Monodelphis_domestica Locus ENSMODG00000010967
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000010967
Monodelphis_domestica
ENSMODG00000010967
8
SNORA62, SNORA62
3395..3549, 5916..6071
8480
CTACTATGTGCCAAGCACTTTATAAATATCACTTCTGATCCTTAAAACAACGCTATGAG
GAAGGTACTATATATATATATATATTCTTTTACAGATGATGAAAACTTAGAGATGGAATG
ATTTCCGAAGCTCATATAGTTGAATGCATCATTGGTGGGATTTGAAGATGAAGCTCTCCT
TATTTTAAGTCCAACACTCCTTTGAACCACACTGACTCTGTATCACACTGCTCAATCATT
GCTTGTTGAATGAATCTCTGCTGTGACAAAAATTCAATCTGTCTCTAACTGCTATTTGCA
GGTTTTTCCTGTTAAGACATAACTGGAGTTATTAAACTGAAAAGTTGATGGGCAGCATTA
GGGCTTTGTGATGTTACTTTCTCTATGAATGAGTTACAAGACTCCTTCCCCCCTCACCAC
CCCCCGCCCCAATTCTTCAAACATCTTCTCCTCTGGCCAATTGGTTGTCTGTGAACAAGA
CAGAATTTAAGTTCCTTGGGGGGCAAGGGCTGCTTTGTCGGTCTTTGGATTCCCAGAGTT
GGCACACAGTAGAGCGTCATAATTTTTCTTTTTTCTTCCTCTCTCATCTTTCTTTCCTTT
CCTCCCTCCCTTCCTTTTTCTTCCTTCCTTCTTCTTTCTCATATTTCTTTCCCTTTCTTC
TTTTTCCCAGTTCCACCAGAGACTTAAATGAATTTAATTCTTAAATCAATCCTATGTCCC
TCCCTCTACAGGACAGAATGCTGCGCATGCGCTCTGGCTGGTGCCCGTCTACTCAGATTC
GTGTTTAGGAGGCGCACGCGCATACCCGGCGTCTTTCGGTGAGGAAGGGAGCAGGCGCGT
CCCTTTCCCGTTGGCCACTTAACGAGGGTCGCTTTATCCCGGTCTTCCTCAGGACCTTCG
CTCTGCTCTGCCCCGCCCCCTTGCGACTACAAGTGGCCAAAGAAGAGCTTGGCGACAAGG
AAGTACTTCCTGCCCTTGCCCCGCCCCCTGGCTGACCGGGTTATATAAGGACGTCATTTC
CGCCCGTGCTCCCTTTCCGCGGTCCCCAGAAGAGGGTTCCATACGGCGTTGTACTCGGTC
AGTGTCCGCGGGTTCATCACCGCGTCCCTGCGGCTGCAACCGCTATGGGCCGAAGGAGGG
GCGGGAGGCGGGAGGCAGGAGGCCGCGGGTTGGAGGGGTGCAGCGCGCTGGTCCGACCCT
GACGGCGCGCGGGGCCACAGGCCTCTGGAGGGCCGGTGCACGTGGCGGCCTCCCCGGGCC
TCGGCCCGCCAGGCCGCGCTCCTTCCTGCCTTCCGTGTGGAGGTTCCGGCGCTCGCGCCT
CTGCGCGGAGGGAATGAAGGCTGGGCCTGACGAATAATCACGCTGCGTACATGGGACTCG
TGCAGGAAAAAGGTCCCTCTCCCCCTATGTACGATCCGAGTATTCCCAAGGACCAGACAT
GGCATCCTCGGAGGAGGGAGAGGACTTGTCCAGGGTCCCAGAACAGGACGCAGGGCAGCA
GGGGTCCCATGGTCTCCTCTGACACCCACACTCAGTGAATCTTCTGTGGACTAGCAGAGC
AGCTACTGGTCCTCAACCAATAGCAAAGGAAGTTCACTGAAGCGTTAGGGATGAGCCTGG
AGAACCTTCTAATTGACGTAGGTCCGTGTTTAGTGTCTTAATAGAAATTAAGTGGTCTTT
TGTGTTAGGCAAATGGTTTTGACTTTGGGGTCCCCCTGGCATACCCGACGTGGAGAATCA
CCGAGAGTAACTGTCAGGAAACCTACCAGCCCTACCCTTTAAGCTGAGTTGCCGGGGCGA
AGGCCATTGCCGGGGGCGAAGGCCGTTGCCGGGATGTGTCTGGAAGGATTTGAACCCCTG
ACCTCCTAGTTTGGAAGCTGCTTTCCAAGTTTATACTTTTTGGCTTATTTAGGAGTATGG
CAATTGAACAGGAAGGATGGATTTTTCAAAAGGACACCCAAATGCCACAAATTCTGATTG
TTTTCTGCCATTTCAGGTTTCCGTCGTAACTTTAAAAGGAAACTTCCACAATGTCCGGAG
CCCTAGATGTCTTGCAGATGAAGGAGGAGGATGTCCTCAAATTCCTTGCTGCAGGGACCC
ATTTGGGTGGCACCAATTTGGACTTCCAAATGGAACAGTATATCTACAAAAGAAAGAGTG
ATGGTGGGTCTTTGACGTTAAAACAAGTGCTGGACAGGTTGGGAAGCCTACTTATTTCTA
GTTGGTCGTGTGCCTGGGGACAAGTCAAGAAAGTGGCTGGGGGAATTGATGCTGGAGGAT
GATTTTGGGAGGGAGCAGTTCTGAGCCATTTAAGGATATTTAACAGGATCCTGAAAAGAT
AGGCATAATAAGCTCACATTTAATAGAGTGCTTTAAAGTTAACAAAGCACTTTGCTCACA
ACTTTGTGAGGTATGTGCACTTTCCCCATTTTGCAGATGAGGAAACTAAGACTTAGAGAT
CAAGTGACTTCTGATCACATGGTAAGTAACTATTTCCGAGTGAGGATTTTGGCCCAGGTT
TTCTTGCTCCGAATCTGTCATTCATAGGCCAAACCACTTTTCATTCTGTGTATTGTATAT
ATCTGGGAATTAGTGATTTAAGGATTCCCAGAATTTTCAGAATTAGACTGATAGGTCTAA
GTGTATCACCATGTTGTGGAACTTATAAGAAAGATATGTTAAATGGGTTCACTTAACCTA
ACTATATATAATCACATGAAATCAATAGTAATTTTGTTGGTTACCCTCTGGACCATACTA
TCCATGGGGTTTCCTTTTTCTCCAGAATAATATAATTTAGCACTAAACAAAAGAAAAGGC
ATTGCAAATACTAAGTATCTTCATGTTTCATTCTTGACAGTATAATTTTACAATTGGTAA
ATTCATAGTCTGATAGTGAATCTTTCCCACCTTGCCTTTTAATTGTATTTATCTTTGCAT
TTGGGTTGTTGAGAACAAAGATTTAAGTTTCTACTATGGACCAATGCCTAATGTAATTGC
TCTGCAAATAATCTGATCCTCACAACCCTGTGAGGTAGGAACTATTATGATCCCCATCCT
ACATTTGAGGAAACTTAGGCAGGTTAAGTAACTTTGGCCAGGGTCACATGAGACTTCCAG
CCTGGTTCTTTCTAACTCCCTTCTGCATAAAGATACTCTACTAGCATTTTTAAAAATGGT
GAACTTTTTCCTATTCTAATCCCTCGAGATGAAACAAATTATAAATATATAACTGGAATT
AAGAGATTTGTAGATATTTAACGTAATAGAGGAAGCAACTTTAGAAGGCAAAAGTTTTGG
TAATCTAGGTGATCAGAATTTGAGTCAAGTTGGTAGAAGTAGGAAGGGAAAGGAAGGAAT
GAATGCAGAAGATTCCATTGTTGGGTCAATTCTAATCTGCACATTATTAAAACCCAGAGT
TTAGGCCAGTTTTGGGCCAATGAACTTCTGAGTGTCGGAAGTGTGCTACAGTATGTTGGG
CAGGATTTTCGCTAACACCAGTAGAGCTTGTCTCTGTGACTGGAGTTTGATAGTAGTCAC
TGCCACATTTCTGATTTTAGGTGGTGTTCTTAGTGTTACATTTTAAGTTGGTTTTTAGAA
CTTTGTTCTGCCCGCTATAGGCATCTACATCATTAATTTGAAGAGAACTTGGGAAAAGCT
TCTGCTGGCAGCTCGGGCCATTGTTGCCATTGAAAATCCAGCTGATGTGAGTGTCATCTC
ATCTAGGAATACTGGCCAGGTATGTGAATTGGGAAAATTTTTCATGTTGAGACTGATAAA
GTCACATTTCTAACTCTTAAGGTATGCTCTCATTTGATCCTCCCAATTGTCCTAATAAAG
TTGATGGTAAGAGGTCATTCAATTTTGCAGATGAAGTGATTGAAATTCAGACCGGAATCT
GCCAGGTCTAAATGTAGAAATTCTTAAAAAGCATTTCCTGACAGTTATGTATCTGGGATT
TTTATTGATAATTGGTTTAATTTAAAGTATTTTTAGAAGTTGGTTTGAATTTTATAAATT
GAGTACAATCTTTGTATGGAATTACCTGCTACAGTGAATGAATTCATAAAAGTATAAAAA
GGTAAGCAGAAACAAGCTACTTAAGGCATACATCTGTGATGTTTTCCAGTTTATATGGGA
ATTTCCAGAAAAATATTGTTAAACTTTTAACAGGAGCCAATTTCAAGGTATGGGCAGTAT
GATTTAAAAAATATTTTTTCAGTAATTTATAATGGCTTTGCAGTTTTGTATCAAATAAGA
AAGAAGCACTGGAAAACTTTATACATGTATTATGAAATTTATTATAATATATTATATGAA
ATGTATTATGAAAGTTGTACAGATAGATATGTAATAATAAACATCTGTTATTAATATGCT
AATGACTGCTCATTTAATGAGAAATAAAAGTAATTTATGAAAGAAAAAAAAAGATCTCTG
GGTGCAGGTCCAGCAGCAGTCTTTGCAGGACTAATGCCTTCTACAAATTTGGGTCTTTCA
TGTCTATCAAAGCTAGCTGGGAATCTGGTTGTGTACAAAGTCAATATGTCCATTGCCTGA
ACTTGCTGGACAGTTTTTGACTTCCATTATTTATAATTTTTAAGTCGTCTAGATGGTGGT
TTACTGTCACAGAACTGATTCTAGTGACATAGTAGTCAGTTCCTTTTTTTTTTAACCTAT
AATCTAACATTTTAGAATCAATACTGTGTATTGATTCCAAGGCAGAAAAGTGGTAAGGGC
TAGGCAATGGGGTTTAAGTTGACTGCCCAGGGTCACACAGCTAGGAAGTGTCTGAGGTCA
GATTTGAACCTAGGACCTCCTGTCTCTAGGCCTAGCTTTCAATTCACTGAGCCATCTCAC
TGCCTCCCTCCTAGTTATATGTTCATGATAGAATGAAACATCCATTTCAGCCAAATTTTA
TCTAGTTCTCAGAAAGCATGGAAAAGTTAAGAAATTTATCATTGCTTGTTTTTTTACTCA
AAAGATATTCTCAGTGGAATATATTCTTTGATGTGAGGCTTAAAAAAATTTTTTTTTGGT
GAGCATTCTCTAAACTTGCCTCCCTTTTCCAGTAGAACAATTTAGAAAATCATCCCAAAA
AACATAGCCCTACAAAACATCTTATTGGATTTCCAGTCTATTTTAAGTGGCAGGATGGAT
AGTGTGATTAATCTTCAATCCTGGGGACTTAAAGATTTAACATTTCTTGCATTGATTAGT
TTTAAAATTTAAAAAGTTGTTTTTCTCTAATTGTATACATTTTTCTTCTGCTTATATCAC
TGTCCCAGTTCATAGAAGTCTTTCAATTTCCTAGGAAATTGTCTACATTTTGTCACTTAG
GGCACATAATGTGAGGCTTTCTACATGATAAAAAGAAATGGAGAAAAATAGGAGTATATT
CAATACCAAAAACAACCTTGTTCATAGAATTGTTGGACACTTATCTGTCCTTACAGTGGA
ATATAGTCAATTTACTTGTAATCCTTTGGTTCATCACTTTTGTCCTCAGCGAGCTGTTTT
GAAATTTGCTGCTGCCACTGGAGCCACACCTATTGCTGGACGCTTTACACCGGGCACCTT
CACTAACCAGATCCAGGCAGCTTTCAGGGAGCCTCGCCTCTTGGTGGTCACTGATCCTCG
GGCTGATCACCAGCCTCTTACTGAAGCATCGTATGTTAACCTCCCAACCATTGCCTTGTG
CAACACAGACTCCCCACTCCGCTATGTGGACATTGCCATTCCATGTAACAATAAGGTATC
ATCAATAATCTCTCCATCACTTAGATTTTCCAGTGAGGTCTTAGAGAAGGGAGTACACAT
CCATATTGTGACTGCAGGCACTTTGCTAAATTGTCATTAGCATCTTAGGAGTACCAGAAA
TGAATTAGCTCTTGGGAAGAGCTCATTAGGTGTCACTTTGCACACTGTTAGAGCTTGGAG
CTGAGGCCAGTTACTGGCTGATGAACTCACAAGTGTAGGTTGTGTGCTATATTAATGGCA
GGTTTTTCGCTAACACCACAAGGGCCTTTGTGGTCCAATGAGTGGAGTTTGATAGTATTC
CATGCAACATGTAATTACATTATTTCAAAGGAGATAGAGTAAAATAGGCACTAGAGAGGG
TCTTGGGCAACCTGTGATACATCAAGACCTGAAGTGCCCAACTTTTGGGTATGTTATATA
GTGAAGACTTTTTTTTTGCACTTTAAAATTATTTTATTAGTTTTTGCTCCTTTCTTATTA
AAAAGGTTCCTTATCCCGACTATGAATTTGCAGATGGATAGCAGGTTGCTTTAAGGTTCA
ATGAGAGGTCCTTTCTGTACAACACTGAGCTTTGAAACAAACCACAGGTAGATGTTAATT
TTTTTGTTTTGTTGTAGAAGCTAGAGAAAGTATGACAATAGGTAGTTATGAAGTGAGGGA
GCTGTCATAATATTTGCATGATTATATTTGACTATGTGACTTTTGCAGGGAGCTCACTCG
GTGGGTCTGATGTGGTGGATGTTGGCCCGTGAAGTCCTGCGAATGCGTGGTACTATCTCC
CGTGAGCACCCATGGGAGGTTATGCCCGATCTCTACTTCTACAGGGATCCAGAGGAGGTA
TCTTTGGCCATTTTCAATGTGGAAATTGATGATGTGTATAGTATTTGGACATAATTAGGT
CCTATAATTTACCCTGAACAAAAATGATTTTCTGAAATGCACATGCTGTGTTTCTGCACT
ATAAGGGGAGAATTGGTTAGCATAGTGAGCAGTTCTTTGGGAGGACAGCATGAAAGGAAA
GGCTGTTCCTCCATGGGGGCAGCATGGGTGGAAAGGCTGTCCCTCAGACGACATCAGTGT
ATATATTCTTTAGATGCTATGTCCTGGTGTGGACGTGACCTAGAGTATTAGTCCCATAGG
CATTTGGTGGGGTGAGGTGGTCATTGTGTTCCCTGTGATTTTTACTAGATTGAAAAGGAA
GAGCAGGCCGCAGCTGAGAAAGCAGTGACAAAGGAGGAGTTCCAGGGTGAATGGACTGCA
CCTGCCCCAGAATTCACTGCTACTCAGCCAGAGGTGGCTGATTGGTCTGAGGGAGTACAG
GTTCCATCTGTGCCCATTCAACAGTTCCCTACTGGTAAGTATGGGGTAAGAGGATATAGT
TTGTATTAGAATATGGAGAATGGAGTACACATCCATATGTGCACCAACAAAGTGAAGTGT
TATTTCCATGAGTTGGGGAGAGTGGTTATCTGTTTTAAGAGGCTTTGAAAATATGGCCAT
AGATATGTGGTTCACATATATGCTATTGTGCATATTTTTCTTTAGATAATATTTGTTGAA
CTAAAAGGTAAATGGCACAGAGCTCATGATTTTTTCTTTTCTATTTTTAGAAGATTGGAG
TGCTCAGCCAGCTACTGAGGACTGGTCTGCAGCTCCTACTGCTCAGGCTACTGAGTGGGT
AGGAACTACCACAGAGTGGTCCTAAGTTTTATCCCAGATGCTCTTAATAATGTTGAAAAA
ATTATGACTGAAAATAAACATCAGTTTCTTACATTCTTGGTCTCATTTCATCCTTTATAT
TGATTATTCCAATTTTTTGCCTCAGATTTTTATACTTTAGAATGCTGAAAGACTCTTGAA
CCTTTGTCCATCTGTCATAAACCTATAGAATCTCCTTGGTATTCCTTTGTCCAGGATTAA
CAGTAAGGTCAATTTAATGATTTGTGGAGAAGACAGTGCTAGAGAGATTTTGGATCTATC
GTGGACACTGCAATATCTTAAATGTAATTGGGCTGTGGATTTCATCTTTTCTGGATTGAT
ATGCTAGTACTATTGATTTGGACCATATATTGAATGAAGTTTTAGTGAATTTATACTGCT
TTAGATCTGAAAAGGAATCCATTAGTCTACCTTATCTTAAGATCCTATTCACTTAGTGAA
GGATTCAGTACAGTGTGTTTGAGTCCGTAGAAGCTACTTAGTGGTTTTTAGGAATATCAA
CCTGACTGCCCTTCAGGGAGCAGGATGTCAACAAGAAGATGCCTAGCCCTGAACTGTAAA
TTACCTTTCAATCCAATAATTCTTTGAACTTTTATTTTTTTAAATTAATTTTTAATTCAG
TCTTATTCTTCAACTATTAAATCCATAGTTGTATGTAATGCTTTCTTGGTTCTACTCATT
TCACTTCATTATCTCATGTAGTTTTTTAAAAACCTCATTACAGTGCAGTAGTAGTCTATC
AAAATCGTATAACATTTTTTAGTCATTCCCCAATTGATGAACACCTCTATTTCCAGTTAT
AGCTCTGGGTTGTAATTCCAAATTACCCTCCAAAATAGGTCAGTTCACAGTTCCACCAGC
AGTGTATTATTAATCTCTACTTTTCCACATCTCCAACAACTGTTAATTTGTACCTTTGTC
ATTTTAGCCAATCTGGTATGAGATGATATCTCAATTATTTTGGTTTGTGTTTTCCTAATC
AGTAGTGAGTTAGGGCATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1082, 2004..2162, 3620..3738, 5509..5754, 6468..6596, 6948..7113, 7370..7480
2030..2162, 3620..3738, 5509..5754, 6468..6596, 6948..7113, 7370..7461
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved