Monodelphis_domestica Locus SLC25A3
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SLC25A3
Monodelphis_domestica
SLC25A3
8
SNORA53
6682..6920
9205
GGTTGGGAGGGTCAGTGGAAGTCAGATAGTGACAGGTCTTGATTGCCAGGCTGAAAAGT
TTGGACTTTTTATCCTACAGGCAAATAGTAGGGAGCCCCTGAAGGTTTTGGAAGAGGAGG
ACATATCTGTCAGACCATGCATGCCTTAGGAAGAATGGTAGGGCAGCAGAGTGGCTGAAA
CATGGGACTGGGGGAGAAGTGACCCCTTGGTGGGGCTGGGCGGGTGGAAGCTGCGAAGTT
GAGGAAGGACAGGGACAAGGAGGTGGAACTTTGGTCAGTTACACAACAATCGAGGTAACT
GACCAGCTCGGTAAGGGCCTCTAGTGAGTCGAAAAGTGAAAGGGATATCTAAGAAAGAGT
GAGGACAGAGCTCTGAAAGGGCAGGAGAACCCCTCCCCCATGGGCTAAATCGTATGACGT
CACGGGACGGACGTCCGGCCCTCCACCTAGCTTTCGTGTTCTAGGACGTGAGGGAGAAGG
CAAAAACTAGCCCGGGGTTCTCCACGTTACGCGAGACTTGGAGACGGTTGAGAACGCACC
TGCGCACAAGCAAGTCCTCTTGCTTAGGGGGCGGTCACTTCAGAAGGCGAGGCGGAGCCA
CGCGGTGACGTAAAGACTGCGGAGCTGTCTTCTCCAACCGGCGGGCTCGAGGCGCGGTGA
CGTTCAGGGCTGCGTCAGAGTGACGCCGGACGAAGGGCACAGACTTTAGGGCGGGGAGGA
CATTCAGTCTCTGTGAGCTGCTGCCTGCCGGAGCGGACGTTCCGTCTTGTCTCCGCCATC
TTAGGTGAGCGGGAAATGCCGGAGGAGAGACCTGGGCTGCTGGCCCTGGGCCCAGGAGTC
GGTCCGGGGGCGGTGGGGAGGATTGGCCTTGGCCAGCCGTGGGTGACCATTGAAGGTGCG
CGGGCCGCGGCCGCAACGGGGGACATTGATGGCCGCGCCGGGTGACATTGGCGCCCGCGG
CCCTCCGCTGATTACGGCCTTGCCGCCTTCTTTTCCTCAGGAGGATGTTCTCGTCCGTGG
CGCACTTGGCGCGCGCCAACCCTTTCCAAGCACCCCACCTGCAGCTCCTGCTGCAGCCTG
AAGCCGATGCCAGCCCCGCAGGGCCCCCGGGCGCACCTAGCCGGCTCCGCCCGCGCAGCC
TGGCTGCCGCCGCCGTGGAAGGTGAGATGCTCTGCCTGGCCCGGTGACCTTGGGCAGGTC
GTCGAGGCCCGCTCGCTCGTGACTCTCGTTTTACAGATTAGCAAATTGAGCGTTAGGGAT
GTGGATGGGAGAGGGGCCCAACCCCACTGAATGACAGAAAAGGGAACTGGCGGGGGAGGG
TCATAGGGGTCACAGCCGTAGAGTGGGGAGAAGCCTTAGGCCTTTGGTCTGGCCTCCTTA
TTCTTGAGGCCGGGAATAAGCTTTCTTAAGTGTTGGGCATGCACACAAATCCTATCCTCA
AGAATCTCTCCTTCTAAGGGGTAAAGACTACGTGGAAAGACCCAGGCTTTCGGGGTTGGG
AGTGGGGTGGGACCTCTAGAGGAGGTAAGAGACTTCCCCAAGGTCACCCAGTTACCCTTT
GGGATTCTCTGACATGAATCTCTGCTTTTAGATTTATTTTCTTTTCCCTTTTTTCAAACC
TTTATTTTCTTAGTATTAATTCTAATAATAATGGTAAAGGTTAGGCCAATGGGGTTGAGT
GACTTGCTCACTCAGCCAGGAAGTGCCTGATGTCAGAATTGAACCCTGGCCTCATCTCCT
ATTCTGCCTTTAGGTTTATTTCTTAAGTTTTTGTACTTCCTCCCATCCACAAACTGCACT
AAATAAAAACCTTTTACACCTGATAGTCTTGAAAATGTGTTTGAAGTCCCAGATAGAAAA
CTCAGCAGTAAGGAAGACTTGAGTTCAGATCCAACTTCAGATAACTGGCTTTGTGACCTT
GGGCAAGTCACCTCATCTCTGCCTCAGTTTTCTCTTGTAATATGGGGATAATAACACCAA
CCTCCCAGAGTTGTCAGGAGAACAGGAGATAACATTGAGTGGCAAACAGGTACATTTTGT
AAGTTATCATTAGATTACACATAACTGGGGGCTGAGTAATAGCCAGGAATGATTCTTCTC
CTCCCTCCCCCCCCACCTTAATTTCCTAGTAATCTCTTCACTCTACTAGAATTGTTAATC
TTAAATGTAATAAATGAAGGAAGCTTTATACCAGGCATTGTTTAATAGTCATAGTGGCTC
TTGAGCTGTCCCTTGGTGCCAGGAAGACCCAGTGGTAGAGAAAACACCAGCCTGCCTTTG
TCTAGGAAGGTTCTCCACCTGGTAGTTCCTATATCAAGGATATCATAGTTAAGTCCTAGT
CCCTATTTAAGATTCTTTAGTAGTTTTTAGTCAAGGCATTTATTTAAGCATCTTCTGGTA
CATGCTAAACTGGATGTACAATTAAGACAACCATAGACATTCCCTGCCATCTATGAGCTT
CTTAATAGGGGAGACAACAAGCAAACATGTACAAACAAGGTAAGGTACAGACAGGATAAA
TTGGGGATAGTCTCAGAAAACTAGAGATTGGGGGCTAGAGAGGGTTTCTTGCAGAACATA
GTTCTTAAGACAGAAGATTTATGAAAATCATCTGCTCTCAAAGAGCATTTGTTGAAACAA
ATCTATAGGGGGTCAGGCAGCTGGGTAGCTCAGTGGATTGAGATCCAGGCCTGGAGATTA
GAGGGTCTGGGTTCAAATATGACCTCAAGACAACTTTCTGTGTGATTCTGGGCAAGTCAC
TTAATCTCCATTGCCTAACCTTTACCACAATTGTGCCTTGGAACCAACACACAGTATTGA
TTCTAAGATGGGGGGTATTCATTAAAAAAATGAATAAATAAAGGAAGGCCTGACCTGAGG
AGGAAACCAGATTTTAGGCTTAATATAGAATCATTTAATTTGAGGGTAGTTGTCTTGTAG
AAAAAAGAAAGTTGATCTTTGCCCTTTGTTGAAATGGATGCTGGACTTTTGATCTTTTAA
AATTCCTGTAGAGTTTCTGTGATAATAAACCAGCAGGGAGAAATTAGCCTTTGGGGTGAA
TCCTTAACTATTGGACTCCTACTTTATATCTGTTCCTTTTTTCTTTTTTTTCCCCCAAAT
GGATCTATCTAGATTTTTTTGCCCATATCTTTCTAGATTTCTTTTGTTGTTGAAAGCTAA
TATAAAGCCTTTGTGTATTTACTTCAAGAATAGGTGAATTAATGGTCTTATAAACAAATT
ATTAGAATTTGGGGCATTGGTAAACTAACTGTAGGATCTTTTGTGCAAGTTGCCTCTTTG
GAAATTGATGTACCTATTAAAGCTCCCTTAGGTTTTTTTTTAATATATATTTTAAGAGTA
GTAAAGCTGGCTTTGTCAGTATTTAAAATTGATATCTGGTATTTGTATTACAAAGTCTTT
ATTGCTAACTTTAGATGTCATGCCTAATCTTTGTCATCGAATTGCAAGTCGAGGAAGAGG
CTTTTCAGTTTTTCTTAGTGTAGCAATATCAGTCACATGGGGGGGTTATGAGTCAGCATA
GAAATATTTTCTATCATTTGAAATGTTGTGGTGTCTGGAGAAAAAAATTAATTTTTTTTC
TTTAAATGAAAACAGAGCAATATAGCTGCGAATATGGATCTGGCAGATTCTTTGTCCTTT
GTGGCCTCGGAGGAATTATTAGCTGTGGCACAACTCACACAGCAGTGGTTCCCCTAGATC
TGGTTAAGTGCAGAATGCAGGTTGGTTTGGCATGTTGGACTCCAGTCCACCCTTGCTCTG
CATGTCTGAGAGTGGCGAGTGTGGGCCTCTACTAACAAGCTGTGTGCAAATCCTAATTGA
CCAGAAGGTAAGTTACTCTCTAGTAACATGAGTTTTTCTATTAAAAAGCATGGTGTGTCT
TGTTTCTGCTACAGAATACAGTTGTGAATATGGCTCCATGAAGTTTTATGCACTCTGTGG
CGTTGGTGGGGTCTTAAGTTGTGGCCTGACACACACTGCTGTTGTACCCCTCGACTTAGT
GAAATGCAGAATGCAGGTTTGTACCGAGTTGGCACTCCAAAAGGCTTTGAGATTATGGCA
AGATTCTCAATACCATAAAATGCTTAAAATAAGCAAGGAAGAAAATGGAAACCAAGACAA
ATTCTGCTATTAATTTGAATAGTTATGATGCAAGTTGAGATCATTCAAGACTACTGTTAT
TGTTTTTTTTTTCACAATTGATAATAAAATAAGTTTTACAGGGGCAAATAGTGCCTCAGG
TTGAGAGCCAGGCCTAGAGACAAGAGGTCCTGGGTTCAAATGTGGCCTTAGACACTTTAG
GCAACAATGTGTAAATCATTTAATAACCCTATTGCTGAGCCCTTACCCTACTCTTCTGCC
TCAGAATCAGTACACTGTATGGATTCTTAAGCTGGAAGGTTAAAGTTTAAAAAATACATG
TTTTTAACTGACTTATACAAGTCAGGTGTTAATTTTCTTATGTAATTAATGTTTGAAACT
CAAGGACAATCTGGCCCTATTGTAGGAACAATCTGGGGATGTGCCTTTTCTTTCTTGCCT
CATCCATTTGCTACCATTTTCAACACAGCTGAAATCTCTTTAATTTGGTTATCCCTAACT
CTTAGTTACTTATTTCTATATTAGCCTTCTAGTTTTAGCTGTATATGAAGTGTTACTTGG
GAAGCCCAAGTTTTACTATGTGAGATTTGCTTGTTTTTATGTTTTTGGTAAAAGAACTGG
ATTTTAATATATTTTTCTAACGATTTTTTGAGCCTAATTTTAAAAAATTAAAATGTTAAA
ATTTATTCCAAACAGGATTATGAGTTCACTTACCTATAAGGGGGAGAGAAAGAAAGGTGA
AGTATTAGGAATAAGAGGAAGATGAAGTATCACTGAACTGACCCTAATAGAGATAAGAGC
TTTTTGCATTAGGTAAATAGTAGGGGTTCTAAAGGAATGTGAACAATCCTCTTTGATGGC
AATTGTCTATTGATGTGTGTTTTATGGTGTATCTAATAGTTGAAGCACATTCTTAGTTTG
AGATGAATCTTTTTATTCATTAATTTGGAGTTCACAGAATTTTCGGCCCCTGGCATGTGT
TAAAGAAACCTAGCATACTTTTACTGGCATGTATTTGAGAGTACTTAGGGGGTAGCTTAG
TTTATTCATATTTTGGTCTGTATTATCAAAAAGGGATTTTATTTGATAATTCTATGTTGT
GTAAGTTATAGGTTATATAATAAATCGTTGTGCTTTTGAGTCTGTTAAAAACAGTGCTGA
CTAATATTAGGCTATGTGTCATGACCTACTCAATGCTTGAATTCAAGCATTATCCTTTAT
AGTAAATTGCTATTACAGTACCAGTGTAACATGTCTATATATTTCAATGAAATACTAGTA
AAAGTAAACTTTTAGAAGCATTGGGTAGTTCAAGTTGGAGGTTTTTGGAGATGTTACATC
TAACTTTATTTTGTGTTAATTTTTAAGGTGGACCCACAAAAATACAAGGGTATCTTTAAT
GGATTCTCCATCACACTTAGAGAAGATGGTGTTCGTGGTCTGGCCAGAGGATGGGCTCCA
ACATTCATCGGCTACTCTATGCAGGGACTCTGCAAGTTTGGTTTTTATGAAGCCTTCAAA
GTCTTGTATAGCAACATTCTTGGTGAGGTAAATTATATTTCCAACATACATCCATAAAAC
TAAAGGTTTGAAACAATCGACACTTTTACAAAATCAGAAACTGAAGTTTAAAAATGTAGT
TTGCCCAAGATCATAAACCTAGTTGGTGACTCAATACAAGGTTATCTTTACTATACTGGT
TGCATCTGCCTCCTACAATAAACTTGGGCCCTTTGGCCTGGATAACTAGAACAAACATAT
GCCATGAATAAGATGTCAGAATGTAGCCCAAATTGTCTTCAACATTGAGAAGTATGGTAA
AGTAAAATTAAAAATGGAATTGCATCTTTTAGTGTCTTATGTCAGAGTTGTGATGAGTGT
AGCTCTTCTTGTATTTGTTTTTGAAGTGATAATTTAGAGGGAATATGAAGACAAATGAGG
CAGGAATTAAAGGATAGCTTTGTTTCAATTTATTCTCTCATTTTGATGTTTCAGGAAAAC
AGTTATCTCTGGCGTACATCCCTATATTTAGCTGCTTCGGCCAGTGCTGAATTCTTTGCT
GATATTGCCTTGGCTCCTATGGAAGCTGCCAAGGTCAGAATTCAGACCCAGCCAGGCTAT
GCCAACACCCTAAGGGAGGCTGCTCCAAAAATGTTTAAAGAAGAGGGCCTGTTTGCGTAA
GTGATTGGTCTAAACTCTTTATACTTGTAATTTTGTTTGCCTATTTTTTTAGTCCTTTTG
ATCATTTTGTAAATTTTGGTGATTGAAAGACTTAGCCCTATCTGAGTCTTAGTGTGAATA
ATCAGCTCAAATTAGAGGCTAAGAAGCAGGAATGGTTCAGGATTTAAGTTCCATGGTTTC
TGTGCCTCACAGGCTTTCTTGCAACCTAAAAACTTGAGTTACTAAGGGATTTTGTTGGCA
TTAACTTAATGCATAGTGCCTGGTACATAGTAGGCAATTAATACTTGTTGACTGCTTTGT
ATGTTGGCTTTCTGATTTTATTTTTTTTGGTGCCAGAAGCTGATGCTTTGTTTTAGGGGT
TTGTGCATTAGACCTAGTTGGCAACATGCTTCCTTAGATCCACCTTTGTGGATGCCAACT
CTTGTTCTGAGTTCTACTTGCTAACGTTTGTTTCTTGTAGTTCCAGTCAAGAGGCATCCA
GCAACTTTACCGGTTGTACTGTCAAAGGTGCTTGAGTCATTGGCATGTGAGATGAATATA
CCTGCATATTAGTCATGCGTTCTGATAGAAATGGCAGTGTGTCGTTTCTTACTATCAGGA
CTTGATTGGTATGCGGACAGACTTTTAAAAACAAAACAACTTTGGTATTTAAAATGTAGT
TTTCTGTTACATTAACCACTTGGGTCTTGTAGATTCTACAAGGGAGTTGCTCCTTTATGG
ATGAGACAGATACCGTACACCATGATGAAGTTTGCTTGCTTTGAGCGCACTGTTGAGGCC
CTGTACAAGTATGTTGTTCCGAAGCCTAGAAGTGAGTGCTCAAAGGGAGAACAGCTGGTT
GTGACATTTGTGGCGGGTTACATAGGTAAGAAACAATTACAAATCTTTAATTATTGAATC
CTAGTGTCATTGGCATTTTGTATAGTTTAATTCATTTGTTCTAGTGAAATTAGTTATCTT
CTGTGACTTCAAGACCCCCAGGCAGCTGGTCTGAAACCTCTATTACTTTGTGATCTTGAG
ACAAGTTGTGTCACCTTGCTTTTAGCTTTAAGGAGGTTGGGCTAGACCTGATTCCTTTCC
ATTTTCTCGGATGAGCCCTAACGAACAAATATTTTTAAAAGGTTGTCTTTTGAGTGTTAA
ATTCTTGAAAATCATCGACACTCAGATAACTCAGGGTTGGTATCTTGTGAATTAGATTCA
TGGGTCTCTGCAGAGAAATAAAAAATTATATCCTTTCTAAAATACAGAATACCTGGAGGT
GAACAGTAAGTTTTACATCTTCATAATTGGTCAGTTTTTTACTGCAATATTAGCCAGCTG
AACCCCTGCCCTAGGTATAGTTTTTTTGTTTGTTTTTTTCTATGAGATGATTTAGAATAT
TTTTCCATGGTTACAAGACTCGTGTTCTTTCCTGGATATAGTTATTAACTGTCCTCATCT
TTCAGCTGGAGTCTTCTGTGCCATCGTATCTCACCCTGCTGACTCAGTGGTGTCTGTGCT
GAACAAGGAAAAGGGCAGCTCAGCTTCACAAGTCCTCCAAAGGCTTGGATTCAGAGGTAG
AATTTTGTTTCTTAAACAAAATTTTCCCACAGGGGATTGCCTTTTTTCTCCTCCCTTGTC
ATTGTGCTTTGTATTATTTTCATTAGGTGTATGGAAGGGGCTCTTTGCCCGTATCATCAT
GATTGGTACTCTGACTGCACTACAGTGGTTTATCTATGACTCCGTGAAAGTCTATTTTAG
ACTTCCCCGTCCTCCTCCTCCTGAGATGCCAGAGTCTCTGAAGAAGAAGCTTGGGTTGAA
ATAACAGACAAATCAAGACTTTAACTATGGACTGAATCTGCTTGCTGACCAGTGTTGAGC
AAATATAAAAGAAACTTTTATATATTTGACTGTGTAGATTGTCTCTTCCTGATGTAATTA
TTGGTTGTACCCTTGCCTAATGCAGGGGTTTCAAAATTTAACTGTTGCAATAAAACAACT
ATTCGTGTTTCTTCTTGCCTTTTTGTTAATTTGATTTCACTTTGTTTAAAGAGATGACAG
ATTTAATTTGAATTTTTCCTGAATTTCAACATTGACAAAACGAGAAATAAGATTGCTTTA
TGAAACTTTTCTACACGGATTATTACATTTCTTCACGTTTTGGCGTCAACGCTATATTTC
CATCTTGGTAAATATTTTTTAATGCTATGATGACCTCATTTTTTTGCATCTTCACCCCCA
AATAGGACCCTTATAAGAAGTACAATGAACGTGGCTTGTTCTCCTTGAGTCCCCTATCTC
TGTTAGGCTATGGGTAGCATACTTCATTATTAGGTATCATGCAGAGTTCTTAAATGTTAC
ATGAAATGCTCTGCTTTATCTTACTAGGTTTTCTCAGTCCTAATCCCCTTGTCATTTCTT
GTGTAATGTTTCATTTATAGTCTTTATCTTGCCATGGATATTCAGGCATGTCCCAGTTGA
TGGGATTTGAGAACAATGATGTATCTTGTGTATGTGGTTCCTTTCTCTTTCTATTACGCC
TTTTAGGGATAATAAAATGAAGTGGTATTGTTGGGTCAAAGGGTACAATTGAGTGAGTAG
ACTTGCTTTCCAGAGTGGCTGGACCTGTTAGCTTATGACTACATCATCTGCATTGATGTG
CCTGCTTGTCCTTTCCCTGACCCTCCACTATTGTTATTTCCTTGGTTATCCTTGCCAAAC
TAATGGAGTTCATGATGTAAACCTCAGTTATTTTACTTTTCATTTTTCTTGGGTCAATAT
TACTAGAGAAATGACAGGATTTAATTTGGTAATTTTGCAAGTTCAGACCCTTTTTGGCTC
TGAGAAACATTGATTCTTGGTTCAGATCTGTGACTTCAATGTGAGGGAAATCCTGGTAAG
GATGCAGATCAGCAGCCATTCTACAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1160, 3914..4035, 5487..5666, 6114..6295, 6992..7164, 7745..7855, 7946..8205
1001..1160, 3914..4035, 5487..5666, 6114..6295, 6992..7164, 7745..7855, 7946..8100
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved