Monodelphis_domestica Locus NOL5A
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica NOL5A
Monodelphis_domestica
NOL5A
5
SNORD56, SNORD57
3818..3888, 4185..4252
5752
CCGGTTACAATAGGAGCAGTAGAAAGAACACAGTCCGCGCGCGGTAAGAAGGTATCGCG
AGAACTGAAGTTTGGTTCCAGGCACATTGTGTGGATTCCACGTCGCCCACGCCCTCACCC
CCCGGCCTCTTCCTTTCCACGGCAAAGGATCGTTACGGTTGCCCCCACGTGGAGGAGTGA
CGACTTTTTCCGTAGGTGGAAATGACTCAGAGACCCATTAATTATCTTGTATTTTCTAAT
ACTTATTAGAACGTCCCCACCGCGGGGGTCTGGGTGATCCCGGAAGCACCGCCCCATTCC
CATCAGCCAGTGGGGCCGGTGCAAAGGCGGGAAGCAGCGCGCACGCGGCGGCCCCGGTGG
CCCCACCTTACTTCCGGGCGAGACCATTTTCTTCAGCCTCCCCCTTGGTCTCTTTAAACG
ATGGTGCCTTCCCCGAGCTCTGAGTGGACGTTTCGACCCGGAGGAGGTGGGGCTAGCGAC
GCTAGGGTACCTGCGTGTCCGGCGGGAGGCCCGCATTGCGATTGGGGCTTCAGACTGCCG
CCATGGTGAGCTGGCCTGCGGGCCATGGGGCAGGGGTCGGGGGTCGGGGGTCGCGAGTCG
TCCTGCCCCAAATCTGAGGGTGGGGAAGGGAGTAAGCTGCAGGTGGAGCGAGGGTCCAAT
ATAAGCGCGTGCGCACGGAGGCAGGGAGGGGAACGGCGGTGGCAGAGGCAGATAGCCGAC
TTTTGGGCCGCATGTGTGCGGCCTCCCAAGTGTGGTAGCCTGGGCCTTCCTTCGAGGGCA
GAGCAGGACAGGCGAGAAGCGCAGCCTTTGCGGGGGATGAGGTCCCGGGGCTTTCTGGAG
GGGTTTCAGAACTCTGCTTTTCGGGACTGGACTGGGACACGTGGAGCAGCATGGGGAGTT
GGACCCACGTGGCGGGGCTGGCCTGGACGGGTTAACTTTTTCGGTCACTGAATCGGGGTT
TCAAGGACCCCATTTAACACCCCTCCCCCCTATACTCCTAGGTGCTGTTGCACGTGCTGT
TTGAGCATGCCGCTGGCTATGCTCTGCTGGCACTCAAGGAAGTGGAGGAGATCAGTCTGC
TACTACCCCAGGTAAGCCTGGCTGCAGGCAGGGTGCATTTGGGAGTAGAGGTTCCCTGGG
ACAACAGCCGCTGCACTGTGATGAGTTTTTAAAATCTGTCAATCCCCTGACCATAGTGAT
GTGACTTACTCTCTGAGTACGGTGTCTGTCTCAGCCCCAGGAGGAAGGATGGGAGGGTAG
TATGAAAAAGGCCTTCTAGAGAAAGCCACGTGCTCCTGCCTCCTGCTTCTTAGATCTTTA
GGCCAAGTAGCTTTTGTTTGCAATTCTTGGTGATGGAAGAGGAAGAAAGCATTGGGGAGG
AGCCTGTGTCCCTGAGTAGGAACCTATTTTCCCTGAAAATGGGGAGTTTGCCACCTTCCC
CTTCTCCAGCAGTGTCCCTAGACACTCTTTACCTTCTCAGGTGGAGGAATGTGTGCTGAA
CATTGGAAAGTTTCACAGCATTGTCCGTCTTGTGGCCTTTTCTCCATTTAAGTCTGCCCA
CAGTGCTTTAGAGAATGCTAATGCAGTTTCCGAGGGTGAGTGTCTTTTCCCCTCTTGATT
TTTCTGACTTTTTTTAATATGCTGTGCATTTGTAATTTGAAGAAATAACTATTCACAGGT
ATCCTCCATGAGGATCTCCGACTTTTCTTGGAAACCAACATGCCAGCTAAGAAGAAGAAA
GCCTTACTGGGTGTTGGAGACCCCAAGATTGGGGCTGCTATCCAAGAGGAATTAGGTTAT
CCCTGCCAAACTGGAGGTGTTGTTGCTGAAATCCTTAGAGGTAAGAGTCTAGATAACTTT
AGAAATCAGAAGTGAGGGCTGGGACACGGTCTAAGTAGAAGTTTGAATGAGTACTGGATT
CCAGTGGTGGAGAGGTACTCTGGGGTGTAAAAATGGAGACTTGAATCCAGAACTCCATTC
CCCAGCAGTCCTTGCTCACGTCCCAAAATGCCTTGTAACCTCACCTGGGCCCAAGTCCTG
GTAGTGTCTCATTCTACCTGATTGCTTTCAGGAGTTCGTCTGCACTTTCATTCTCTGGTG
AAAGGTCTGACTGAGGTTTCAGCTTCTAAGGCCCAACTGGGTCTAGGACACAGCTACTCT
CGGGCCAAGGTCAAGTTCAATGTGAACAGAGTAGACAACATGATCATCCAGTCCATCAGT
CTTCTTGACCAGCTGGACAAAGACATCAACACCTTTTCTATGCGTGTCAGGTCAGCTCCA
GGGAGGGTGGGGCAGGTGTTGGAGCCATGGCTGAATTTTTGATGGCACTCTAGCCCTTCC
ACCTCCTATTGCTTACCACAGACTGTGTTTTTTCTTTGCACAGACTGTATAGAAAAAGGA
GGCAGAGAAACCTTTCCTCTTGTACACCTCAGCCAGGAGCCTGCGTGTGCCCTAGCTGTA
TTGTGAAAGGGGAGACAGCAACAACTTGGGAATCTGGGGAATTGGGTTTGGGGGACAGGG
AGGTGCAGTGGGTAAGGTGTGTTTCTCCATTGGACTGCTGCTTTTCTTTTTTTTTTCTGC
TTAAGATCATCTCTGGTTTTTCCAGGGAGTGGTATGGCTATCATTTTCCCGAACTGGTAA
AAATTGTTAATGACAATGCCACATACTGTCGCCTGGCCCGGCTCATTGGTAATCGAAAAG
AATTGAATGAGGAGAAGCTAGAGGCTCTGGAGGAGCTGACAATGGATGGAGCGAAGGCCC
AAGCCATCCTGGATGCATCTCGGTCTTCCATGGGTGAGTGTTTTATTGGAAGTCTTTGTT
CAGTCAGTTGTGGAGGAGAATGTTAGGGTCTTTATATTTATTTATCGCTTTTCCAGGTAT
GGACATATCTCCCATTGACCTGATCAATATTGAAAGTTTTTCAAGTCGAGTGGTGTCTTT
ATCTGAGTATCGACAGAGTTTGAACACTTACCTTCGATCCAAGATGGCCCAAGTGGCCCC
CAGCCTGTCAGCCCTCATTGGGGAGGCGGTCAGTCATTGGGGTGTGTGTTGGGGGGTACT
GTTGCCTTACGGTGCAGCTTCTAGCTTAACTGTTTTCTCCTTCAGAGTTAAGAGTGGGTT
TGGTTATGTCAGAACTGGCTGCCCTTCGCCCACATCATTTTTTTTTCTTCCTAGGTTGGT
GCTCGACTTATCTCCCATGCTGGGAGCCTTACCAATCTGGCCAAGTACCCAGCATCCACA
GTGCAGATCTTGGGGGCTGAGAAGGCACTGTTCAGGTACCAATGTTCAGGTACTGACATT
CTGGTGCCAGCTGCTAGGGGGTGTGTCACTGTGATGGCAGCGCTGGGGTACCCTGACCCG
AAGGCTTTGTCTCGGTTGTGATGGGTCAGCCCTAGCCTCTGAGTGACCCCCATGGCCCCA
AGGAGGGGATGCAGCCTCCAGGTCAGCGACATCTGACTCCTGGCCCCCATGGGAGTTTTG
TGGGTGGGGCCGAGGTGGGCAATCATTTTTGGAATTGAAATGGGAGACCTTTGGTAAAAT
GGTCCAGGGGTAAGGGATTTGGGAATCTGTCCCTAGGAAGCTAACCCTGTACACTTCTAT
AGAGCCCTGAAGACTCGGGGAAATACCCCCAAATATGGACTCATATTCCACTCAACCTTC
ATTGGCCGTGCGGCCGCCAAGAATAAAGGCAGAATCTCCCGATACCTGGCAAACAAATGC
AGCATTGCATCCCGGATCGACTGCTTTTCTGGTACAGGATTCAGGGCTGAGGGGGAGGGG
GGAATAGGGTAAGCAGGAAAAACTATTCCAAGTGGCTTCTGCAATGATGGGAAAATTTTT
CGTCAACAGCAGTTCACCTTGTGAGTGTTGAATTTCTTAGTCTGAGCAAAGCTGAGGGTT
GAGGGGTTCGGAGATCACCAGGGTCCCCTTGAAGGGTGGGCTACATGATCCTCCTCCCAA
CAGTATCCTAATCATCTGTTCCCAGAGGTTCCCACAACTGTGTTTGGAGAGAAGTTACGG
GAACAGGTAGAAGAACGCCTATCATTCTATGAGACAGGGGACCCACCCCGGAAGAATCTG
GATGTTATGAAGGAGGCAGTGAATGAGGTTGGCCCAAGATATATGGTCTACCAGTGGAAG
GCATGGGGAGGGAAGGACAGATGGGAGAGCATAGTCTATACCTGTTGGAGGTGATGAGCA
TCCTTACCCTGACTCCAGAGTGGAGGCAAAAACTGATTTAATGAGCCTGATCCAACATGT
CAGGGGAAGTTTATGCTTTAGTGCTGGTTGGGATTTCTGGGAGCTGACAATAGTTTGTCT
GGACAGGCTGGGGAAGTGGTTGCAGAGATTAGGAGGAAGCTGGCGAAGAAGGAAAAGAAG
CGGCTGAAGAAAGAGAAGAAGCGCCTAGAGGCTTTGGCAGCTGCAGAAAACAGCATTCCT
GAAAATGGACAGGTGTGTGATGTATCTGTATATCAGACAGGTACCCTCCACCCATCCAAA
AACCCATGGTGGACAATTTGTAATCTGGGGACTGGTTTGGTTCTAAGCATGTCCCCACAT
TTGCCTTTAGGAAACTGAGAATGGGGAGGAGAAACCAAAAAAGAAAAGAAAACGACAGGA
GGATGAGACTGAAGAAGTCCCTGAAGAGATATCCACACCCCCTAAGCCCAAGAAAAAGAA
AAAACTTTTAAATTCAGAAGATGGAGTAGCAGCAGACACACCCACTATAGTCAAGAAAAA
AAAGAAAAAGGCACAAAAGACTTCTGGGGGCGAGGACTAGAACCCAGGACTTGAGGCTCA
GGTGACCACTGGTGCTGTGTGTTCCTGGGCCCAGCACCCAAGGGCCAGGACTGTAATTTC
CCTCCCTCACCCCCAATAAAGACATTAACTCACAGAATGCTACCTTGGTTTAATTTATTT
CTTCTCCCAGATTTATCAGGATGCTTGTGGGGTAGACAGGCTACTAATGATGGCCTGGGT
GAGATCCCGGCAGGTGGCATAGCCACCCATGTCCGGGGTGCGTACCTGTGAGGGAAAAGG
GGGTAATAATTTAACCTTAGACCCAAGAGAATTTCTTGGATCTCTTCCTCCCCTCAGGCC
CTCCTCCCATTTCTGTTCCCAAAACAAAATTTTTAATACCTTCCCCCATACTGATAGGGG
ATTGTTCCACCAAAAGCCCCAGGTTAAATTGGGAGGGATGGCACAAAGGATCCTGACTCT
GGTCGTGGTTTTTATTGAGACAAAAGCACAAACAGCTGTAGATAAAGAGATCTTGTCCCA
TGGAATGGAATGGGGCAGAGTTCCTCCAAGTGGTCCATTTTATGGAAGCAGGGGGGTGAG
AACAATGGGACTTGTCCAGGGACTCTGGTCAAGGGCAAGATAAGGAAATGGGGAGAGGTT
CTAGCCCCCATGAGGGGGGTGCAGGTGGCTGATGACAGACTTGATGAAGTCAGACGTGGT
GCTGTAGCCGCCCATGTCCCGAGTCCGAACCTACATCCAGTGACAAAGCCACCAGGAACA
AGAAGGGAAAAGATGGCTAGTGAGTGTGGAGGGTGGGCAAAAGAAGGGAGAATGATAATG
GAGGGGTGGGAAGGCGACCTGAGGAAAGATGGAAGTGCCAAGAAGAGATGAGGCAGTGCC
AAGAAGAGATGAAAGAATGGGGAAAGAGTTGAGGAAACACAAGAGATGGAGGATGGGGTG
AAGGATGGCCCAGAGAGAAGTTGGCATTTATAAGGTTCTTTTAGGTGTACAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1090, 1480..1594, 1678..1839, 2071..2269, 2605..2792, 2876..3027, 3174..3274, 3602..3750, 3985..4106, 4326..4451, 4570..4752
1001..1090, 1480..1594, 1678..1839, 2071..2269, 2605..2792, 2876..3027, 3174..3274, 3602..3750, 3985..4106, 4326..4451, 4570..4752
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved