Monodelphis_domestica Locus IPO7
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica IPO7
Monodelphis_domestica
IPO7
5
SNORA23, SNORA23
14038..14220, 14954..15136
31304
AGCTCCTCTCAAAAGTCCTTCTGTCTTTCTAATAATTAACTCTTGACAGGCAAAGGTTT
GTCATCATAGGGTTAGGCCATTGGGTTTAAGGGACTTGCCCAGATTCACACAGGTAGGAA
GTGACTGAGGTCAGATTTGAACCCAGGTCCGGTTCTCTATCCACTGAGACACCTAACTGC
CTCTTTTCTATCTTTTTAAATTACTGTTAAACATATGGAAAATGTAATATCTAGAGACTG
ATCATGAAACCACTTAAATTCAGGACTTTATTTTTTTAACACTTACCTTCCACCTTAGAA
TCAATACTAAGGCAGAAGAGTGATTAGGCCTAGGCAATGGGGGTTAAGTGACTTGCCCAG
GGTCACATAGCTAGAAAGTATCTAAGGCTGGATTTGAACCCAGGATCTCCCATCTCTAGG
CCTGACTCTCAATCCACTGAGCCCAGCTGCCCCCTCAGTACATGTTTAAATGCATAACTA
TTAATTAATTGTAAAATGGTATGAGAGTCAAGCAATTACTTTCCTTTCTGAGATCTCACA
GTTTTGGAACTTTAGGCTTGCATGCACATGACTACAAATGGAAGTAGCATGTATGTGTCA
AAGAAACTAATTTTTCAGAGAGAGAAATAATTTCTTTGTAGCTTCATTAAGCAAGATTGT
AGAACATGAAGTATGATTTTTAAGTTGTGCCCTGAAATAGCCAAGACTGAGGTTTGTTTT
TGATGGGGCAGATGGGTGGTGAGTAAGAAGTGGAGGTAGGAATATGTGAGGTGTGTTTAG
GAGACAATGAACACAGATCAGTTTGGCTTGAGCAGGGTGATGTTGGGAGATGGGGATCAG
TAGAGTCCTTTTCCATCAATCTTGGAAAGGTGGGATGGGGGTACAGATTTTTAAGTACTT
AATTGATCCTTAATATTTTTTTTAGTTGAACTGGCCACCGTATATATTTTTAAGTCTTAC
TTGTGCAGAGCTTTAAAATTTCATCTCCTTTGCTTTTGTAGGCCCACAAGTCTGTGAACT
TTGTTTCAACTCTGCTACAAATCACCATGTCGGAGCAGCTGGATTTACCAGTGAGACAGG
CAGGCAAGTTTGCAGCGACCTTTTTTCTTTTGAATGTGGAAATGTTTTTTTAAAAGTTCA
TAATTGAACTGACTTTTATCCAATGACATGATGTTTAGTGGTTTTTCTGCCTATTGGGCT
AGAGTCCAATATCCTGGGTCATGAATGCCTACGTTTTCAATGGCTCAGTGGGAATGTAAG
ATCATCGTTTCAGCATAAATGCCTCTTTGATCCTAGACAAAAGGTATAATTCCAAAAAAA
ATTAAAAGATTCTTAATAAATAAATGTGAACTTGGAATGTTTAAGTATGGTTTAGGAAGA
TGTGTCCAAAGAGTCTTTTCCTTTACATATGTTTTTATCCTTGATTGTGGCCTGTGAAGG
ACATTTAATTTGATAGCCCAAAGTTTAAGGACTACTTATTTATTAAAAACTTATCTGAGA
AGCAGTAATCATAGAGCTTACTGTTGTTTTATGCTTGACCATATTTTATATATGAGAACG
CTGTAGGAAACATGAACTTGGTTCACAGTTTGTATATTTTCTTATAAAGTATTGAAGTTT
AGTACTGTCAGTTGTAGACTTAGTCACATTATTTATACTTTTATTTATACTTTTAGATCA
CTAATAAGGGTCATTTTAAATCCTAAGCAGTGGAATGTAGGTCACAATTTGGGATTAAAG
CTAGAGCTTTTCTTGGCTCTTGAGAAGACCTGACTAAATTTTGTAGACTTGAGACTATAG
TTGCAGCAAAATTATTGAATCTACTAATGTTAGAAAATTAGTTTTGGGAGAATACCAGAA
CTCTTTGTCTATTCTTTTTGATATGTTAAAATGTATATAATATGCAAGTTGTAAATAGAA
GGAAAGTAGCAATAATTAGCTCCAGTTGTATCACTTATCTTTAGAAGAGTCAGAAGATGG
GTTGACTTTTGAATCTATTTTAAAACAGGTTATGCCTTTTGCATAAATACATTAATAAAT
TACAAATTAGAGAGCCAGTATTTTTCAGTAATTGGTATTTGAGTCATTTCTGATAACTTT
ACATTTGTAATTTAGATCTGTTTTGTATGTCTAAAGAATACTGCTCAGGCTGTATGTTCT
GTAGTCTCATTTTTTAGTTCAGCTTGGTAACTATCAAGACTTGAAAGTACAGCATTCTGA
TTGCTGATGAGAAGGTATGGTCTAGAATCCAGTGAAAAACTACTTTTGAGTCTCAGAATT
CTAAGTGACATTTGAAACAGATTACATTTAGGATTGTAATATATTGTGCTGCAAAATAAC
TTTCTTACTGATTTGAGTAAAATCATTTTGATTATCAGAGCCATGAACTGATTTTTGTCA
TTTGGTACTACGTAAAGCATTGAAGAACTATTTAATAAATTCCGTAAATTCTAGAGCAGT
CTTGCAAATTGCCATTTGCCCTAAGCAAATTTCATTTCATATTGTTTTCTAATCTAATAT
ATTAGAATCTTGATTGCCTTTTAAAAAATGATTTATTCATACTATTTATTTGTGCTATAC
TATTTGTATCACAGAAAACCAATATCTGATTTTTACTTAATTTCTGAAATAATAGTAATG
ACACTTTTGTTCAACGAGTTGGAGTTAATTTGAAAGCACTTCAGATTTTTCAGTGAACAT
AAATAACACATAAAGGGACTATTCATGGCACATAACTATTCTTTTGTCCACCTGTCCTGA
TATCTTTCAGGTGTTATCTATTTGAAAAATATGATAACTCAGTATTGGCCTGATAGGGAA
ACAACACCAGGGGAAATACCTCCATATACAATTCCAGAGGAAGATCGGCATTGTATTCGT
GAAAACATCGTAGAAGCTATTATTCATTCTCCTGAACTTATCAGGTATTTTAAACTATTA
TTCATTGTTTCAGTAATATCCCATTTGCTCTATCTTGGTCCTTTTTTTTTTTAAGTCCCT
ATATTAGGTACCAGTGTAGTAATAGTTTGTATACTATTTATAGTTGGTTATGAGATAAAA
AATTCTTTTACTGTTCAGCAAATATATCTGTTAAATTATTCTTAATAAGGAATTCTGTTT
GATTTATATTTTGTATAATCTAATACACCTAATCATAATCTAATGTGTAATTTAATTATT
TGTATATGGGTCTCTTTCTCTCAATACTAGCTTTGAAGGGTAGGGATTGCAGTCCTTTCC
TTATTTGTGTGCTTTCAGGGCTTTCATATATTTTCATATACCACAACAACCCTATGGCAT
AGGGAAGATAGTTTTATAGGTAGGGAAAAGATTGTCAGGCAGCTAGCTGTTAATGACCCA
AGATTTTTGGGAGTCCTTGACTCTTACTCTGTCCAGAAAACTGTAATGGAATTTTGAGTG
ACTGTTTCAGTTGCTTTTTTCAGTCTGCATTTCTCAAGGCAAGGTCACAATTCGAAATTA
CATTCATAAATCAGATTAATAAAATGTCTGAACATAATTGCACTATGTAATCTTCATAGC
ATTTTCACCATTTATATGTCTTATTCGACTTTCAGGGTACAGCTTACTACATGTATTCAT
CACATAATCAAACATGATTATCCAAGCCGCTGGACTGCAGTTGTGGACAAAATTGGTTTT
TATCTTCAGTCTGAAAACAGTGCCTGTTGGCTCGGGATCCTTCTTTGCCTTTATCAGCTG
GTGAAAAACTATGAGTACGTATCTCATTCTCAAGCTGCAGATTATATACTTAGGGAAAAA
ATCTATGATTGTAACAATAGATAGAGGAAGCTCAAGGGCGAAATTAAGATTTCTTAAATA
TATTAAGACACATTCTTTTGAATTGCGTGTTGAATATAATTTGGTCATCTCCATTTGTAA
TCCTGTGAATATTAGCCAGTGGTTCTTAGAAGTAAACTTGAATCAAGAACCATTTTGTTT
GTTGTTGGACTTATTTCGACTTCACCTTTTTTCAAAGTATGATATAATCTGTTACTCCTA
TTTGTATTTTATTCAGTCCACCAAATTCACTTCCTTATTGTTCCTTATATGACCCTTTAT
CTCCTATCTCCCTGCCTTTGTGTTGACTATCCCTCATTCTGGCCTATAATACTTTCTCAG
CATCACTTCTTAGAATCCTGATTTCCTTTAAGAGTTACTCAGCTCAGTAGCCACCTCCTG
AACTTCCCCTCCTGAACATCTCCCAGTCCTAATGTTCCTTCTCTGTTGTTTTTTTTTTCT
ATTTTCTACCTGCCTGTATTTGTACATATGTCTTCCTATAGAATGTAAGTAGCTTAAGAG
AAAGGACTACTTCAATTTTGCTTCTTTGTCTCCAATGCCTAGCACGTAACAGTACCTTTA
TAAATTCTTCAACTTGTGAAGTTTGACTCTTAAGGGTGATTAAGAGTTGAGAAAAGACAG
GAGTCAGTGTTAGATGAAGAACTTATAGAAAAATGGCCCCTAAGGGGAGATGCACAATAA
ATTTTTGGTTGAAGAATGGATAGAATTTGATCTTTAAATAAATTAGATCAATGGGCACTG
TCAGACAGGAGAAATTAATTATATTTGGGTCACAATGGCCATAAGCCTATATTTTCAGGA
TAATAATAAGAAGGGTGAGAGTAACTAGAATGGAGATTTAGTGATGGAGTAGTGAAGTCA
TTTCTATTAGGAAAAGACATCAGATTATGGAGTGCCTTAAATGAAAAAAAGGAGTAGATA
GAGAGGTTCATAATTCTTAAAACCACTTCTAGTTAAGTTTAGGTCACAAGATTCAGATAT
TCAAATAGTTTGTTCATAAATTTATGAAATTTCATGGAACTTAAAAAAATTTGTAAAAAA
GGATTTGTTTCCTGTACCAAGTTAAGTGGAATCTATCTATTATATAAAGTCAAATGTACA
ACACAATTATAGCATAGCTTCTTGAAAAATGTGAAATTTTACTTAAGAATATAAGGATTT
GACCATTATTTATGTAACATAAATATACACAAATCATCTTACTAGCATCAACCATGTTTA
ATTGATTAGATTGTAAGTTGGCTCAATACCTTAATCAATTCATAGGATTTCTCCATAGCC
AGAATTTCCATTCAGATCATATAATGTCCCCCAGAACATGGAGATGGCATCTTTTTATAG
GTAGATAATTATGATATTTATAGATCATTGAAGATGTTGTATTAAAAGTTTTATCTAAAG
ACTGGTAATAAAGGTGGCTCAGTGGATGAGAGAGCCAGGTCTAGAGACAAGCAGTATCCT
GGATTCAAATTTGGTCTCAGACACTTAGCTTACAATTCTGAGCAAGTTACTTAACACCCA
TTGCCTAGACCTCACTGCTCTTCTGCCTTGTAACTACTATGTAATATGGATTCTAAGACA
GAAGGTAAGGATTTATTTTTTAAAAAAAGACTAGTAATACAGATCTTTTTGTTACATACC
TTTAGAATGCCAAGTGTGAATTATAAAACTACATTGACTTGCCAAAGAAAAATATTGTTC
TGAGCTTAGTTGTCTCAAGAATCAACCTTACTAGGTGTACACATTAGCTAATTCTTTTTA
CATACTTAATAGTCTCCATGCTGTTGATCATGGGCCCATGTTATTGATTAATCTTTACTT
TGTTTTTTAAAATATCTTTTCCTTGGATGCTGATTGATTAATCTTATGTACTCATTTTCA
TCTATGTTGAGTTCTGCTCAATGTTCCTTTATTTTTGTTTTACTTTGCCCACACTCTGGG
GAGTAGCTTTTTTAAAGATCAGACATCTCTGTCATATTGCAAATGTCTTATTTTGCCTTT
TTTTTTTCACTACATGTACTATAACTGCCTGGGGAAAGAGTTAGAAAATAAAAGGAAGTG
AAATTTACTTACCAGTGTGGAGTTTGTTCAAAGTAGTTATCTTAAGTGAATTTTAAGAGA
GTAAAATATAATCTAGTGACATGTGATAATCATCACATTTTATTAAGTTATGTTTTTTTT
TCTTTAATATTAAAAAGATTATAGATTTCAGAAAGGAAAATGATTACCATGGCATTGTGA
CAGATATTCTGGATTTGTAATCAGAAGCGTTTGAGACCTGGCTTTGCCAAATTGCTACTT
ATATGATATGTCCATGATCAAGCCAAATCACTTCTGAGCCTGTGATCTCATTTGTAAGAT
AGAGTTGATGATACCTACTTTACGTCGAAAGATTGCTTCTTCTAAGTGAGAACTTGTAAC
CTTTGGCTAAATGACATTGATGAAATATCTAAAGGATGAAAATATACCATATTGATACCC
CCACCCCACCCCCATCCACAGGTCAGCTACTACTGAAATTATTTGTCAACATAGCTGTGC
TACTTCTGTTGCCCATGTATTAAAATAAGTTTGGTTTTCCCTAGGTATTCTCAAAGATGC
TAATATGAAGAAATTTTTGTTGTTTTTACATACAATTGTGATTTTAAATTCTTGGGTATT
CTTTTTATATTTGAACCTAAAGGTACAAGAAGCCAGAGGAACGGAGTCCATTGGTAGCAG
CAATGCAGCACTTCCTACCAGTTCTGAAGGATCGTTTTATTCAGCTTCTTCCTGATCAGT
CTGATCAATCAGTCCTCATTCAGAAACAGATATTCAAGATCTTCTATGCCCTTGTTCAGG
TATTCTGAAATATTGATTTCATTAGTGTGGATGTCCTTCTTAGGAGTCTTGTCCATGATT
TCCTATAGATCTCCCCTAAAGTGATCCTCCTTTGGATACCTTTGATCTTTTAAGTACCTT
GTTCAATAGTTAATATATTACCTTGTACTTTTATTCACAGAAAGATAGTCTGCCATCATA
GGAACCAATTTCCCCAGATTACGTTATTATATGATAGGATAAGTTAGAAGATATAGCTTC
TAAGGGAAAAGGAACAAAAATTGTTTTTGAGAGAGTTTGGTTATGTGTAACAAAGGAAAA
GTTGTAAAGTTTAAAACTTATTTGGAGTTTGAAATGTGACATTATTATTAGTAGGAAGCA
GAAACTACAGAAATCAGTCTTTTGATTGGTAATTGAAAATTTTGGTACAATTTAAAGAAA
AGTTGACTTTTTTTTTTAACCCTTACCTTCTGTCTTGAAGTATTGGCTCCAAGGCAGAAG
GTAAGGGCTAGGCAATGGGGGTCAAATGACTTGCCCAGGGTCACACAGCTAGGAAGTGTC
TGAGGCCAGATTTGAACCTAGGACCTCCCGTCTCTAGGCTTGGCTCTCAATCCACTGAGC
TACCCACCTGCCCCCGAAAAGTTGACTTTTAAAAATTTTAAGAAAAACTTTTAAAAAATA
TTTTTTTCCCCCCCAAGTATACTCTTCCATTGGAGCTGATAAATCAAGCAAATCTGACAG
AATGGATAGAAATTCTAAAGACGGTTGTGAACAGGGATGTGCCACCTGTAAGTATGTGTC
CTTTTAGGCGGGAGTTTGGGACAAGGAGCTATCAACTTGGACTTTTGTTGGGGTTGGAAC
TCTAGCACTCTTTATTATCTAACCAAGAAACATTTCATCAGCTTTCCCTCAAAGTTTTTA
ATCTTTTTCTAGAATGCTTCCATTTTAATGTGTATGAAAGAGCAGTGTTCCCTAGGACAA
TTTTGAACTGGATGCTTTCCGAATTACTGATATCTTTCTGCTATATTGTAGCTGGTTTGA
CCCTGAGATGGTAGTTTTTTTACTTGTTGGTTTTGTGCCAGTTTAAGGCAATTAGAAACA
AAGAACCTGGTCTTAATCAGATGATTCAGAGCAAACAGTCGAGTGTATGAAAAGATAATT
TGATGTGATATCTTTTCCCTTTAAATTGGCAGCATTTGTTTGGAGATTTTAATGTTCTGA
ATCAGGAATTTAGAATATTTTCTTGGTTCTTAACCACACATAAAAATCTTATCCATCCCT
CCACCTCATCAGTTTGTCACCAACCACAAAAGTGACATTTGAGAGAAGCTGTCTTAGAAG
AGCCTGAGGTGTGTTCAATAGTGGGGTAAGTCGTAGAGGAGGTTTTGTGTCACTGACAGG
TGGAGCCAAAGCTCCACTCCTAGCTGTAGTTGTTTCCTGAAATTACAGGGATAATTGGTT
CTAGATTGGGGTGCTGAGCTCTTGTTTACATGAATGAACAAATTTCAACTGTGGCTGTCT
AGCCTGTGGTATTCTGCAGACATTAGTCTCAGAATTAGTTCTTGGAGAATATCATGTTGA
GTTAGTAAAAATCTACTGTTGATAGAATTTATAATGCATAAAGGCAGTTAAAGCTGGCCT
TATCCCTGAGGGATCTTACCAGAGCCATGCTGGTGTTTTTTCCTTCCTCTTTCTTTGCTT
CCATGTGCTTTTATGTGCAGTCTAGGTTAGACTGGAATTGTTACAATCCCTAACACCAAA
TGAGTAAGCCAGAGGTATTGCATTTTTTTGATGGAACACCAAATCTGGTCTTAACCTGTG
TCAGGAGGGCTTTTACCTTATCTACTTCCTTTAAAGAAAGGAGAAGAATTTGTAAATCCC
TTGGCTCTTTGTCAGTTAGGGAACTTGTAGAGCCCACTGACAATAATTCAGAATTTTTTG
CAGTTTATTCTCTAAGAGGATTAGCCAGTATATGTTTTATGTGGGACCTGATTAGGGCTT
CTGAATTCTGAGGCTGCTCTACCTACCATCCTGCTCTTCTCTAGGAAAGGGCCCAGAACA
GTTTGTAAAGTAGCATGCATGTTTCTACAGTAAGTGCTATTTTCCTCTGTTGGTTTGCAT
GCTATGGCAATTTGACTATTTTTTAAAATTAAGTAAGAATTCCAGGTATTATTTATTCTT
TGAATCAGAATTCCTTATGGAATTTTAAATTTTAAACTAATTATTACTAATAGTTGGAGG
GATGGTGTTTCTTCTTAGATTTACTTAAAGACTAATTTTACCTCAAGTGGCTACCACCTT
GTCTGGAAGTCTTATAGTAGAAATCATCCTGATTCACAGAAAATACTGGAAGTTTGCCCA
TATCAAAGGTACTATTTATCACTCCTAGCCTCCTTTGTTTAAGTGAAAGATTTATATATT
GGGGGATATTTTTGGTTTCTGCAGATATAGTTGGAGATAATAGAGGTTTTACTTAATTTT
TAAAAATCATAGTTAATAGAATCTCTTCTAAAAGGAAACCCTTCAAGTTGAAGAGGATGA
TCGGCCAGAATTACCCTGGTGGAAATGTAAGAAGTGGGCCTTACATATCCTGGCAAGGCT
TTTTGAAAGGTAAGTTTCTTTCCTTGTGTCCATCAGTCAATCATTAAAAAATATTCCCTA
CCCAAAACCCCCAGGAGGAACTTTTAAAAAACATAACAAAAGTTTATTGGAGATTCCTAC
TTTCTTTTAGGTATGGAAGCCCTGGCAATGTTTCCAAGGAGTATAATGAATTTGCTGAAG
TCTTCCTAAAAGCATTTGCAGTTGGTGTCCAGCAGGTAAAAAGCCCCTATCTTAGATATT
AATTAGCAAAGAACTGAACTGTTCTGATGCTTCCTCAAGGTATCACGGTTCTCCTGGATT
TGACTACTCTACTAGCTGAACTCTAGCTCTTGGAGTAGTTTTCAAACTGGAAAGACTTTG
TGTTAAGACCTCAGAAACATTATCACCCAAAGACCAATCTAACTATATATAGAGGCTTAA
ATATCAGAAGGTTACTAAGTATCTTTCCATGTCTCCCTGGCATATCACTTCCAGGATCAA
ACACAAAATGCTATCTATTTGAAGTCTTTCATAATACAGCCCCTAACTCTAGCTCCCACT
GACTTACAGTCTCCTTTACACCATGTACCCGACCCTGGCCTCCTGACTGATCTTCACACA
AGACAACCATCTTTTCATTCTGTTCATTTTCACTGGCCATTCCCGTATATAGGATTCTCT
TTCTCCTTATCTTCCTTCACATCCTAGCTAAAATCTCTCCTTTAAGAAGTTTTTTCCCAA
TTTCCTCTGAATGCTAATGCCTTCCCTCTATTGATTCCAATTTACTTTGAATATATTTTG
ATTATACAGAATTGTTTACATTGTTACCTCCCCTATTAGACCATGGGCACTTTGAGAACA
AGAACTAAATCATCCACTAAAGATTTGAAGGAGCTACATTGAAATGAAGTCTAGCAATGT
TTGACAGTAGGAAATTCAGCATTTTTTGTAGATGTTTATATTATACTCCTTTGCTTCTTC
ACTTCCTTTGCTTACTCTCATAATCTGAGTTTTTAACCTTACTATTCTCTATTTCATATA
ATTGCTAAATATTTTCCTTTCTGTTTACTTTTTGGTAAGCAGAGTATTTCTTCTGTTAAC
ATTGTAGTGAACAGATTGAAACTTTACAGTAGAAACTGTTCTCTGTGATAGACCAGATTT
AAATTATATTCATGAATTTAGACTCATCTAATAAAAATGTTTAAAGATAATGTGATTTGA
AGATTTTTTTAAATCATTAAACAACCTATTAATAACTCCATTTTTCCTCCTAACTTCATT
ATTTTTTCAGTGAACAGAAATTATTTTCTCTCCTAGTCTTCCCAAGTGAGAAGAAGAAAA
ACAAGCAAAACAAATTCCTTCTTTGGCCACATTGAAAAAATATATGCTGTCCCCATCAAA
GATGCCCTAATTTATAATACGAAATGTATTTATATTTTAGTGTCAGAATTGGGGGGGATT
ATACTTTTATCGATAAATACTCATCCATGTCTTATCACATTGTTTTTAACCTTTCTCAAT
AGGTATTGCTGAAGGTGCTGTATCAATACAAAGAAAAACAATATATGGCTCCTCGAGTTC
TACAACAGACACTGAACTATATCAATCAAGGAGTGTCTCATGCTGTCACATGGAAGAATC
TAAAACCTCATATACAAGTAATAATTCTCTTTCTAAAGATTGGCAGTTGTTACAGAAATA
TGGGATATGTATGAGTATATACACACAATGTACATATAGAAATAGATATAGAATATATAT
GGAGAAAGAGGAAACTATAAAATGGCCTAAATATAGTTTTATTTGCTCAATAATGCTATC
ATTCAGTTTACCTAATCCTACTGTAATGGTGGAGATGAATAAGATTATAAGAATCTGGTG
CCTCACATAGCTTGACTTGGATTATTAAAGCATAATCTTTATCGTATGAAAGGAAGCTCT
GGATGGTGAAAAAGGCACTGACTCTGGGTTTGAAGAACTTGAATTCAAAGCTTATCTTTG
GTTTGTACTAAAATGACCTGGAGAAAGTCTTTTTATTTCCTTCAGTCTCACTTTTTTTAT
CAGTAAAATCGGAAGGTCGGGCGTCGTGGTCCCCGAGGTCTTTTCCACATTCAGTTATAC
TACCCTGCAACAGTAGCCAGTTTTATTACAATTGACAGGAAAGAACTTGGCAATGAAACC
TCACATCAGATTCCTTTCTCACTGTAATTCACCAATATTTCTACAGCTGGTCAGTTTGCT
TTTAATATAGAAAACTGAGTTGGTGAGTTTGGCTGCAATTGTATATTAAAGCCCTATGGA
ATTCTTGAACTATCCTGTATATTCCTGCTTCCTTCATAAGTTTACAAGTTGAAGAAAAGA
GTGAGCCTAAATTACTCATTGAGCAGGTAGCTAATTTTTGATTTATTGAGACAAATGTAT
TCTTTTTACTAGTATTTACATCTTATGGAGGATTTAAAGACTAGTAGCCATTGAAATCTA
AAATGGTCACTTTTGACTTTTAAATTACAGGGCATTATCCAAGATGTTATTTTTCCATTG
ATGTGCTATACAGATGCTGATGAAGAGCTCTGGCAGGAAGATCCTTATGAATATATACGC
ATGAAGTTTGGTAAGAAATGTGATGTTTTTCAAAAATTGCATCCCAGTGTTAGGTTGGTA
ATGTCAGCATTTTTACCTTTGAGTGTGCTTTATTCCATGGACTTATCTCCTGGGTTCAAG
TTTGTATTAATTGGATATTTTATTTTGAACAAGTACAATTATATATGCAATTGGTCATAA
ATTGTTCCTAGGTGAATATACATGTTCTTAAATTGCAAAATTAGCATTGCATGAGACAGG
TCCTGCTATTCCAACATAGTTCTCCTTTGGCATATGCTATACTATAAGTAGTTGGTTGTT
CCTTTCCATAGAGCTGTATAGAAAGTACAACGTCTATGTTTTGAAGTAGTCCAGAAACTA
TACTGTCAGACATGTGAGAATTCAGAAAACAATCTAGAAACTTGGCCTTAGGGTCAGAGA
AAAGAATCATATTCTTAGAAGAAATAAATTTAAAATGTTCTGGGATGCAGTGACAGTGTA
CTCTATAGAGAGCTTACTTTGAATGGCTTGGCTTTTCTCAGGAAAATAAGTGCCAAGGTT
CTCAGCTGAGAGTTGGGAAGTTGGTGAGAGAGGAGATAATTTGGGATAGGTGAAATTAAA
TGAGTGGGGAATAAAAGGACTGCCTTATTGCAGGAAGGGTCTAATAAAGTTTGTTAAAAG
GAATTTGTAATGTACCCAAAGTACTGTCTTTTCCTGTGTTCTTCAGTTCTGAGTAGAATT
GAAAATGGCAGTTAGTGGGATAACCAGGACTGACTGAGCCACAGGCCAAAGGGGCAAAAA
ATTTGAAAGTAGAAGATAGTTTACGTGTATCATTGTTCAAAACTCATTTCCATATTATTA
GTTTTTGCAATAGTGATCATTTAAAGTCAACATCCCCATTGAACCATGTGATTGAACATA
TGTTTTTCTTTTGCATTTCTACTCCCACAGTTCTTTCTCTGGATGTGGATAGCATTCTTT
TTCATAAGTAAGGGGAATGTTTCTAATTAGGGAAATGGACCATTTATGGGTGATGATGAG
CTCAAGTGTGTGACCATCTTTGTGGGCTGAGGTGAAGAAAAGGAGTAGTTCATGGGATTG
TTTTTGAGAGAGGCTGAGTGAGGAATTAGAAGGTTGTAGAGTTGGATGAAACTTCCATGT
AGTATCTCTGCTCTATATGAATAGATAGGGAAATAGTGAACCAGGTTCTGAACCTCAAAT
CATTTTCCATTAAAGACATTTTTCATAAATTGAGTTAAATGTTGGGGATTATTTAAGATG
TTCTTAACCTTACAATACAATTTGTCTTATAGATGTGTTTGAAGACTTCATTTCCCCCAC
TACTGCTGCCCAGACACTCTTGTTTACAGCCTGTAGTAAGAGAAAAGAGGTAAGTTAAGT
ATTTGTGGCAAAATACTCATTCACAACCATTAATTGATTGCTCTAAAAATGTAGATTATG
CTTTGTTACTGAGATTTTTCTCATATTGTTACTGTCCATTATCCAGTTTAATAATATAAA
TCTTTTAAAAATATTTTGGTAAAAAAATGAATCTTAGTTTTGAGTGCTCAGAACGTTGTC
CTTTCTCTTTAATCCAGGTCTTACAGAAAACAATGGGATTTTGCTATCAGATTCTTACAG
AGCCAAATGCTGATCCTCGGAAAAAAGATGGTGCTCTGCATATGATTGGTTCTTTGGCTG
AAATCCTACTAAAGGTATAGAGAAGTGGGGGGTGAAGGGCAGGTCTCTTCTTTGTAGTCT
TGCTGAATAATGTCCTGAACAACTCAGCTGGTTTGAGTTAATTCATGAGTATATGTAAAT
GCCATTGGCATTAAGGAAAATCATAGCTTTGTGGGCTGACATGCCCTGCTTTTAATTCTA
ACATGTAATAGCTGTGAGCTCACAAAGCAAATATAAATTCCAGAGTGTACAAATTTTTTT
TCCTTTATAATTCATTAAATTATAAATTTTTGTGTAGTTAAAATGTTTGTTTTTTTTTAA
CTGCCACCTAATTTGGGGAAACACATAGTAGATCTTTATTGTTTGTTGGACACATTTTAC
ATTATTCTAATGTAGTATTATATGTGGAGTGAGAGGCATCATGAAAGGGGGAAAAACTGG
CCTTAGAATAAGAAAGACATGGGTTCAAAGTCATATTCTTGACACATGTAAAAATGGATA
ATTAATGATGTATAGAACTATTTGGATTTTTCTGTTGAACAGATTTCTTAAATGGCCGCA
GCCTTTGTGTGCATAGCTTCCATCTGTGTCTGGTAGCATTGTCTGTTTGTGTTTTGCATT
CAGATGCTGCTGCCCACACATAATCCTGCAGCCAGAAAGAAAAATGGGATCATAGTACTG
GCCTAGTGACGTCTTTTTGGACAAATCTAACACTGGTCAGCCTCCGAACTCCCAGACATA
TAATCCCCAATCCCCAGAAGTCCTTGGTATTTCCCAGAATTCCCTATAATCTCACCTGGC
TCTCAGCGCTCCATGGGCTCATTCCTTCAATAACCTTCATTAATATGGTCTACACCTTGA
TCTCTCATCACAGATGAAATCATAGGCCTTGACCAAGAAAACTGTCAAGTTGAATACTTT
GTTTTACTGTTTAACTTGCATTAATATGCACAGAGATACACACATAAATAAATGTAAAGT
ATAGTTAGCTTTCAGAATGTGGTTGCAGGTTACATTGTCATGAGGTTTTAGGATTGCGTG
TAGTCTTCTAAATGATATGTTAATCCTGAGGGGGGGTTAGATTTTAGTACCAAATCCAGT
AGATGATTAGGAAAGCCAGTATAGGCTTTTTTTTGTCAACTATGATAGACAATTTTAGCT
TTAGCCTTAAATTGTTGGGGTTTGTTTGGGTTTTTTTGCCTGTGCTCCTCCCCTCAAACA
ATTTTAATAAAAAAGTAATTACCTCAGCAAAAAATAATTTTCCTTATATGTCAACAGAAA
AAGATCTACAAGGATCAGATGGAGTACATGTTGCAAAATCATGTATTCCCTCTCTTCAGC
AGTGACCTAGGCTACATGAGAGCAAGGGTGAGCATATTTGGAAACTTTCTTTTTTTTCTT
CTCTTTACTTTTGATAATTAATGATGTATAGAACTATTTGGATTTTTCTGTTGAACAGAT
TTCTTAAATGGCCGCAGCCTTTGTGTGCATAGCTTCCATCTGTGTCTGGTAGCATTGTCT
GTTTGTGTTTTGCATTCAGATGCTGCTGCCCACACATAATCCTGCAGCCAGAAAGAAAAA
TGGGATCATAGTACTGGCCTAGTGACGTCTTTTTGGACAAATCTACCACTGGTCAGCCTC
CGAACTCCCAGACATATAAAAGTTGCTGTTAATAACGCCCAGTTATGATATGGTTGTTTT
TTTACCCCCATCTTATTTATTTATAGAAACGCATCGTTCTATATGGTTTAATCGAGGCAT
TTTTTTGCTTCTTAAACACATCTTTTAAAGGCTTGCTGGGTGCTTCATTATTTCTGTGAA
GTGAAGTTTAAAAGTGACCAGAACCTGCAGACAGCCTTGGAACTGACAAGACGATGTCTG
ATTGATGATAGGGAGATGCCCGTGAAAGTAGAAGCTGCTATTGCCCTTCAAGTTCTGATT
AGCAATCAGGAGAAAGGTAACATTATCAAGTAAAACTATGTAAATTTGGATTTCTGCATT
AAATTATTTTTTACAGATGCCTTTAACTGTGTATTAGTTGCTTTGGTTTATCCCCTTCAT
TTCCAACTATATCCCTTCCTTTCCTCCCCTCCTAACCTCACCAGTGGAACATGCCTTTAT
ACTATCACAGAATTAAAAAGAGAGTTTTTAAAATTCTGTGAAACTAACCAGCACATGCAC
TGACATGACAGTCTTAGAAATGTTGCACATTCATAGTCCTCCCAGGGAAGGGGGCTCATC
TCTTTCTTAGGGACAAATTGGATCATAATTACACATCATTATTTCAGGGCTTTTTGTAGT
CATTCTTTCCATTTTACATCTTGTAGTAACCTTTGTGTGTCTGTTTTCCACATTCTGTCA
CTTTATTCTCAGCTCTTTCAATTCAGGTACATCTTCCAATAATTTTCCACACCCGCATTT
ATATGAAATGATACGTAGAGATAGGATTGCTTAAATGGAAGCCTTTTGATGCCTTTTTTA
GACATTCTAAAGCTATAGCTCTGGGTAGTGGGGCACAGAAAGCACAGTTTTCATGTCACA
GGGCTGTCATTACCCTTTGAAGGTACCTTGCAGTAGTAGAAAGGTAAGAGCCACTGACTT
TTTAGCTAGAAGGTTGATTTTTGGTGTCCCACTTCTGAGCTGGGCAACCACATTTTCCAC
ATTCAAAGACAAGATTTAGATACTTTCACTGCAACTCCTCCAGAGGCCTTTTCTGAAGGT
CCAGTGAGATACAATAGTCAGAAAATGATATAGAAATAATTCAGGCTATTTTTTATCTTG
CAGCTAAGGAATATATTACACCATTTATTAGGCCTGTAATGCAGGCTCTTCTTCATATTA
TAAGAGAAACAGAAAATGATGATCTAACCAATGTGATTCAGAAAATGATTTGCGAGTACA
GTGAAGAGGTTACACCCATTGCTGTTGAAATGACACAGCATTTGGTAAGTGTTGCAATCT
TACAGGTTATGTGCTGGAAAATTGGTCCAGTTTTGTTGAAGATGGGCTCAACTCAGTGAT
TAAGTACTTTTCCATTTGCAAACTCTGATTTTATTGTACGTAGTGGTTACAAATAGATGG
ACATCTAAGTATAGGTAATAGATATGAACTGCTATATGGTTTCCCAACCATTTGTTGGCA
GGAAATTAGTGGCCTACCTAAAAGTTGGGCATACAATATTTTAAAACTTAACACACCAAA
ACCCTTCACTCCTTTCAACTTCCTCTTCCTCATGTTCCTCCCAATGGAATTGTGCTTCTA
GAGTAGTGGAATTCTGATAAAAGGATTTGCTTAGTAGAATTTAGAAATTTGCCAGTGAAT
GTATCTTGCTATTTAATGTTGTTTGAATTAGGAAATATTGATGTACCCATTAATTTCTAA
ATCTGCTATATCCACAATACATGTGCTTGATTTTAAAACTAAAGACAAAAGATACTTTGA
TCATGATACCGAAACATCAATTCCTCAAATATTCTAGGCTTTAGTAAGCTGTTATTTGGT
ATCAGGAGGGGTATCTTATATTTCCTAAAAAGGAAGTAACTATGAATCTCTTATTAGTTG
TGATAGTTCAGTTAATGACCAACTTTTAGTGATGTTCTTTGAAAATTAATTTTTCAAACT
AAGGCTGATTTCTAAATGGTATTTTTTTGTTTTGATTGCCTTCCATAATTTGAAGCTATT
AAATCAATATGGACAACTATTTGAGAACAGTAACACTTTGTGATTAAGTTACTAGGATTA
CAAATCAGACATTCTACTTTTCCAGGCCATGACATTTAATCAAGTCATCCAGACTGGGCC
AGATGAAGAAGGAAGTGATGATAAAGCAGTAACAGCTATGGGAATCTTAAATACAATTGA
TACACTGCTTAGTGTAGTGGAGGATCATAAGGAGGTAAGAAGACTATTGCTCCTCAGTAC
TTCTCCAAAGGAATCCATGCATGTCTTTCATGGTTTGGGGGAGGACGGGAATATGGGCAA
TTCTTTTCACTTCTTGGATCCTTTACAAGTTGCCCCATTTTTCCTTTTGGGGAATTTAGT
TTATTTGAACCAGCCTCCTTGAAATTTATCAAGGGCAGTGTCTTCTTACATGTTTATCTT
TAACAAGTCTGTACCAGCTTTTAGACAAGGAATTAGTGAGAAAAAAGTTTAGAAGGAAAA
TAAGCCAAATAATATTCAACAGGCATCTGGATCCCCAGAATGTTAAACATGAGTTGTTGG
CTTGTGACCATGTAAGTTGGCATTTAGGTGCTTTTTTTTTGAGCTGTCAGATGTCCTTAA
TGTGAACTATACCTGGTGAAATGATGTCTTTGATATCTCACAAACTTTAGCCTTTACATT
CATTTTCTTTACTTTCTCAATGTCTGTTAAGATTTGAATTTTAGATGGTGAAGTGATAAT
ATTGAGTTGGCCTTTGCAAGTATTTTTTTTTTAAACATTGTTTTATTTGGTCATTTCCAA
ACATTATTCATTGGAAACAAAGATCATTTTCTTTTCTTCCCCCCACCCCCCTCCCACCAC
CTCTCCCATAGCCCTCGTGCCATTCCATTGAGTATCACATGTGTTCTTGATTCGAACCCA
TTTCCATGTTGTTGGTATTTCCACTAGAGTGTTCATTTAGAGTCTCTCCTCAGTCATATC
CCCTCCACTCCTGTAGTTAAGCAGTTGCTTTTCATCAGTGTTTTTACACCCACAGTTTAT
CCTCTGCTTGTGGATAGTGTTTTTTAGATCCCTGCAGATTGTTCAGGGACATTGCATTGA
CAACAATGGAGAAGTCAATTACCTTCGATTGTACCACAGTGTATCAGTCTGTGTACAATG
TTTTCCTGGTTCTGCTCCTCTCACTCTGCATCACTTCCTGGAGGTTGTTCCAGTCTCCAT
GGAATTCCTCCATCTTATTATTCCTTTTAGCACAATAGTATTCCATCACCAACATATACC
ACAATTTGTTCAGCAATTCCCCAATTGATGGGCATCCCCATTTTTTCCTTATTATTTGGG
GTACAAACCCAGTAGTGCTATGGCTGGATCAAAGGGCAGACAGTCTTTTATCGCCCTTTG
GGCATAGTTCCAAATTGTCCTCCAGAATGGTTGGATCAATTGACAACTCCACCAGCAATG
CATTAATGTTCCAACTTTGTCACACCCCCTCCAGCATTCATTACTTTCCATAGCTGTCAT
GTTAGCCAATCTGCTAGGTGTGAGGTAATGCCTCAGATTTGTTTTGATTTGCATCTCTCT
GATTATAAGAGATGTAGAACACTTTTTCATGTGCTTATTAATAGTTTTGATTTCTTTGGC
TGAGAACTGCCTATTCATGTCCCTTGCCCATTTATCAATTGGAGAATGGCTTGATTTTTT
TATACAATTGATTTAGCTCTTTGTAAATTTGAGTAATTAAACCTTTGTCAGAGGTTTTTA
TGAAGATGATTTCCCAATTTGTGCTTCCCTTCTGATTTTAGTCTTGCTGAGATCATTTAC
CCCAAGTCTATTCCACTGATCCTCCTTTCTGTCTCTTAGCCAGTACCAAATTGTTTTGAT
AACCACTGTTTTATAGTATAGTTTGAGATCTGGGACTGTAAATCCTCCTTCCTTTGCATT
TTTTTTCATGATTTCCCTGGATATCCTTGATCTTTTGTTCTTCCAAATGAACTTAGTTAT
GATTTTTTCTAATTCAGTAAAGGAAGTTTTTGGTAGTTCAATGGGTATGGCACTAAATAA
GTAAATTAATTTGGGTAGGATGGTCATTTTATTATGTTAGCTTGTCCCACCCATGAGCAA
TCAATGTTTTTCCAATTGTTTAGATCTAGTTTTAACTGTGTGGAAAATGTTTTGTAATTG
TGTTCATATAGTTCCTGTGTTTGTCTCGGCAGATAGATTCCCAAGTATTTTATATTGTCT
AGGGTGATTTTAAATGGAATTTCTTTTTCTAATTCTTGCTGAAGAAATGGGTTAGAGATA
TATAGAAATGCGGATTTATTTTGAATCCTGCAACTTTGCTAAAGTTGTTGATTATTTCAA
GTAACTTTTTGGTTGATTCTGCAAGTATTTTAAAATACTTTTCCCTAATTACTTTGTGTT
TATGTTACGCATTTAAAAAGTTGTGGTAGTAATCCTCATTATTTTATTCTCTCGTATGTC
ATAATTCAATCCCTAGGTGCAAAAATATGTTTATTGAGTAAGTTCATTGTCTTCTGATGT
TGTAATTTCATATATCTGTTCTCTTTCAGATAACACAGCAGCTAGAGGGGATCTGTTTGC
AAGTAATTGGTACTGTTTTACAACAGCATGTTTTAGGTGTGTATGCCTTTGTGAGGAATA
GAAATCTGAAATCAAGAGTTCCAGTTTTACATGAATAAGGAGTAACTCCTTCACAATTCA
TTCTGTTTCAGAGTTCTATGAGGAAATCTTTTCCTTAGCTCACAGTTTGACCTGTCAACA
AGTCTCTCCACAGATGTGGCAGCTTTTGCCTCTTGTATTTGAAGTCTTTCAGCAGGATGG
ATTTGATTACTTTACAGGTAAGAAGTCAACTTTGAAATACTGACTTTCTTATTCCTTTGT
GATAAGTTTTTTTGATCCCCAAATAGTTTTCTTAGGAAAAATAGAAAAACAAAATTTCTT
TGCCTGTGCATGCCTTGCTTCCAGTATTCAAAATTTTAGCCTAACAGAATAGTTAATTAG
GAGCAGAGTAATTTAGTAAAAAAGGACCAAGCCACAGTAGCCCTGGGTTCAGGTAGTACA
TATTATTGTACAGGATTATTCATGGAATGTTCCATTAACACGAGAAGATTTTGTTAACAA
TGAATTCCTCCAAGCTAGTCCTATTCTTGTTTTAGTAGGCCTGAAGATTAAACCTTTGTC
ACCATGAAACACATCACATGTATAATTGTTTTTTTATCTAACACAGATATGATGCCTCTT
CTTCATAATTATGTAACTGTGGACACAGATACTCTTTTATCAGATACCAAATATCTTGAA
ATGATTTACAGTATGTGCAAAAAGGTAGGTAACCCTAACTTAATTTAAACTTATTTAAAT
TTTAAAATTACCATGAATTGATAGTCTATACCGTTTATATAGAATCTACAAAATTATGTT
TCTACTCTGGTCATCAGGTAGTATTCTATGTGTTCTCATCTTTTGCTCTATTGCTCATGT
GTGGATAAAGCTTCCAGGCCTTTAACTTTCTATTCCTTTAAACCCTGAGAGTTAAAAGAT
ATATGGGACAAGGAGTAGGAACATAATATGTTCCTGATAAGTGATAGGGAAAAGCACTGG
CTTCCTTGTTTATTTTGAGATTCCTGAAAACATTGAACCCCAGGTTCTAAAGGAGAATAA
TAATAATAAAATTTGAGTACCACATCAGGATTGTTTAGGGAGATGGCTTTAAGTTTTTAA
AGGAGCTTAGTAAATCTTATAAGATATTGAGAAGTAATATCCTTTCATAGGAAGACCAAC
AAACACTAGTTGAGTTCTTAAATACTTCAAGCAGATTGTGCATTATCTGTTTGTAAGACA
TAGGTGCTACATAGCATCATCTTGACTTTTCATGTGTACAATGAGCAGATGGGATTAGAT
GACATTTGCTAACTCTTGATTTATTGGGCACCAGGTGCTGTGCAAAAATCTCATAAGACA
TTTCCCTGCTTCCATTTTAGTAGTTTATAGTGTAGTGAAGAACATTGTTAACTGACACAA
ATATCTTTGGTATATTATAAATAGTCTCTGATAGCTAATTAGTACCAGCTTTTCCAAGAA
TCTGATTGCTTCTCATCCTCAGTTCCCTTTGCAAGCTCAGGGAAAGAACAGCTATGTCTT
GTACTTTGATAGGTCTTGACAGGAGTAGCAGGAGAAGATGCAGAATGTCATGCAGCCAAG
TTACTGGAAGTGATCATTCTACAATGCAAAGGACGTGGCATCGATCAGGTCAGTAGCCTT
TTACCAATTGTGTGGATTTGTGAGTAAATCAAGGAGGAAATACCAAACATATTTTAAGTT
TCGAAAAATTCTATGTAGTCATTTTCCATCCTTTGAAATATCCAATTGAATATTATATCT
TGAGTCCCAAAAAAACTGTCTTCCCCACCATCATTTTTCCTTTTTTGTATTGTAACAGCC
CAATACATCTCTGATTTAATAGTGACTTTGAAAGTGGAAACTATTGGAGAGGATGTGGGG
GTTTCCCACGTAAAAACTTTTTCAAGAGATGTCCTTATTAAACATTGTCTTTAATATTGA
TATACTTCTAACATTCATTGGGAACCGGTATGGGTGTGATCACTTTCAGAGTTAAATTGT
CCAGTACAGGTTTCATGCAGGAAGCATACCATAGTAATACTATTTAAAACTTTTGGTGAT
GACAATATTTTGTGGGATGGGTTTGGCTATGGTGCTTGTTGGCAGATAAATCAGGAAGGA
GCTGAGTAGAGTATACTACTACTATTGCTGGCATTGTGAAATGTGTTGGTTTTTAATGTT
TTCCAGTGTATTCCCTTGTTTGTGGAAGCTGCATTAGAAAGACTTACCAGAGAGGTCAAA
ACAAGTGAACTGCGAACAATGTGTCTTCAGGTGGCCATTGCGGCTCTCTATTACAACCCT
CATCTACTCCTCAACACCTTAGAAAACCTTCGATTCCCCAACAATGTTGAACCTGTCACA
AATCACTTTATTACACAGTGGCTTAATGATGTTGATTGTTTCTTGGGGTGAGTGACTTAA
GTAGGAGAATTCCATCCTATCTAAACTTTGTGAAAACCTTTTCCCCACTAAACTTCTCTT
TTTGTTTTTAGGCTTCATGATAGAAAGATGTGTGTTCTGGGCTTGTGTGCTCTTATTGAC
TTGGAACAAATACCGCAAGTTTTAAATCAGGTTTCAGGACAGATTCTTCCAGCTTTTATC
CTTTTATTTAATGGGTTAAAAAGAGCATATGCTTGTCATGCAGAGCATGAAAATGATAGT
GATGAAGATGATGAAGCTGATGATGATGAAGAAACAGGTAAGGGGGTTGAAATGTAAAGT
CCCTGATTTGTACCATGTTTTCCCCATAGCGAGGAAATCGAGTTGGAAATCAGAAAAGAG
CATTAAATGTATTAGAAAGGACATTGGCTGTTAAAGGTCAGGAGCCCAACTGATAACCTT
TTGGGAGAGGTCCTCTGATCCCCATCTCGTTGATCTAGATGTTCTCCATGGTCACTTCCA
GGCTTAAGGGTTTGTGGTTCATCACTCTAATGGCAAGAATTGAGGCTTGGACAAATACCT
TTTTATTTAGTAAATGACCATGTTGGTTTAAATGTGAGGTTTAGGAGAAAAATGGAAGGT
ACAGGCTCTTTAGAGCCAAGCCTGTGGTCTCTCAAGGTTCAGGGTCCTCCATCTGATGTG
GCGGTCAATCGAATAAGTGGTGAGAGACACTGTATGCTCAATCCTGTGTTCAGGCATCAC
ACAGAGTTCTGCCATAGCACAAGAGTTGGTTTATTTTATAGCTTTAATGAGTACATGCTT
TTCTGACACAAATCATTTTTCAACATTCATGTTTCCATAGAACCTAACAATAGATACGGA
GTATAAAGAGATAGTCAATGAAACAGTGATACTAAAACAGAAATAGATGAATGACATAAA
CAGGGTGATCTGGAGGCTAGTTCCCCCCAACTTATGGGATGACAAGCTTGGAGAGTCATT
GTTGCTTTTGATCAGTTTTCACAATCAATCACAATTACTTAGGAGATGGGTAACATAACA
TTTCATAGCTAGGGACAGGGTTAGAGGGTAATTTAAGACAGACCATAATCAGGAATTCCC
TTAATTTCCAAGTTGCATTTTTCTTGTGTTTGATTCAAGCACCTGTCAAAGTTGCCTGGT
CATGGTAAACATAACAAATCAGCAAAGTGTGTCTGTAACTTGTTTTTCAGAGGAATGATT
TTATTTATCTGTCATGCTTGACTCACAATGGATGTGGGGCCTCTGAATGTACCTCTGCTA
AGAGAAAGAAAGGAGGGGTAGTGGGTAGTGATCTTTGGGTTTTAATTCTGTAAATTAATC
TTTTGGGGGTACTATTCTAAAGGGGTTAAAGTGGGATATATGTGGGAATATGTGTGTTAA
CCCTCTTAAGTATTTGCTCTTATGTTATTTCTCCTGAACTGGGAAGAGAACAATAATCAT
AACAATTCCATTAGTAAGGGAAGTTAGAGAGAGAAGTATAATAGAGGATGTTCCATGGGT
GCCTTATTTTCTGGGGGCTGCTTTGCAGTCTCCATTTCCCCAGACTGCGACTATCAGACA
TGGGGGGGTATGATAGCTCTCCACCTACAGTAAATTCTTATCTGGCATAGCTAGAGACTT
GGGCTTTGGCTATTTTCTCACTCATCAGATAATCTGGTTAGCCGAAACTTATTCACATGC
ATGGGAAGGAATCTTGGGTAGTAAGAAGGCACTTGTAAGTTACCCATTACCATAGGATCA
TCATGGCACTCCTGTAGGGCTTGGCCTAAATCAGGTGCACTTTTCATCAATCAACCCTCT
TCCATGCTGGGATTCCAGACTACCTGCCTGCAAAGGGAAATCAAACTGTGGGGACTATTT
TTCACTCATTAGATCTAGCATAAATTTGCTGGGAGTAGATACATAGTTGACAAGAAAAGA
TTTTGGAATGGGGGGGGGGGTTTGGAATCTTTTAGTGATACCCTGGGAGAGGGGCAGTAG
GGACTTAAGGTTTAACCTAGACGGAAGTTCCTTTGAGTCATTTTTTAATGAAATACCTTC
TTGCCTATAGAACTATCAGTCTTTGTCAGGTATATAAACCCAAATTTTTTTTTTTGACAC
TTTGGATCTGTTACAGTGTTAATGAGCATGTTATGTTACCTTTTGTTCTCTCCATCCCTT
GGGAAATTATAGGAATTTCCAAAGTATAACACCGAGTTGGGTGGCAATTTGGTGGGGTGA
AAAAAGGTCATGGAGAAGTCATCTTAAGGGACATTTTTGTAGTAAATAGGGAAATTTGTG
GCTTGGTAATAAAAATTTACTGCAGCCTAATTCTGCTTTCCCTGTACCCATGCTTCCTGA
ATGCTTGTCATTAATTTTTTTTTCATTTTTATTAATACTGTTTATCTAAGCATCATGAAG
GAAAAACGCAGTATTTTAATTGAAAACTTAGATTGTCTTAGTATGTGTGGGACCTTCCTT
TCCAACCTTTTAAAAAACGCAAAATGAAGGAAGAATCAACATGTTGTAATTTAAAAGTAT
CTTCCCAAGTTGAAAAACATTCTTGTTCTTTGACAGAAGAGCTTGGAAGTGATGAAGATG
ATATTGATGAAGATGGGCAAGAATATTTAGAGATTCTGGCTAAGCAGGCAGGAGAAGATG
GAGATGATGAAGAGTGGGAAGAAGATGATGCAGAAGAAACTGCCTTGGAAGGCTATTCCA
CAATCATTGATGATGAAGAGAACCCTGTTGACGAGTATCAGATATTTAAAGCTATATTTC
AGAGTAAGTGATTCCAATGATTCAAATGGTCACTTACTAGATCTTACTATAGCAATTTCT
GTACTCGGGTCACTTACTATATATATTTCTATACTATTTATTAACATGTAATTTCTTGAT
CTAACTGGACATTTATGAATTGCTTTTAAATTCCAATAAATCTTCTTACTTAAATTGGCT
AATTTAATTAATTTATAGGGGCCTTGCCTTCCCATCTTGGAAGTCAATTCCTGTGTATGG
CCTCAAAGCCAGAAGAGTGGTAAGGGCTAGGCAATGGGGGTCAAGTGACTTGCCCAGGGT
CACACAGCTGGGAAGTGTCTGAGGCCAGATATGAACCCAGGATCTCCTGTCTCTAGGCCT
GGCTCTCAATCCACTGAGATACCTAGCTGCCCCCTAAATTTTAATTTAAAAATGTTAACA
GAGTGCAACAAATATTTAATGCCTGGAAAAATTTGGGATCAAAAAATAGTTTACTAGTTG
TATGAAAGTATAATGAGCTGCTTTAGTAAGATGTAATATCTTTACTGTATTTGAGGAGGT
TGAAAATCATTACTGCCAAATTAGCTGCTAGAGCAGCTAAATCATAACTGTCACTGAAAG
ATATATCACCTCATTCTAGAAACAATACCAGTTTTGCTGAATGGTTAGAAAATACATGCA
AAAAATAGTTCTATGACTATAGGGAACAGACTTGGCATGTCTGTTTTTTCTTCTCTCAAA
TGGTAATTGATATGTTACATTGTAGGTGACAATTGCATATAGCTCTCGGTGCTATAAAGG
TTTTTGTTTTAAGTATTAGTTCATATTATAAATTAAAGTTTTATTTAAATACTATTCTGG
GGCAGGAATCAGAGGTTATAGTGGGGCAAAATAAGTGTTTACTATACATAAAGCACTCAA
ACTATAAAAGTGGTCTAAAAGATCATATCTTCTTTACTATAGTATTTCCTATAGAACAAG
AATGCTTCAGAAAATATGACTCCAATCTCAATATGTCTTGAAACCTCATTTAGTGTGATT
GTGGGACTAATTTTTTTCTTTCTTTCTTCCTGTTTTTTAAAAAAATAGCTATTCAGAGTC
GAAATCCTGTGTGGTACCAGGCTCTGACTCATGGTCTTAATGAAGAACAAAGAAAACAGT
TACAAGATATAGCAACTCTGGCAGATCAGAGACGAGCAGCCCATGGTACTTCCATATGTT
TTATTCATTTTTAAGTGCCCTAGATAGGTTTGCATATTTTTGAAGTTCAGTAATACATTG
TCTCTTGCAGATCTCAGTGGTTCATGTGATTTATCATTATTTAATAGAATAGAATAGAAT
GTAAAATCATTCCATTACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCCCTGTAGCTAGTAGTTATTCGTC
CTGTTCTTTTTCCATTGGCTCCCATGAACCTCCTGGTGTTCTCTTAGATAGGTAAAAACT
TACTGAAAGGCTCTCCCAAGATAAGTATGTATGTCCAAGGTCCTTGAAGTCAACTTTTCT
TTTTTTAAAACATTATTTTATTTGGTCATTTCCAAACATTATTCATTGGAAACAATAATC
ATTTTCTTTTCCTCCCCGCCCCCCTCTCCCAACACCTTTCCCATAGCCCACATGCGATTC
CATTGGGTTACACATGTGTTCTTGATTCGAACCCATTTCCATGTTGTTGGTATTTCCACT
AGAGTGTTCATTTAGAGTCTCTCCTCAGTCATTTCCCCTCAACCCCTGTAGTCAAGCAGT
TGCTTTTCATCGGTATTTTTACTCCCACAGTTTATCCTCTGCTTGTGGATAGTGTTTTTT
AGATCCCTGCAGATTGTTCAGAGACATTGCATTGACCCTAATGGAGAAGTCCATCACCTT
CGATTGTACCACAGTGTATCAGTCTGTGTACAATATTTTCCTGGTTCTGCTCCTCTCACT
CTGCATCACTTCCTGGAGGTTGTTCCAGTCTCCATGGAATTCCTCCACCTTATTATTCCT
TTTAGCACAATAGTATTCCATCACCAACATATACCACAATTTGTTTAGCCATTCCCCAAT
TGAGGGGCATCCCCTCATTTTCCAATTTTTGGCCACCACAAAGAGTGCAGCTATGAATAT
TCTTGAACAAATCTTTTTCCTTATTATCTCTTTCGGAAACAAACCCAGCAGTGGCAGGAT
CAAAGGGTAGATATTCTTTTATCGCCCTTTGGGCATAGTTCCAAATTGCCCTCCAGAATG
GTTGGATCAATTCACAACCCCACCAGCAATGAATTAGTGTCCCTACTTTGCCGCATGAAG
TCAACTTTTCTTGCTCTACCTCTTGCATTCTCAGTATAGATGTTCTCTGAGGTTCTGATT
TAGATTTTTTTTCTTCTTTATCCCATTTTCCCTTTAAATATTTCTTTTGCTTCTATAGAT
TCAAATAATGGGTGATAAATCTCATATCTGTGTTTCCCTATCCTGTCTCTCTTATTCTCT
AGTAATTATCTCCTCCTGGATGGGAAACGCAGAATTCCCAAAATGTAATTTTCTTTCTCT
GTAAATTCCTGTCTCCTAAGTTTTAGCCATGTACATTGAGGACATGCCCATCCTATCATT
CACTGAGTTTTTTCATCTTGGAGTCATTACTCCCAATATCTAGGATTTTATTGCTTCTTT
ATCTACATCTTGTTTCCTTTCTACTCACACAGCCACCATCCTAGGTTCTTGCTCAGTCTA
TTGTAAAAGTTTCACTGTTGTTTCTCCCACTTTTCCTTCTTTTAATTTATTTCCACTTGT
AAAAATTTTTTATTGATTTTTGTTGTTGTTGCTATTATTTTTCAACAGTTCTTTTCTATT
TATCTACAAAGGCACTTTTCCTAATACACAGATCTTATCCTAGAATTTTTTTTTTAATAA
TTTATTTAGTCAATTTAGAACATTATTCCTTGGTTACAAGAATCATATTATATCCCTCCC
TCCCCTTCCCCCACCCTTTCCATAGCCAACATCCAATTTCACTGGGTAGTACATGTATCC
TTGATCAAAACCTATTTCCATGTTGTTGGTGTTTGCATTACTCATCCTAGAATTCTTTGC
TCAAAACCTTTGAATAATGTACTGCTTGCTGCCTGCAGATAAAATTCATTAGCCTGAGAT
ATAAGGCCCTCCAGTTTTGCTCCCTTTTACTTTTCTCAACTTACTTCACTTTATTCTTGT
TCATGTTTTAATTTCCAGCCATTCTGAAATATCAGCTGTTTCCTGAACTCGGCACTCTTG
CCTCATCTCTTTCAGAACTCTTTATCTTCCTTCACAACTGCTCAACTGCCACCACCTTTG
AATTCTTCTGTTAACCCCATTCATTCTAGTACTATATCTTTCATTTTCCCTCTCCTAAAT
TTGTCAACAGATTCTCTTCTTTCTTGAGACTAGGAACTGTTCCATTTCTGTCTATCCTCA
GTGGCTTGCATGTCACACTAGGTGAAGCAAACATTTGCACAGTTGAGTTGAACTGGTTGA
TAATGTACTTTTTAGGCTCAATATGATTAAGACAATGGTTAAATGACAGTCCTGATAGGA
CTCAGAATCGGGAAGGCAGTTTCCTGTTAACCCGTAGCAACCTGTGTACTTCTTGAGGCC
AGTCTACACTGGGAAAGGTTTTCCCCACACCAGTGACATCACTGGGCAGGGCCAGAAATC
AGGCATTAGGTGGTAGGAACATATTAGCAAACCTCTAGAAGAGAATTGGAAAAGGGAAGG
ATTCTGGCCCATCTTAAAAGCAAAGGTACAAACTGTTAGTGCTGATCTTACTGATATTGT
ACTCTCAGTGTTTTGATAGTTGAGGATCAAGAGGATTCTGAGACCCGGAGAGGTCATACA
ATGCTAAATATCTCCATTTTTGTCAGATTTTATAATCTGCCCCCCAAATCCCATAATTTA
CTTTACACTTCCTCACCATGGCATGCATGTGCATGTATGTACTATATTTTCCTTTTCACA
CCAGTTTAGATTTAATGGTTCAGACATTGCAGTCCACAAAAGACCGCCTGAAAGTTGTAA
GCTCTAATAACAAAGGAGAACCCCAAAATTCAAAGTAGGCTCACCAACCTGGTGAGGTAT
AGAGAATTTAGAACCATTTCTTCATCCTTTTGTAGATGAGGCAATTGAGTCCTAGACAGT
AGAAGTGCCTTCTTCAGGGTTATACAGGCTTCAAGTAAGCATAGATACATGCCTGGATTC
TGTGACTCCAGGGCCAAGATCACTTATGCCATAGAGGCTCAGACTTCTCTGAAATAGCAG
TAGTATGGTATGTGTGAACTAAGAGCTTGGCTTTGAAAAGGGCTCTTTACCCGAGAAGTC
TGTGGTTGAAGTGAATATTCATACTGGGTGACTTAAGAGAATTTTACTTTTTTGCCTCTT
CATATAATGAATGCTTTCTGTCAAAAATTGAACTAAAATAAATGTTTTTTCTTCCAGAAT
CCAAAATGATTGAGAAACATGGAGGATACAAATTCAATGCTCCAGTTGTGCCAAGTTCAT
TCAATTTTGGAGGTCCAGCCCCTGGGATGAATTGAATGATCCTTTTATTTCCTGCTACCG
TGTGATTGTAGTAAAGAGCTTGTGTTCCTCCCAGTAGTGGTTCCAGAACTGGTTTGTGTT
CTCTACAGCTCACTCTAAACTAATTGATCAATAGATTGGACAGAAAACCCAGGAAGTGGG
ACCTGATCATGCAACCTGGCACTGGAAAGTAAACCAGAGGGGTATTGGTTGGGGTGGGGG
GAGGGAAAGGTGGTTTTTGTTTTGTTTGGGGGTGGGAGGGTTGTTTTCAATTTTTTTGGA
AGAAAAGAAGAACCTGACTTTGGAGCTTCAAATGACACACTGTGGAGATCTGCAAACAAA
TGAGGGAATGTCATAAGGCAGCTTTTCTTTTTCTGAGGAAAAAATAGGCATGGGCTGCAG
GACTATTTAAAATGTCTCATTTACAGTACAAGCTCAAAGGTAGATGTAATTTTTACACCT
ATGAATATTTTGCCCAGTTTCCTTCCCTTTCCCATCCCTTCCCCATTGGGTCTTTATTCT
TTTAATGTAAATAAGGTAATCTGATAGCCTTACTTAATCTTCATCATTTCCATTTATCAA
AGATTGTTCCTATATAGATTATTGGACACTTATTGTAGCACTACATAACTGATACAAATC
TGTAAATGAATTAGCACTTTCATATTGAAACAAGCCTGCTAGCCTATGTATAAAATAGCA
AAATGTTTGCTGTTTATAAAAAGAAGGGATGTAATGGGGAGGGGGGCTGGGGTAATTTCA
AGTTATTAATTTAAAAATGAACTAGCAGTTTTGTACCTGGTGACTGTGGTGCACTCACCT
CTGACAGTGACTTGAATTCGGTATGTAAAAAGGGGTTAGTGATACTTCATTGCTGCTAAA
AAATGGCAACACCCTCTGTGTCCTTTGTTTTTTCTTAAGGCTCTCAATGTACAAGTGGAA
ATTTGGATATAAGACCTTAATGTAAAAATGAGAAAGGTTATCTTCTCTGAAGCATGTAAA
TTGGACCTAAGTTCTGCTCTTAAAGAGTTGATTGAAGTGTGTGGATGAACATCTATATAT
GCAATCTATTAAAAGAACTTAATTCGGCTGATATGGCTTGATCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1086, 2456..2457, 2770..2923, 3575..3733, 6502..6658, 7337..7426, 9154..9248, 9370..9454, 10742..10876, 11730..11829, 13112..13188, 13397..13513, 14757..14846, 15270..15435, 16263..16423, 17245..17373, 19709..19775, 19871..19996, 20386..20483, 21312..21407, 21966..22186, 22271..22413, 24717..24962, 26028..26144, 30117..30304
1001..1086, 2456..2457, 2770..2923, 3575..3733, 6502..6658, 7337..7426, 9154..9248, 9370..9454, 10742..10876, 11730..11829, 13112..13188, 13397..13513, 14757..14846, 15270..15435, 16263..16423, 17245..17373, 19709..19775, 19871..19996, 20386..20483, 21312..21407, 21966..22186, 22271..22413, 24717..24962, 26028..26144, 30117..30211
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved