTACCCAGCTGCCCCCGATTATGTTAGTTCTACATTATTGAAC
AGTCTAGTTCATATTCCTTAGAGCAAGGAATAGTTTCTCTTTTTTGTTCAGACCCTGTGA
TTTTATCATTTTGAAGAGTTTCTTGGGTAAAACATGGTACTAGTTTTGATCAGCAACTGG
TTTTCAATTTGTAGTCAGAGAAAGTTGTTTGGGACACTGATAGGTTAAGTGAATGACTCA
GGATCACACTATTTTATTTTTTTAAACCCTCACCTTCTGTCTTAGAATCAATACTCTGTA
TTGGTTCCAAGGCAAAAGAGTAGTATGGGCTAGGCAATGGGGGTTAAGTGACTTGCCCAA
GATCACACAGCTGGAAGTGTCTGAACTCAAATTGGAACTCAGGACCTCCCACCTCTAGAC
CTGGCTCTCAATCCTCTGAGCTACCCAGTTTCCCTTCATGGTCACACTATTAATACTGGC
AGAGGCAAGACGTGAACCAAAACCATTCTCAGTCTAAGACTATTTTCTACTATCCTGCTT
CCCAACTACCAAGTATAAGTCTTTTCACCTCATCAGGGAAGAATTCTTGTGTACATGCGA
TGCTTTACAAGTCAGAAGTTATAGAGTGAATGTCCCTAGAAAATACTGGCCTTTAGGGCT
ATGGAACCATTGAATTTCTTTTGATACACATAATTTAACTTTTGCTTCATGTAGATGTAT
GTGTGTGATGTGTATAATACATATAAGTTTGTTAAATTCCTTAAAATGGTGCATTTCTAT
ACACTTTCCTTTGTACTAGGTGATTGAGATCTCAGAATATCGAAACCAACTCTACGAGTA
TCTCCAAAATAGGATGATGGCCATAGCCCCCAATGTGACTGTCATGGTTGGTGAGCTAGT
TGGAGCAAGGCTAATTTCTCATGCAGGTAGGTCATTGTCATTTGAATTTTTTTATGTTCT
TGCTTTAGTGGTAAGCATCCAAGAGCTTTCTTAAGAGCTCTAACTTTCAGTGAAAAGCAA
GAAATACTATTACACCAAGTCATCCTGTGTTTGTTCAAGATTGAGGACTGAAGTGATCTG
TGATGATTTTAATTTGTTTGCCTGACTTCCTTTTCAATAATGAGGGCAACTTTAGTCACT
ACCTCTTCTGAGACACTTCAATTCCCTTTGTTAGATTGTATTAGAACTTATTACATGACT
CTTACTTTGGCTATTGAATAGCATTGGAAAGTAGAATGGAACTCTATATTAACACTAACT
GCCTAGTAAAATTCAAAATAGAATGTTCATCTTAGATAGAATCTACTGGAATTTAGTTGT
GGAAATACAAAAGGACCTGTTAGCCAGTGATTTATTATGCCAATCCCACAACATTGGACT
CAGGGGTGATAGTATAAGTGAAGTTCCAGGATAGTAAATAAAAGGGATAATTAATATTCT
AGAGTTGTGCAGTTGTTGCTATTAGTTGAAATTGTTCATTCAAACACAATATTTTTCTCT
TACCCTAGCCTTTGTATGCCCTAAATGTAAATATTGCTATTTGAACTTGGTGTTTTACCC
CCTGTTTTAAACAGCTACAGAAAAGGACCTATGCCCACTGTGGTACAAAATGTTTGTACA
GGCTTCGATGACTTGACATTCATATTTTAGCTCAAGATTTCAAAGAGTTTACATGTTTAA
CACTAAGTACAGTTTATAACCTTCTGTCTTAGGTTCCCTTTTGAATTTAGCAAAGCATGC
AGCTTCTACTGTGCAGATACTAGGAGCTGAAAAGGCACTCTTTAGAGCCCTGAAGACAAG
AAGGGACACCCCTAAATATGGCCTGATTTATCATGCTTCCCTTGTGGGCCAAAGCACCCC
CAAAAACAAAGGAAAGGTGAGTTATTATATATTGCTCAGTTATCTGTTTCTCAAGAGGAA
AAATTGGCAAAAATTCTTTTCCTTCTAGGAAACTTGTTGCTCCATGAGTTTGCCATCAGA
CATCAAGAATCTTTTATTTTAGTTATTGCCTCTTTTACCATGTAAGTGAAGAAGAGATAG
CTATTAATGGGTTAAAAAATTAGAAGAATTTTGGAAGGGGTGAAAACTCAAAGAAATCTT
ATCAGTTGAATTTTTCTGGACTAATGAAGGTAGAAAATATACCTTGTTATAAAAGAGCTC
ATTTCATTATGTTGAATTCAATTTTTTTTCTTCCAAAATCAACATAATAAATGGGATCTT
TGATTCTCTGCATCTTTCTGTTAAAATTGTAAACTGGTAAAGATGTAGCCCACTGCTAAC
TCTCTTGTAAAAATCTATCCTCTATTGATATTGTGTGAGAGAGAGAGATATTTATGCAAA
TTGTGAACTGATGGAAGAGTAGGAATGTGTCCATGGTTGGTTAACATGCCTTGTTTTTGT
ATTAATAAGGCCCACGGTGCTCATATAATTATTTCATAATCATCTGCATAGACTAGGCCC
CATCTTTTAACTCTTGAGTGCCATTTCTACTGTATCTTCCCTGGGTATAAACAGCATATG
CCACAAAATAGGTAAAAATGTGAGATATTTGTGTAGAGCTAATCCTTCGAGTTAGGGCAA
TGAATGAATTTGCCAAGGGGGAGTGGACAAGGATGGCCAATTTAGTGCATAAGAGCAAGC
ATTGGACATGGAGTTCGGGTATAATAGTTTACATCGTGGCTCCAATACTATGTGTAAGTT
TAGGCATAAAGCTTTCCAAGCCTTAGATAATTGGAGGTAGAGGATACTTTGTAAACCTTA
AAATCCTCTCAAAATCTGAGCAAAGCCTATAGGCTGAGTTAAAGAGAAGGTAGAGCAAGC
ACAGATCAAGAGGAGGAAGTACAGGCAGGCAGAGAGGCAGAAGAGTGAAATCTTAATAGC
ACAGACTGAACAATGGGAACTTTAGACAAAGAAGCCAAAGATGAGCATGGAGGAGCCCTA
TTGTTTCAGGGACCTTGGAGAAAGTAGCTTCAGTAGAGCAGAGTCAAAAGTTAATTGTAA
GAATTGTCATTGTTGATGAGAAAGGAGGGGCCATGGGGTAACCAGATTTTTTCCCCCTTG
ATTTTTGTTTGGAGGGGAATAGAAATAGGGAATGGTAGCCAGCTGGTTTAAAGGGGTCAG
AAGGTTAGTTTGGGATTAAAGAAACCTTTGAATTTGTAGATGGTTAGAAACAAGCCAACT
GAAGGGTGGCACATTAACATTGGAGGAAAGGAACATTAGGCAAAGGGAGAACAAGGTGTA
GAGTTGGTCAATCCACATGGTTTTGGCTTTCTCCCCAGAAACAGTAGGGAAAGAGGATAT
GAAAGTGCTGACTAATAAGGAGGTTCATAAGGAAAGGATGGACAAGAGCACAAGGGTTGT
TGGGACAGTCTTAACTAGTATAACACTGAAGTGTAAGCCATGGGATCCATGTTGAGGAAA
GAGAACCAAAAGTCGAAGTTCATATTAAGGATGTTGAATGGGATAAGCCAGTGATGGTGG
ATCTATGACATGGGCACCAAATATGGCACACATGGGCCCCACACATCCCAAAGTTCATTA
CTAGAAAGGCAGAGGGACTTGGGCAGAGCTGCTCCTCCTCCTCTCCACCATGCCTGATAA
CATTTTTTCACATCACCCACCCCTCTGCCTAGCAGCCCAATGGCAACACTTTCTCCCTCC
CTGGGAGGAGGGGTGGGGGTAGAGCCTGGCACTCTTTCTCTAAAACATTCACCATCACTG
TAGTGACAAGTTTTCCAGAAACACTTTTTAAAAGTTCTGGATCTTGGAAATTGTATCATT
CTGAGCAATAATAGAACCATACATTGGGAGCATGGAGAAAGGGGTGGAAGTTAAGAAAAG
TGAATAAGTGTCTTTGAGCAGCTACTATAAGCAGAGTCAAAAAACATGATTCCAGTTGTG
TTCTCCTCTCCCCATATTGGAACATGAGTCAAACTAGGTGTTAGTCATCTTGGTGTATCA
ATTGAATGTCTTTATCCTCTGTGTCTCTCTCCCAGATTTCTCGAATGTTGGCAGCCAAAA
CTGCTTTGGCTATCCGTTATGATGCTTTTGGAGAGGATTCTAGTGCTGAAATGGGAATTG
AGAACAGAGCCAAATTAGAGGCTCGACTGAGGCATTTGGAAGAGAGAGGGGTAAGATCCA
TGTTCTTGCTTAATATTCAACAAAATAGGAAGATTTCCAGGAGAAAAAGTTCTAATTTGA
CATCTTAGTACATTTTGGTTAAAGGAAAAAAATAAAGACACTAATGAAATAAGGCAAAAA
GCAAAATAGTATTTTTGTGAATTTTAAAATGCTTGTATCTGGGCAGAAGATCACTATACT
TCTTTCCTTAGCTTTATTAAACCTTACTACTAGTTCACATTTTTAAGAAATGAGTGGTGG
GTTTTTTTTCTTAGCTAACTCAGTCTTGTTCTTTGTGTATTTGTTTAGAGAGTGAGAAAT
TAGGAGCAATTTTTCAACTAGAATCATCTTGGAGTGTAGAATAATTTAGTTACTAATTTG
ACCCAAGCAAGCTAGCACTTATTTAAGTGCCTGTTTTCTGTGAGGCACTCTGCTAAGCAC
TTTACAAATATTAATTCACTTGATCCTCAACAACCCTGGGAAGTAGGTGCTGTTATTAGC
CTCATTTTACAGATAAGGAAACTGAGATAAATGAGTTGCCCAGTGTCACACAGAATGCCT
GAGAATCAATATAACCTGTGGACCTCCAGCATCCTAGGAACTGCAGTGTTGCCTTAGAGG
CTGAATCTTCCTGAGTTTCACTTTCCTCATCTACAGAATGGGGATGATAATATCTCTAGT
ACCTTACACATAAAGCTGTTGTAATATGTAAATGTGCTGTTGTCTATATTTTGTAAACCG
TAAAGCAGTCCTTTGGCATTTTAAAAATGTTAGTCATGGGGCAGTTGGGTAGCTCATCTC
CCTAGCAGTTGTGATTGATAGTGAAAGCTGATCAAAAGCACAATGATCTTCTCAGCTGGT
CAAGGGGTACTAACCTACAAATGGCTTCATTCACTTTATTCATATCCATCACAGAGTGTT
GTAGAAATGTAGCAAATGATCACAGAATTCTTTGTTGTAGGTGATTTGATAATATCTAAT
CCGATTGTAGAATGTCATATACGTAGAGAATTGATTGTGTGTCAAAGAAGCATGTACCTG
GAAACCTATATAATAAATGAACCACGGCACTATGACAGATCACTATGTGTGATGCCTGCA
TATGTGGATTAGAATATACAGTGTTTCTCATCTCCTTTATCCGACTGGGTCCTCTGAGAG
GCTGCTATGCTAGATAGACCTCAATAGCTCAGTGGATTCAAAGCCAGACCTAGCAACAGG
AAGTCCTAGGTTCAAATGTGGCCTCAGACACTTCCTAGCTCTGTGACCCTGGACAAGTTG
CCTAATCCCCATTGCCTAGCGCTTACCGCTCTTCTGCTGTGGAACCAATACGTTGTATTT
ATTCTAAGGCAAAAGGTAAGGGTTTAAAAAATAACAATATTAATAATAAAAATAAAAGTT
AGTCCAGTCCTCTTGTGGGCCTCTTGTTTCTTTGTGTGATTTCAAGTGATTCATTTGTGT
GATTTCACATGGCTCGATTCAACACAGAATTATTAAATGTACAAGGATAGAACTATTATA
GGATGAAATGAGATTGTAGATAACTAAATTGTTTGATTTGGGGTAACTGTTGCTTTCCTT
TTCAGATAAGAAAAATCAGTGGCACAGGAAAGGCATTAGCAAAAACAGAAAAGTATATCC
ATAAAAGGTAAGTGGGTGGGCACTCATTGTGGCGGGGGTTCAGCTGTACCACACCTGTGC
GTGCTTACCTATCATGTCAGTACACTACTGCTTAGACCTCTGCTGTTTCTTGTCCAACTA
AATAGTCCCAGATCTTTAAATAGTTTTGTGCTATTGTGGCTTAATATTGATTCAGTCATG
ATCAAATTTATTTGAAAGACTCTTTTAATATTTAATTCATACACCTCCCCAAAACATCTC
AATTGTAAGTCACACTATATTTTAGTGTTAAAAACCTATATTATGCTACCTCGTACAGAT
TTCTAAACATCTTCCTGTCAAAACGATCATAAATATCTGGTGCTTGATGAAATTACTTGA
CTCTCTTTCAGCGAAGTAAAAACTTATGATCCATCTGTTGATTCAACTCTTCCAACATTG
TCTAAGAAACGCAAGTTTGAAGAAGTGACAGAAGAACAAGATGCTGAACCAAAGGTTGCA
GTGAAAGCAAAGAAACCCAAGATTGTAGAAGTTAAAGGTTGTTCTGAACTTCTTTTGTCT
AATCTATACTTGAGTTTCTTTGTTAGTTGTTGATATCTGGCCTTGGAAAGAGATTTGGAT
TTGAAAGCCAAAATAGCAAGTTCTTCTTGACGTTTGAAACTTGTATATTTTGAAAGCTGA
TAGTATTAAATTTGCAAGCTAAATATTTAGTATATAGTTAGATTATCTTTTAAAATATTT
AACAGTGTGCTAATATTATATGGGAGCAATGGTATTCTTTTTTTTTTAATAAACCCTTAC
CTTCCATCTTAGAATCAATACTGTATATTGTTTCTGAAGCAGAAGAGCTTAGTAAGGGCC
CAGGAGTGGAGGTTAAGTGATTTGCCCAGGGTCATACAGCTAGGAAGTATCTGAGGCCAC
ATTTGAACCTAGGACCTCCTGTCTCTAGGACTGGCTCTCAATCCACTGAGTCACCCAACT
GCCCCTAAAGGTTGTTTTGTTTTGTCTTTTCAAGAAAGAAAAATACTTTACCCGTAACCA
TATGACGGTGTCGTTAAATATTTGTGTATGATTGCTTTTATATCTAGATTGTTTCTCAAT
GTTGGTAAAGTTACATTACCAAAATTGATACCGTTTTCATTTGTTAGTGACTGATTACTA
ACACCTCTTCTAGTGCATGTTCTTTTTGAAGTATGAAATTTATTTTAGTCACTATTTTCT
TGAGATCCTATCTGAGCATGTCACTTCAAAAACAAACTTCACATTCCTACTTCATTACTA
AGTTCTCCTTATACCAACATACCTGTCATCCACAGATGAAGAAGTGAAGAGATCACAAGT
AAACAATTGAGACTGAAAAAAGTCATTAGCCTCTAGACTCAAGTCTTCCAGGCTAAGTAA
TTTGAAGTTTAGAACTTTGGCAGTTGGCAATCTTTAGCTCGCTCACTCACTTGCTTTCTT
TCTCTTTTTTTCTTTCTTCCCTTCATTTCTTTCTTCTTTTTTTTCCATTTATACAACTTG
TGCACAAAGAAAATAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 4522..4598, 7687..7739, 11678..11802, 18039..18175, 19180..19244, 20887..21021, 21701..21846, 23659..23785, 24572..24735, 26855..26989, 28565..28626, 28991..29135
1001..1045, 4522..4598, 7687..7739, 11678..11802, 18039..18175, 19180..19244, 20887..21021, 21701..21846, 23659..23785, 24572..24735, 26855..26989, 28565..28626, 28991..29135
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved