Monodelphis_domestica Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica EEF1B2
Monodelphis_domestica
EEF1B2
7
SNORD51, SNORA41
3122..3199, 3478..3612
5499
AGAGCTGGAACGTCTGGACGAGGCCGGTAGAACCACGGCCCGCGTCGCCCTTCGTTCTC
GGGGGTCACTTGGGTTTCCCTGCGGCACGACCCGAGGACCGAGGTTGCGGGTTGGGCCCC
ACTCGGCCTCCCAAGAGGGAGGGGAACGTGGAAGGGCACCCGCGCCGCCCGGCCCGTAGG
GGGTGCCCGGTTCCCCCGTTTGGGAGGCGGGGACACTGACTAACCTGAATTCAAGGGCAA
GGGGAGAAAGAGGCTCGAGGCCTTGTCGGCCAAGAAGCCTGCAGGCACAGCGCTTCCCTA
GGCCACCTCCGACCCGGCCCTCCTCTCTCGCGCCGGGTCTTACCTTCTGCGGGGGGCGCT
GGCACGGTTAGGTCTCCAGGACCGGAGCAAGCCCTCAGCTCCCCCGTCCTTTATTCTCTA
TGGCGCCTTCGGCAATTTCCGTCTACTGGTACGATACGAGACGAGGTGGCAGCGAGAAAG
ACTTCGGCAATTTCCGGCCTGTGGGAGGGATAGGACTCGGCCATGTCCGTCAGGAGGTTC
TGCGGAGGCGGGGCCAGTTTGGTTCGGCAATCTCCGGAGCCTCCAGGTTACGTTTCGGTA
GTTGTCGATCTCTGGGCGCCCGGTACCACGAATGTCTCCGGGGGAAAGAGCTAATGTCGG
AAATGACCGTTTTTATTGTTTCTCATTAGGGAGTCAAATGTTTAGAGAGCTACAGGAGAC
TTTAACACGCAAGATAATGAATTTTAAAGGCCAAATGGGGGTAGGTCTAATGCGAGAACT
TTGCCCTTTGAACTCCGCCCCTTTTCCTAGCGTGGCGAAGCGGAAGGATACGCACTGACC
TTATATAAGGGAGTCGCCGCTTGAGCGCGGCCCTTTTTTCAGTCGGCGGCCGGCGCTATC
GTGTTTCCACGCCGTGCTCCTCTTCTACTCCGGGCTCAAGTCCTCCGTCGCCGCCACCGC
CTCTTCCTAGCCCCTACACCACCACCACCACCGCCGCCGCCATGGGCTTCGGAGATCTCA
AAACACCCGCGGGCCTGCAGCACCTCAACGACTTCCTAGCGGACAAGAGCTACATCGAGG
GGTGAGCGAGGGCCCCGGGGCGGCGTCTACAGGGAGGCCCCTTAGATGCAGCGCGGATGG
TCAATGAGGGCCCGGGCACGAGAGCGGGCTGCGGCGACGGGAAAAGAGGAGGAGAAAGAG
GGAAGGGAGGCACACTCACGGAAAGGACACCCGAAGGTGGTGGGGAGGAGGAGGTGGAAG
CCCTAGGATTGGGACCCATCTGGGTGGGACACGTGGCCGTAGCTCCTCGGGCAGCGATGC
TGGGCCGGGCACCTCGGGCCTAAGAGGAAGGGGGGGAGGTGACCCAAGTCACCACTCCTC
TGCACTGGACTGGCCTGCCACACGTGTGCGGCCACCTCCTCATCCGGCTTTTACACACAC
CCCCTTTGATTTTCTGAAGGCCGACTTAAACATGGTTTGTAAGAGGGGGAAAAAAGTACT
TTGGAGCTCAGCAAAGTGAAGGCAGGCGTGCGTCATGCCTGTCTAACTGGCTGGGACTGT
GGGATATATTTGTAATTGGCGTGCTGGCGTTGCTTCCTAATTGGCGTTGTTGATTTGGTT
TGGTCTTTAGGTACGTGCCATCACAGGCTGACATTGCAGTATTTGAAGCAGTTTCGGGCC
CACCGCCCGCAGACCTGTACCATGCTCTCCGTTGGTATAACCACATTAAGTCTTATGAGA
AGCAAAAGGCAAGGTAAGGTTATGCTGGTGTGTGAACGTCCTTTGAAGGATAGAAACTCA
TAAGGTTTTTCACATTCCAAATTTGGACCTAGGCTATTTTAGTTTTGCTGAGATGTTGTA
AGCTTAATTAATTGCTTGTGCCACCTTGATAGGCCAAGAGACTGAAGTCCTCCATTTTTT
CACAGAACAGGTAGAACATGGACAACAGCAATTCAAGTTTTCCCCACACTGTCCTGCCAA
AATGCCTCGACCCTGACCTGGGGGGGCCACCTCTGGGGTGAGAGGGTAGTTCATCTATGG
CTCATTCATTCAATCCTTGGCCATGCTTCTGAAACTGCCAACAAGGGTGGAAGTTTGGGG
AAGTGGACAACCAGTTCACTAAGAACGGAACTGAACATACTGTTATGAAATCTCAAACAA
AAATGTTCATACTGAAAGATTAAATCATAGTGAGTATTCAATATAATGTCTCCAGGGTAG
CAGAGTGGTTTGGGTGTGAGAATCTTAAAAAGTAGGAGTATTTAAATGGGGTATAATAGA
AATGCTAGTTTTTGAGTACTAAACTTGTATTGACTTATAGTAATGCTGAAGTTAATGTCC
TTTTTATAGAGGAGTTTGAGTGTTAAGAGGTATCAATGTTCATGCACTCCCCCCCCCCCC
CCATTTAGTGTAATTCCAATTCCTAAAACTAGGTCAAAAGTAATCCATTTCAGCTTATGC
ATTAGATTCAGAAATGCATCTTGATTGTTAGTATTCTAAGAAGTGTTGCAGAAAATGTTT
TTAGGTATTAATATTTTATCAGTTTACTGTAAATGGTTGAAAAGACTGATGTGAGGCATT
GGCATTGGTAAAATTTGTTAGGGCTTTGATACAAATTTGTTTTAGTGACCTCAATTTTAG
CATTTGAAGTTATATTGAAAGTGATAGTGTATTTCTTTTTTCTTTTAAGCTTGCCAGGAG
TAAAGAAGGCTTTGGGCAAGTATGGGCCTGCTGAACTAGAAGATAACACAGGAAGTGGTG
GAGCTACAGATAGCAAAGATGATGATGACATTGATCTCTTTGGGTCTGATGAGGAGGAGG
TATGTTATTATCAAGTAGAAATGTGCATTTTTGTTATTGAGGTTAAAGTGCCCACATATT
TGTGCATAAATAGATTTTTTTAGCTCTTAGATTTCCCTCAGAAATTACGTTAACAAAAGA
AGTGCTCTTTGGAGTCATCTTAGATAATAGCATTCTATTAAAATGAATTTAAGTTTTTGC
ATATGGGTACCTGAGGGAAGACCTATTTTAAATTCATATTGTAGGTGTTCCGTTAGTGGT
CACTCAAAAATGAAGTAGATCAGATAGTTATGACTAGTTATGTGACTTAATTTTAAAACT
TGCTGGCTACATGATGAATAAAATCTAATCACCATCTTTCGGCTGAGTTCGTGATGGAAT
TGCTTTTTTCTGATTGGCTGGTCTGTTTTCTGTGTAAATTGTTGACTAATTTTAACAAAA
AAGTAATGCCCTGAACTGTATTGAATTCTCTCCTTAGGAAAGTGAAGAAGCAAAGAGACT
AAGAGAAGAACGCCTTGCTCAGTATGAATCAAAGAAATCAAAAAGTAGGTTGTCTTAAAA
CTTGACCTTACACATTTTAGCTCTTGTTGAGAGGGAAGCCAAAACATGAGGTTATTAGCC
CACTCTTTCTTGGTAAGCTTGATTCTTGTTGGTTGTACCAGCCTATGTGTTTAATACATT
CCACAGCTACTGGTCTGCAACTGTTCTCATCTATAGCAGTTGTTGTATTCCACTGTGGGA
AAGGAACTGTTACACTGTTAAATAACCTCTTTCTAATATAACAGAAAGTGGGTTCTTTGT
GTGACAGACACCTAGTTAAGGATCTTTTAATAATAAAAGACACTACTGAATTTTTTGGCA
ATTTTATGTTATAGTTTATTCCAGATTCTATTAGAACTCCATTGTATAATACAGTGACAA
TTCATGTTCATAATAATGGCATTGAGACACATCAATACCCTGAAGTACCTTTTATTTAGT
GTCTACCTGCTTGGAGTGCCTATACTCTGAAATGTCAGGTTTACTTTTCTGTCAGCTTGA
GTTGCTATTTATTGGGCAATGTTTTAATTAATTAGATGGGATTTTTTTTAACATTTTTTC
CACAGTTGTGTGTATCTACAGAACAAAATGCTGGGGGATACAGTGGGGATAGCTAGTAGA
TTACGGTATAATGGGGGTTACATAAAACTTTACAATAAAATAGGAGACACTGATTGCTAT
TTCTCAGATAAGAGGAAGAAGATGGCATTTAATTTGAACCTTGAAGGATGAGTAGGAATT
AGTAATAAGACTTTATAATCTTTTTACCTTAGAACCTGCAATTGTGGCCAAGTCTTCTCT
CTTACTGGATGTAAAACCTTGGGATGACGAGACAGATATGGCGAAATTGGAGGAATGTGT
CAGAAGCATTCAAGCAGATGGCTTGGTCTGGGGATCTTGTAAGTTGAAAAGTAACCTTTT
AAGTATTGATTGGCATCTTATCATGAGTTTGTGATAAGATTAGCATCTTTATTTTTTTTT
CCTTCCCAGCTAAACTAGTTCCAGTGGGATATGGCATCAAGAAACTTCAGATACAGTGTG
TAGTTGAAGATGATAAAGTTGGAACCGATATGCTAGAGGAACAGATAACTGCCTTTGGAG
ACTATGTGCAATCCATGGATGTTGCTGCCTTCAATAAAATCTAAAACCTACCATCTTTGA
AATTTTCATTTAAATAAAAATATTTGCAAGCAAAAACCGTATCACAGGTCTTCTTAATAG
AAAGGCCCAAATTTTACTTGAATTAGCTGAAATTTCTTCCAGTCCAAACTGCTAGCTTAC
ATTTGTTTCCCATCATCCACAGGAATGCATTAGTAGATTTTCCCGTTTTCTTCATTGATG
GTTTTTGGAATGTGATTTGTATAACAATACATACAAAGTATTTCCAGGAGTAGAAATTTG
GGGAATTTTAAGGTAAGGAGTTTTTAGTGTGCTGCAAATGATTTAGTAAGGAAAGGAGAC
TTGGAGAAGTGACTTAAAATGTTCAAGATTAGTGCAGAGTGGAGCAGCTGGGTGATTCGA
GGATAAAGCTGGGACCCTAGGTTCAAATGTGCCCTCAGATACTTTCTACCCATGTGACCT
AAAATAAGACCCTGAAAGGGTAAAAGTAGTTGAAACCATGGACACTATTTAAAAGTTTAT
CTGGGGCCCAGATAAGGATGACTTCCAAAAGCTGAAATAAGACGGAGAAATATAAAATAT
TTGACATTGCCGTCTTTCCCCCCCCCCATTATCCTACTTTGTATCTCAACCTAACCCATT
CTAAAATGAAGTGGGAGTTGGGCCTTTTGCCACTCTACTCCCTCTGGCTTTAATTCTCCC
AAAAGGTCTGGCTTTTGTCACCAGGGGAAGTTCAGGTCAGATTTTCTCAGTGGCTTCTGA
AGTGTCCACTAAGAGCAATTTGGTTGCCTTGAGGGTTAGACTCCTACCTGTGGAAGGTTG
TGAGGCTTGTACAGGGAAGGGAAAGAGACAAAAACTGCAATGGACTGTGGGTGTAGTAGT
ATGAAATTGCTCCAATACCATATTTCCTTATGACCCTAAAGGAAAGATTGTGAATATGGA
TTTGCTGGCAATGATGTATCTGATCCCAAAGAACTGGTGAAATAGCAAGAGTAAAGGGAA
AAATGAATGCCTTGCCTAGGTCTAATGGAACACTCATTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1080, 1630..1752, 2689..2818, 3277..3343, 4112..4237, 4329..4499
1001..1080, 1630..1752, 2689..2818, 3277..3343, 4112..4237, 4329..4480
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved