Monodelphis_domestica Locus ENSMODG00000007480
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000007480
Monodelphis_domestica
ENSMODG00000007480
5
SNORA3, SNORA3
1549..1679, 2495..2626
3893
GACTGCTCGGGAGGGCAGCGGGGTCTCTTTCACGTAGGCATCTCAGGCCCATAGACTTC
AAGCTGGGAAGGACCTTGGATCGAGTTCCCCCGTTTTAGAGTAGGACTCCCGTGGCCCAG
AATGCTCAGCGATTTGTCCAGTCAGAACGGGTTGGAGCACTACGATAGGGTACATTCGCC
TTCGGAAGCTCCGCTTCAGCTCGGAGAGTTGAGGCCAGCTGGGTAGGGTAGGAGGGGGCC
ATAGATGAGGCGGGTCAGTTCAAAGTGCCTTTATTAAGCGCCTCGGGCAGGGGAACATAA
ACCTAGTAGAGCCGCAGCTCCACAGGAATGGCCCTTCCAGATCTGGATCACCAAGAAGCA
GGAATTGCCAAGCCTGCCAGACCCTTTCCCCGGCAGAGACGACCTCAGAGACCTGTCCGA
GCGTGGCCGCAAAGGCAGGGTTTCCAGGGTCCAAAAAATAGAGGTCTCCTCCCTCAGCTC
CGCCTGCCGAGTGCCGGCGAAAATAGAAGAGACTTTAGTAAGGCAACCATAGCCCAGCAG
TAAGCTTAAACTGACGACCCGCCCCCCCCTCAGGGCACATGCGCACCAACTCCTCTCCCT
TCGTCCCGCCCTTCCTTGGGAGAGGAAGTGACGTATAGTCTAACTTCCCCTCCTCTTTGC
TCTTCTCGCGACACTTGCAGCTCAGCTTCCTTTTCTTTTTTGCTGCGGCTTGCGAGATGG
TAGGTGTCTGTGGTGGGGTCTCTTGTCCCTGGATGGACTGGCCCAGACCGCCTGGGTCAG
CTCGCGGGTGGAGGGGGATAGGCTGAATCTCTTTTTCCTTCTCTTACCTCCCCCTTCCCT
ATCCTCCCTTCGCCGGGTCCCTGTGGTAGGGACAGTGAGCAGCCACGCGGCCCCGGGGGG
GGGGGGGTGGAAGAACGCGTCTGCGCCCAGGGCACGTGGGGTCTGCCGGTGTCGTGGCCC
GCGCTGGCTTCCGTGATCCGACGCCCTGACTTTTCCCTCCGCAGCCTTCCCGACTGAGGA
AGACGCGGAAGCTCCGCGGGCACGTCAGTCATGGCCACGGACGCATCGGTGAGTGACGGC
CTGTGGGGAGGGCCACGCGGCGGAAGGTGGGGCCCAAGCTGGGCTGCGGTCGGTAACTCG
GATCTCTTCCTCCAGGCAAGCACCGCAAGCACCCCGGAGGTCGCGGTAATGCAGGAGGGC
TGCACCATCACCGAATTAACTTCGACAAATAGTAAGGGTTTGTCCTGGCCGGCTCAGGCC
TGACCCTCCGACCGTAGTCTCGGGGCTGCTGAAATGTAGAGTCCCAAAGCTAGCAGCTAA
CACAATTTAATTGACTTCACCTACGAGCTTATTCTTCACTTTGAGACAAACATTTATAGG
ATGTCTGCCGTGTGTTCGGGGGTGGGAGAGAGCCCCAAACTGCTAACGGGGATTAATACC
TAGTGTTTATTGATGAATGAATTAGGCTTAGGCCAGAGTAGTGGACCTTAAGCAAGCCTG
TACGATCTATAAAGGAATATATTGCCAAGACCAAGTAGATTTGCTGAAAACCGAGACTTA
GAGTCACATCTAGGCATTGCCTGTTGTCGTGGTGTGCTAAAGTCCTCGAAAAGTAACAGC
TAACTCTATTCACTGGCTGGTCATCTTGTGATCCACTCAGTCACCGGGTTAGGAATAAAA
CAAATTTAAATGCTCTGCAGAGGGCTTGCTTAAGGTGAGGAATGTTCAGTAACTTGCCCA
GGGTCACACAGTAAATGTCTGGGGCTGGATTTCCAGGCTCCAGGCCCCTCTCCAGATGCT
ACCTTCCTCTGGAGTAAATGAAAACTTGTCGCTGAGGAAATGCCGTTTACTCTTGTAGGC
TAAAAATAACTGACTTTGAGATAATCGTTTCCCATTTACTAGTTTAGATTTTCCCCATCT
TTAAAAGGGCATTGAATTCCAGACTTTTAAGACCTTTTTGACCCTTTTTTATGGGTAAAG
TACATATTTTTAATTCTGTCAAGTAAAATTAGTCCATCCTTTTGGTCAGACCTTGGCAAT
TAGGAAAGGGCAACTGACTTTAGGCCTGACACTAAATGATGGGTTTTTTCCCCCAGTCAC
CCAGGTTACTTTGGGAAAGTGGGAATGAGGCATTACCACTTGAAGAAGAACCAAAGCTAC
TGCCCAACTGTCAACCTTGATAAGCTGTGGACACTGGTCAGTGAGCAGACCAGGATTAAT
GCTGCCAAAAGCAAGGAGGGGCTTGCCCCAATCATTGATGTTGTGCGCTCTGTAAGTAAA
CAGAACTAAACTTACTCCATCTTAACCATCCCAACTGTCTCCTCAGGATTTCAGTTTTTA
AGCTTGAGTACATTTAAGGCATTCTGTAATGCTTTAAACATAGTTAAACTTAAAAAGGGG
GCCTTTGAAGCAGAAAAGAAACACTATTCTTTAGCCTCTTCATATATAATCTGCTGACCA
TATTTGTTTGTAACAATTTCTTCATCTTCTGCAAACCCGAGACTAGAGTCACATCCTGAC
AATGACTGTTGTTTTGGTGTGCTAGAGTCTTCGGAGAAAATCTTCTGACCTTTATTCACT
GGCCTTGGCATCTGGTGCCACAGTCAGTCACCGGGTCAGTTACATTGTATTTGCTTTACT
TGAAAGACTAATGTGTGGCAAAAAAATGGTTCTGTTTTTGGGTATCAGTAAATCTTATTT
TGATTGTAAATGCGCTGTACAGTGTAATGGTTCTTATTTAAGCTTTTCCCATTTCAACTT
TCTAGGGTTACTACAAAGTCCTAGGAAAGGGGAAACTCCCCAAGCAGCCAGTCATCGTGA
AGGCAAAATTCTTCAGCAGAAGAGCAGAGGAAAAAATCAAGGGTGTTGGTGGAGCCTGTG
TCCTTGTGGCATAAAAATCCAATGTTAACCAATAAAATGTCGTTATTAAACAGTGGGGTT
TAATGTATATGGTTTAAGAAATTGTTAAAACATTTCCGTGGTTCTGGTTTTTCACTGACA
GTTAAAAAATGACTACAACTATTTGCATACTAGTGGGTGCTCTCTTAAATTTCTAATTAG
TTTTATGTACACTATGAATGTGGATGTTTTAATCAGTTTTCATCTAAAGAAAGTTCCTGG
TTGCATCAGTTGAGTACATTCAATTTCCTTGTATGCAAGAATATTAAGCCTTCTGTTTTA
TGTCAGGCACTAAGTATACAAACAAGCAAAGGTAAGTCTCTTCCTCAAGCTCATGTTCTA
ATGGAGAAAAAGAGCAAAAGTATATGCCAAATGCATCTTGGGTAAATCTCAAGGCAACCT
TGGAAGAGATGGGAGAGGGGCAGTGCCATAGAGCAGGTAGAACAGCAAGTACAATTGTGG
GTTTAGACCCTGAGTAAGTTGAGGATGTGATGTGTAGGAAAATGTTAAAAGTAGGCAAAG
CTATAAGTTTTCATTTAATGCCATAGTCTGTAATTCTGGAGATGAGAAACCACTGGAGTT
GGGAAGATGATGGTCAGATGATCTAGAATGTAGATCTTGGCAGGGAGACCCAATTAGGAA
GCTAATAGTGGGCCAGAGGTGTTGAGGGCCTTGATTAAGTTGCTGATTGTGAATATATCA
AGTCCAAAGGAGCAAAAGATAACATGTTGGCAAAACTGGAAAAATTGTATTCTCAATAGT
AATAGGGGAATTAAGTGAATTTTTTTGGAGTTGCTGAGGTATCTGCTTTGAAATGTAGAA
ACTGGAGTTAAGGAGAAGCTATACACCTGGGAATTAGCTATGTAAGGAATTGTCAGTGGG
TGGCACCTAAACTTTAAAAGTTTGTGAATTGTTAGAATAAAACTTAATTTCACAACTAGA
CAAGTGACTTGGGCAACATTGGTGTGGATTTGAACTTGGGTCTTCCTGCTTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1155..1230, 2096..2270, 2765..2893
1001..1067, 1155..1230, 2096..2270, 2765..2890
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved