Monodelphis_domestica Locus ENSMODG00000017657
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000017657
Monodelphis_domestica
ENSMODG00000017657
4
SNORA55
10253..10387
17831
GCTGGGCCGGGGCGGGCCGGACGGCGCCGCCCGGGGCGCGCCGTGCCCTTTGACCGGCG
GCGCTCCCGGGGCGGGGGTATAAATGGGGCGCGGCGGCCTCGAGGCTGTCTCTCTCTCCG
CTCCTGCCCCTTTGCTCTGTGCTCCCCGGCTTCCCACCCCCTAACCCCCCCCCAAAAGAC
AAAAAAAAAAGAACCTAAAAAAACCTCAAGCTCCAAGTGAACAACGAAGAACGGACGCGC
GGAGAGACCGTCCGCGGATCGGGGGCTTGGCTTGAGACCTCCCGGCGCCGAGAGAGACCT
TTGCCCCGCTCCGCCTACTCGTCTGCGTGTCAGGCCCCCGCGTGTCTGTCTTCCGTCTCC
GTGCTCGGTACCGCGTGTTCGTTCCGTCTCCCACGTGTTTGCCCCCTCCCCCCGTTTTCT
CCCCTCTCCGGCTGGTCCCCCACGTGGCCCGCCTCGGCCTCCGTGTTCCTCCTCCCCCTG
TTGCTCTCGCTCCTGTTCCCGGCCCCCACGTGTCCTTGAACCGTGTGCCGGTCGCCTCCC
TCCCTCCTTGTGCTTTCCCTCCCCACGTCCGCGGCCGCCGCGCTCCCCCACGTGGCTTCT
CCCCCGCGTGCCGCCGCGTTTGCTGCTTCCCTGCCGGCTTCCCTTGCTATTCCCCCACGG
GGAAGGCGACAGCTACCACCGCCCGCCTGCGAGGCCTCGTTGAAGGGGGCTGTCGAGTTG
GGGGACCACCCAAGAGGGAATAAGGCTCCTCTCTGGGGGTTCTAAATTGAAGCCGGAAGG
CTGAACCGTGGGTTTCGGCCCCATTTTTGTCGTGCTTGTCTGTGTCGCTTGTGTTTCCCC
TAACATGCGGCTGTGATTCTCCGGGCTTCGTCTCCACGTTTCCTTGAGGCTTCGCAACCT
TTACTGGCTGGCTCAGACTTCTCTTTCCCCTTGTCTGTGGCTAGATTTTGGCCTCGGCCA
AAATCGTAAAAGTCTTGTCTTTTTCTCCCCTTGCTTTGGTTCCAGAAAGAGTTCCTCCTG
GCGGGGCTCGGGGTGTTGGGGGGTGGGGAGATGAACACTGCTGCCAGCAGTTACCCCATG
GCCTCCCTATATGTCGGTGACTTGCACTCAGATGTCACCGAAGCCATGCTGTACGAGAAG
TTCAGCCCTGCTGGACCCGTGCTGTCCATTCGGGTCTGCAGGGACATGATTACCAGGCGC
TCCCTGGGATATGCCTATGTCAACTTTCAGCAACCAGCTGATGGTGAGTATGATAGGGAT
CGGGCTCCTCAGGCTGCACTTCGGGGGCTGGTTTGGGCTTCCGAGGACGCACTTGGGCCA
GCAGTATTGCAAGTGTGCAGAGCATTTAAGGCTATTGACTCTTGTTAGGCCTGCATTTCT
TAAGGGCTCGTATTTATTTCATGTTTTTTATAGTTGGCAAAACTTCCTTTAAACAATCCT
ACCAGGTAGGTAATATGAGTAACAGTATCATGTTACAGTGGAAGCTAATGAGGCTCAGAT
TTAAGTGACATGACAATGGCCACACAGCCAGTTTGCCCCTGAGCTGGGGCTCAAGTCACA
GGCATCTTACTCCCAGGACTTTCTATTTTGCCAAGGTGCTTCTCCAAAAACAACTGAAAT
GATTCACAATTTGTTCAATAACTGGTAGGTGGCCTTAGTCTTTAATCCCATCCCTAGTGG
TTACTCCTTAAGTAAGTCACTCTTGAGTTCCACTTTCTTGTGTTATGAATAGTTTTCCAT
TATTTGCATCCTGGTGGGGAAAGGAGTGGGATCCCATAAGCATTTCTGTAGCTATGTAAA
AGCATTTTAAAAGTATTTCATTTGATTCTCACTGCTACAGTCCTGCAAGGTGGTAGTTCT
TGAGGGTTCCCTCTAATTTCTAGGTGATATGACCTGTGAAAATTTTTGTTCTGAGGGCTG
TAATAGCCAATTATACAAAGAAGGGAGGGCTGGACTTAGACGGTTCTCATCCATGTGCTG
TTTAAACAAAGCTGAACTATCCCACATTGTCCTAAATAAAATCAGGAGCATTTAAAAGTA
TTAAGTAACCAGTAATTTTGAACCTCGGACCATTAGCTAACCCCGAGGGGGTAAGAGAAG
GTGCAGCCATTTTGCTGATTAAAATCTCCATCTGCATCTTGAGTTGGCAACCCCCAGGCA
CAGAGCACATGTGTAACCAATTGAACACAATTAGTTTTTTGGTATAAATTTTGGGGAAGT
GTGGTTCTTAACTGGTAGTTATGGCCAGTTGTTTTACCCAGTTAAGATAAAAATGACCAG
TCCACAGATCAGTTGGAAAGTCTTAATAAGGCTTTCAAGAAAGAATTCCTTGGGTAGTGT
CCACCTGAAGCACAAGACTGTTTTGTCTGCCCCCTGGGTATCTAGGAATGGGATGATTAA
TGCTAGAGCCTCTCCTAGGGAGAGGGAAAGCATATAATGTAGGTAACAGCACTGCTTTCA
GGATCTATAGCTTAGTCACTCACTGGTTTATAGAAGTCTTAGTTGTGTGTGTGTGTGTGT
GTGTGTGTTTCCTCTTAGAATCAATACTGTATTGGTTCTATGGCAGAAGAATAAGGGCTA
GGCATTGGAGGTAAAGTGACGATTTGAATCTAGGACTTCCCATCTCTTGGCCTGGTTCCC
CATAAACCTTAATTTTCCCAATCTAAACTTTCTTTGGGAATATTTAATCCCAACTAGTGG
GCATCACATGAGAGAATGGCCACCAGAATTTTGTATAAACACTAGCTTTTGGACATGATG
ACCTACTTAACATTGTGTAAAAGTTCTGTTAGCAATGATACAAAACCAAAGTCGTTTAAG
CAACTTTTTTAAAACTTGAGAATAAAACTAAATTCATATTGACTACTTTTGGCAACAGTA
AAGGACACTCCCTAAGTTTTCAGTTACTGATATCCCATGTTAGCCAATTGGGAGTCTGAG
GGCCTGAGAGAGCTGTTTATTCAAGGTCAGAGTAAGACAGTGGAAATAGAACCTAGGCTT
TTGCCTTCACAGATAGGGCTCTAATCAGTAGAGAGAAGCAGCTTTTTGTGTGTGCACAGT
GTGTTTTTGAACTTCCAGTATGAACACAAAAGATTGGGAGAAGCAGTACTAAGAGGTTAA
ATGGGGCCTTTTTAGGGGAAATAATAATGCTGTCTTTGGTACATGTGTTGGCTACAAGAT
TGTCACCTTTGAACAAAAGTACTGTTCAGTTGCAGATAACATAAGCTATTGGTTTGTGTC
TTTGCCAAGGCATACTTTTGCAGGTCCTCTCCCTGCTAAAAATAAATGCTGCCCACTTTG
AGTTGTCTTTAGAAGTGCCTTCTTGAAATTTAGGTTTTTTCAAAAGTCATTGATTCATAT
TGTTGAAATCGAACCCCGAGGTGTCAATTATATTAGTTGCCCACATTTATACTAAGATTT
TAATTACTAAATAACAAATGTATAATAGCACTTCAGGACTATTTCTGCCTCCTCCTGCAC
ACATTTTTATTCTCAGTTTTCTATTTGTTCCTAGCCCACTCTAGCATAAATGGAACCTGT
GGGGGTTTCCAACATTGGGTAGAGAATGAAAGTTTCCTTAGCAGATGTCAGTAATTTTGG
AGGAAAGGATAAGATCTTGTTTTTATATTAAACCTCAATGAATTGACAAATAAAACTTGC
TGTTTTTAAAATAAAGTAAATCTTTTCCCCTTGTTTAATAACATGAGTAGAAATTGTCAA
TGTGGAATCTAGAAGTCCCCAGTTTATTTAGTTGGGAGGTAGAACCCCAGGTTTTGACCT
TGTCACAGGAGAGTTTTCTATAAAGAATTAACTACTTCATTGACAGTACTTTAGGATTTG
TTGAATGCTTTTCTATAGGATCTTGCTTGAGCTTTAAGGACAATCTGAGCATTCTATAGA
TGAGGGAGCAGGTTGAGGTTGAGGACCTTGCACAGGGTCATACAGCTAGGAACGCAGGAT
TTGAACTCAAAATTTGTTGACTCTCAGGCCATCTAGGTGGCTGGCTATTCTCAGGGAGTG
AGCTTAATCCTGAAAAAGGTGTCAGGAATTTAAGGGGATCCTGAAGCATCTTTCCTCATC
CATGTTGAGTTCCATAGTCTGATCTCATTCATGAAAGGGAAAACAAGCAGGACCTCGGGC
TCAGACCTTTAGCTGGATAAGAATGCAAAGGACAGGGATTGTTTTGTGTCCTGGACCCTT
TGACAGTTTGGAACTTGAGGGACTCCTTTTAGCAATTAGGTACTCCTTGCCCTATCCAAA
ACAGACTGAGTGTACCTTGTTTGTTTTTTTCATCACTAGCTGAAAGGGCCCTGGATACCA
TGAACTTTGATGTCATTAAAGGCAAACCAATCCGTATCATGTGGTCTCAACGGGATCCCT
CCTTGAGGAAATCAGGAGTTGGGAATGTTTTCATTAAAAACCTGGATAAGTCCATAGACA
ACAAGGCACTTTATGACACCTTTTCAGCATTTGGGAACATCTTGTCCTGCAAGGTGAGTA
GTGGTTATTTCCATGGCAAAATTGATGTTTATTTAAAGGGGGTGGAGGCATGTGTAATAA
AAAAAAAATTGTAAAGCCAGCCAAAGGTAAAATGTACTTGATCAAAAGGCTGGAGAAACG
CTACTCTTAAATCTCCAAAGTCTGGTTTCCATACAGTGTGTACCTGGAAGTGAGATCTGG
GCTATTGTCCTCAGTCAGGTGACTTTTTAGAAGGGTAAAGCACTGTATTTAGTGGGCATT
GGGTGTTCTTGGGAACTTTATGGTTAAAGCACTTCATGTATTTAGTGGGCACTCTAGGGA
ACCTTAAACCTAAAGGCAAGGAAATCCCAGACTGCCCGGAACACATCAAGATGATTGAAC
ATTGGGGGTAGCTGGGTAGCTCAGTGGATTGAGAGCCAGGCCTAAACACAGGAGGTCCTA
GGTTCAAATCTGAATCTGTCCTCAGACACTTCCCAGCTGTGTGACACTAGGCAAGTCACT
TGACCCCCATTGCCTAGCCCTTACCACTTTTCTGCCTGGAAGGTAAGGGTTTTAAAAAAA
AAATGATTGAACATTGGTTTTCATGGGTCCAGGCACTGCTAGCTCAAGTCTGGAAATTGC
TCTTCTTTCCAAGCCTCCCTCCTACCATGGGCCTTCTCCCTAAAAACTTATTTACCTTTG
GTTCTTCACTTTTATTTTTGTTTTGACAAATGACAAACATTTCCAGTTTTTGATTCCTCC
TTCAGGATCATACATACTTTACCATTCCTACATAAGCTACACCTTTTTTGATATCTGGTC
CTGTCTCCTCTCACCCCTAGCTACTACCCTAGCTCAGGTCCTCTTTCCCCTGTTGAAAAA
GCTTTAGAATTTCTCTGCCTCTGACTTATCTCCTTCCTTCAAGTAGTCTCACATGGCCTA
CTCATATTCTGACAGAGCCCTGGGATAGTCCACTCTTAAATATATTCCCTCCAAGTCTCC
TAATTGCTTTCTGGATGAAATTCAAGTTCTTCACTGATAAAGACACTTGGTTTGTTACGT
AGCGCTTGTCTACATGTCTCCCCTCATCTTAATCAAGTTGCCTAACATCTGCCTTCATCC
AACACTCCCACTCTTTCATGCTCTGGGTGCACCTCCATATCACTCTTGATTTTTGTCCTG
GAGCTACAATTACCTTTTTATTGGAGGACTTAATGTTAAATTGAATTAAGGCAATAACTT
ATTTGGCTCCTGTATTTTATAGGTGGTGTGTGATGAAAATGGTTCTAAAGGCTACGCATT
TGTGCACTTTGAGACCCAGGATGCTGCAGATAGGGCCATCGAGAAGATGAACGGCATGCT
TCTCAACGACCGAAAAGTGTGAGTGTCACAGCCAGAAGCAACAACCATCGCATGAACCGT
GGTGCATCTCAATATTAACAGGGACACACAAGGCTACTGGTGCTCTCGGCTCAAACCGTG
GCCTCCTACCTCTCCACTACAGGGCTGGTGAGTCTCCCTGCCCAAGCTGTGGCCTGCACA
AGGCGGGCTCCCTGCCCAAGCCTTAGCCTGCTACCTCTCCCTTACAGGGATCAGTGGGCC
TCTCCTCTCCTGAAAATGAGAGATGACTAGTTGAGGGCCCTGAGCTTACTCTGAATCAGG
TGAAATTTGGTATCTTTAGGACCATTTGGGTCACTTTAAAACAATGTATATTTAAAATGG
GTTGTTTTTAATTAAAGATAACACCTTGTTCTGTAAGCTCAGGTGTCTTCACATTCTAGC
TCTTGGCCCATTCATGGTAAGAGCTTTGGCCTAATTGCAATGAATCCACTTTAACCAAAA
CATAAATAAATCAAGTGTTCACCAGTCCCTGTATTGTAGGAGTTGGTCTTCTAAGCAAAG
ACCTCATTTTGTAGTGGTCATTTTTAGCTTGGAGACAATCTGGTAAAAGGAAAAAGATGG
GTATGGGGGAAGGGAGGAAAGACAGGCACTTTGACAGCTCAAGGGAAAGTCTCAACTGGG
ATGTAACTTAGAACATCCATGTCATCTTTGCAAACATTGAAGGGCAACAAGTTAAACTGA
CAACTATGGGGCCAAGCATCCCACCCAAAAGGTTGTTTTCCACAGATTTAAGAAGTGTAA
AAGTATGAACATTTTCTTAAAGTGTCATCGTGGTAATAATCTTGGCCTCTGGTGTTATGG
TATAGTCGAATGAGCCAGGAAACTTGGTACAATATCCTTACTGTGATACTAATCTCACCC
ATACCATCAGATGAGCCACTTGCTGTTTGTGGACCTCTGTTTATGACATGAAAAAGAGAA
TATTAGGGGTCCTTAAAAGATTTCCTTTCTGTGATTAGGCACTTTGGTGAGATTGGGTGG
CTGGCGGGAGCCAAGGACATGGTTAGTTGGTACCAACCCCTAAACCCAAAAGTTTGAGGT
CCAGCAACAGACATGTTGTTCATTGGTGATTTTTTTTGAGCCTGGCTTTTTGTACTCCTT
TGTGTATGAAAGTTGGTGGGGTGCTGAGGCTTGCCCCGTCATTGGATGACTTGTGCCAGC
ACACGTTGATTGGTACCTGGCGGTGGAGTGGCCCACTGAATTGAGTTCCTGCTTGCCACT
GGCAAAATAATCATCTTTGTCCACTTTCCAGGTTTGTTGGTAGATTCAAGTCAAGGAAAG
AACGGGAAGCAGAGCTGGGAGCCAAAGCTAAGGAATTCACCAATGTGTACATCAAAAACT
TTGGTGATGATATGGATGATGGAAGACTGAAGGAGCTTTTCAGCAAATATGGTGAGTGTT
ATTGGGGTGCAGCAGACTGTCCTGGAATTCTCTTTGAGGAGGTTTTGAGGATAGGGACCA
AATTCATTGGAAAGAGAAGGCCCACCAAAAACCTTTATCAAATCTTCTGTGCGTTTTTTG
TAGAAACCTAAACATAACTCAAATAATGTCCTACAGTAGAAATTTAACAGTTCTCATCTT
GCCAGTCACTTCATAGAAGTCTTTCTTTGTATTGTTTCTTATGGTCCCATAACCACCACT
ACCTTACATAATTCTCATCACTTTCTATATTATGTTAAATTATAACCCACTCACTTTTTT
GCACTCTTGCCTTTTTTCCCTTTTTCGTGGTATTTAAAATCCCAGTGATAGAATTCTACT
TCTATGTTCTAAGAACATTTCTATTTTGTACCAATTTTACAGTCCCCCCCGACATTCCTT
TGGCCTTGCCAAAATTTAAATTACATCAATTTTGCTTTTTTGCCAGTGCACTATCTGTAA
AAACTTATTTCCACTTTGGAAAGTTGTATTAAAAGGATCGTGCTTTTTTTCCCCCCATGA
ATGCTTGATAGTGACTTTGTAATGATCATGTTGGTCTCACTGTCTGCAATTCTGATCTTT
TAAAACAGGTAAAACTCTTAGTGTCAAAGTGATGACTGATCCTAGTGGAAAATCCAAAGG
CTTTGGCTTTGTGAGTTTTGAGAAGCATGAAGATGCCAATAAGGTGAGATCACATGTAGG
AACCTCTTAAAGGATAGAAGTGGAAAGGATTGTAAAAAGACACTAAAGCATTATTTTAGT
CTTTAAAAAAGAAGTTAACAGACTAAATGATAGAATAAGCATGTTCTGATACTTATCTAA
ATTGGATCTGTCCCTGCCCCCATGGAATTCACATTATGGTTTAGGGATAAGACAGCACAG
GTAATTCAAGTGCATTCTAATAGTGCATTAGAAAGGTGCCCACATAACACATAGGGTTAA
CCTAAGGAAGGGGGGCTGGCAGTCTGGTTTTAGGAATAGGCCTTTACCAACAGATCAGAG
AGGTCTTCCTGTTTTGTCATTGTCAGTTTATCACAGAAAAGCTGTAAACTTTGATGTTAG
CTCTGGATGTTTGCAGTAATTGGATTTGTAAGAAGAGACTTTTTGACTTAGCAGTTTTGT
ACCCAAAGCAGTGTTCATAGAACAGATCCATAATTAACTTTGAGTATAACTCAACTTGAC
TTTTCTTACCCAGGCAGTTGAAGAAATGAATGGAAAAGACATCAATGGAAAGATGGTATT
TGTAGGCCGGGCACAGAAAAAAGTTGAACGCCAGGCTGAATTAAAACGGAAATTTGAGCA
GCTAAAACAAGAGAGAATCAGCCGCTACCAGGTAGGAAAGGATCAGATTTAGCACCCTCT
GGATAGTGACTTCCAAAAAAAAAAAAAAAAGAAATTATTTGGGGACTGAGACTTAGAATG
TACAATGTTAGGTTCCAGTATTCAGTTAATTATTGACTCTGTAGTGGTCATACAATGTAT
TTTTCACATGAAAGGTATTTTGCATTTTCATGTTTTCATTTACATGTTTGTTAATCCATT
AGTTATTGAGCAACCCACAGCCAAGCACTTCAGTCCTAAGATGCAAAAAGAAACCTGAAG
GAACTTAAATAAAGAAAATATAAAAACAAGTACACAGCAAGCTGTATATGGGATAAATGG
AAAATATTTAAGAGAGAAGGCATTGGAATTTAGGTAGGCTTTCCTATTAAAGGTGTGGCG
TTTTAGTGAGGATTTGGAGAGAAGCCAGGGGAGGGTCAAAGTGTTCCAGTGATGGGGAGC
AGTCACAGAAGAACCACTGCATATATTCTAGGTCTGGATAATAGACAATATCTCTCTTCT
AGTGGTACAGATTGCAAGTTATTATCCATACTGTTTCTTTTAGGGGGTGAATCTCTATAT
TAAGAACTTGGATGACACCATTGATGATGAAAAATTAAGGAAGGAATTTTCTCCTTTTGG
ATCAATTACCAGTGCCAAGGTAGTGTTTCTTTTGATTTTTTTTTTTGTAGTTTTCAATTA
GGAAGGCTAAATAGATGTCTTTGTGGAAACTAGGAAGGACATCTAGCCTAACTGAAAAGG
AATCCTTTATTCTTTTTAAGGGATCATGAAACTTCCTTTATCCTCAGCATTAACCTCAAA
TAAACTGCTTGTCCTTAGGGATCAGAACAAGGACCCCATGGTAGAGGTTATAGAAAGGCA
AGTCTGAGCTACTGATTGCAACAAGATATATCACTAAAGTCCTCTTTAACCTAAGATTCT
ATGTCCCAGAAGTCAATTGCTCGAGTTTTAGGGAGAGATGATTTTTTTTTTCCGTCTCTA
AACCTTTACCCTCCAAGGCAGAAGAGTGATAAGGGCTATGCAATTGGGGTCTTCTAGGAA
AGGTCTGAGGACCAATTTGAACCCAGATGTCTTCTTTATCCTGACAACTGCTTTTCAAAT
AACTTCTTGAACTGAAAGAAACTTAGGATTGTGATTTTCTATATAGCAAGACCTTTGCAA
CAAGAATGCTTTTGATTTCATTTTTGGAAATGGACCAATCTTTGGTTTCACTTTCACTTT
CTGGAGGAATTTGTTCCATTCTGTCATGAAAGGGAATCATTTCATCTAGTCTCCACCTAA
ACATCTTCATATAGTCATCAGCAGTGCCTACTCTAGTATTCATTATATACTAGGTAGTGT
TGCTCTTCCCCACTCCTGGTGGGGTGGGGATGTTAGTAGTGTTGGGTTTAGGGAGGAAAG
ACTGCTACAGATCCCTGACCCCGGCGAATCCCTCTACACCCCCATCTCGTCAGTGGCATC
TCCCAATACAAAATTGGCTTGGGATGAACTGTTATGCCCTAGCCAAATGGCCCTTCAGGG
GGTTTTGACTTGTGAGAAATGCCTTGTGTTAGATAAGAAAAATCTACTGTAGGGATGCTA
GCCAGTGTGCTCGACATAGCCAAGAAGCATCAGTGGTCTGGCACGAAGAAGCTGCACCTG
CATCTTTCCCATTCTTGGCTGCTTTGTGCCTGTCTGGGGACAGGTGGTGCTACAGTACAA
GCAGAGGAAATCCAGACAGGTTATCTTCTGTTTACTTTGGGGCTTGTCTCTACAACTCTG
CCACACTTGGGACTTGCATTTATAGAAGTGCCAGCAGGTGTCAGTGTCATGTAGGCCTCT
GAGGTCGAGGGGGGAAGAGAAAGTAATCTCCACTGGCACCCAGGCCTTCACATGACTAGT
TTGAAAATATACAGAAATGTACAGAAAGGAGGAAGGAAAGGCAGCTAGATGACTGGATAG
AGAACCAAAACTAGAGATAGATCCTGCCTTCAATTCTGGCCTTAGACATTCCCTAGCTGT
ATGACCTTGGACAAGTCACTTAATTCTAATTGCAAGCCCTTAACTCTGCTAACTAAAGGT
TTAAAGAAAAAGTCAGATTGTATAGTAGGGGGCTATATCTGAGGGGGACATGTTGCAAGA
TCTAGTGACCATGGTTGAAACCTCAAACAACTGCTGACCCATATGTATGTGCTTGTTCCT
CTGCTTGGTTCTCAGCAGCCTTAGAGCCCCCCAAACAAACAATAAAATCACATTAAGTGG
GGGGAGTCCCCCATGCCTCCCAGGCTGAGGCCTTTAGCCCCCTATATAAAGAGGGGGAAT
GAGCTTTACTGTATTAGTGATTATTCACTTCATATACTAAAAATAAAGGTAGCTCTCAAA
TATTGTGGATATTAAAATCTCCATGATACACTGGATTGGAGTTGGTAGATCTATGCATTT
GGACTTTTTGGAAAATGTCAAGAACATGAGTGCAGAAAATGGACCTGTTGGAGAGTGAGT
GACAGCTGAATCAGGTTGGAGTCCTCCTGTCCTTTGGTAGAACTTAAAGCAGCAGCCTAG
AATGACCCTTGGACATTTTAGAAGCATAGATATATTTGAATAGGGAGTTGGGGGGGGATG
CAATTCTGATTAGACTAGCCAGTGAAGCTTTGAAGTTCATTAGTAGCAGGCAGATTTTGG
GGGGTAATCTGCCTCGAGATCAGCCACAAGAGTCAAAAAAGTTGATATTGATTGGGCAGC
CTTTGGAGCTTTCCTTTTTAATAGCCCCTTTGTCCACCCGCCTGTCCCATCCCTTATCTG
CTCTTCCACTTTACACAATTGCAAATTGAAAGGTTTTTCTTGGCATGTCAAGCCTTATTG
AGGTGAAAACATTGGCAGTAGGATACTGGGATGGGATCTCTACCTGCACATACAAGGAAA
TAGAAACATTACTGTGGGCCAGGACTGCTCCTTGAATAGAAGGCATGCTTTATTAGAAAG
CAAAACACAGGAAGGAGGTTATGGGGAAAGGTAGAAGGGATGAATTCTTGGTTTGGTGGT
CTTTAGGGACAGAAGAGGGGGAAACATCTTGTTTGATAATATGGTGTGAAAAGCTCTTGG
GCTTGGTACCTGGAGAAGCTTCTGGGCTGTATTTCAGCTTCTCCTTAGGTCTTCTGTCTG
CTGTGCTAACATGTCACTTTCATTTTAGGTGATGCTCGAGGATGGGCGAAGTAAAGGCTT
TGGCTTTGTCTGCTTCTCTTCGCCTGATGAGGCAACCAAAGCAGTAACAGAAATGAATGG
GCGCATTGTGGGCTCAAAGCCCTTGTATGTTGCACTTGCACAGAGGAAAGAAGAAAGGAA
AGCTCACCTAACCAATCAGTATATGCAGCGTATTGCAGGAATGAGAGCCCTACCTGCCAA
CACTATCATCAATCAGTTTCAGCCAACTCCTGGGGGCTACTTCATGCCAGCAGTGCCCCA
GGTATTTGTAGATCTGTGTTTATATAGCAAGGCACTTTCTGGAGGGTGGGTTGAAAGCCA
AAATAGAGGATCCTATGGGGCTTGGAAAGACCGAAATATGAGCTTTGGCACGTCCTGCCA
GGCTGAACCAAAACGAGGCTTGCCCATCTGCCAATAGGCATATCTTTTCTTCAAAACTGT
CATGATAATAGGGATTTGATACTGGGGGCGGGGGGTGAAATTCCCAAATTCTTGAGGCAC
ATATTTGTATAGGTGTATATAATTCTCTAGGTTATAATTTGAACAAAACAGTGTTTGGCT
ATAATGCTGCTGGTTAATGTTTGACCTGTGAGAATTGGACAGGTGGTCATGCCAGGCTGC
ACAAATGTGGTATGGGAAGAAATTTCAGAAAACATAGCTGTATTTTCCTAGGTATCTATT
AGATTGTATGCTTTAAGAAAAGGTTGGTGCTAATGGAGAGGATTGTCTAATGTAAATGAG
GAATAAACACATTCAGTGAAAGGTTGATTTGTTTGTTTTTGTTTTTAATCAGGCTCAGAA
TAGACCTCCTTATTATGCTCCCAATCAGATAGCCCAGATGAGACCCAATCCCCGATGGCA
ACAAGGTGGAAGACCTCAAGGTAAGTTGAGAGATTGACTGAAATCTAGTCCTGAGGGAGT
AAAGAAGGCAATTTTTATCCTAATGTTTTCAGGAACACTCAAGTATTAACCCAAATGGTA
TTTATGATGGTTGATAGTCCATTTGGACCCCAGAGAGATACTGTATTATCCCAGCTGGGT
TATTTCTCAGGTATAATGGGACAAATATATTTTTAGTTTGTCATCCTTCCTTCCGTATCC
CCCAAGTTTGTAAATTTCATATGCCATGGATTAAGCCATTTAACCACTAAACCTGGGCCT
TTTTCCTTTTGTTTATTCATCAATTTAGATTCTACCTGTAAGTTTCTGTTCACAAAGGTC
ATAAAGTAAAGGTACATTAATTAAAGATTTAAAGTGAAAGAAGTCATGTAAACATATCTT
TAGATTAATGAGTATTAAGTTGTATACCAAGAGGCATAGTTAAGATTTGGGGGGGAAAAC
CAGAAGGACTTAAAGACTTTACCCCAATTACATGTAAAATGTTCAGTTTTTTTGAAATTG
ACTATTTTTTTCCATGATTCTTTTTGCCTTATATATTTCCCCAGTATCCAACACAGCTTC
AATATTTTATTTTATTTTATTTGGAATTTGTTTTGATCCATATTTGCACTTTTCCCATTA
GGCTTTCAAGGAGTACCAAACACCATTCGTCAGTCTGGGCCACGCCCTGCTCTTCGACAC
CTGACTCCAGCCAGTAATACCCAGGCTTCTCGAGGGCTCCCTACTACTCCTCAGAGAGTG
GGTGAGTCATCAAATGTGGGGTCATGATGTTCATGGAAGATAAAGGTCCTAGGTTCATTA
TCTGGTCAGAGAAGGCATCAACTGCTCCTCCCCAATTTTGTATCAAGGTCCAAATGCCCT
GATCTCAATCCTAGCCTTCTTACCACTGTCCTTGTCACATAGGCCCTGCCAAGGAAGACT
TGTTTTCTTTTTCTAAAACAAATTTAATAATGTGCTTTAATCTGCATTCAGATTGCATTA
TGTATAATGTAATGTCCTTTTGATTCTGCTCACTTCACTCTGCATCAGTTCATATAAATC
AGGTTTTTCTGAAGCTATCCCCTTCATTATAGCACAATAGTATTCCATCCCAATCATACT
ACAATAGTTTCGGCTATTCCCCCAATTGATGGGTATCTCCCATCTACTTTATGACAATAG
TTATAAAGTAATATTGTGGTCTCCTAGTTTAAAATGTTACAGCTTAAGTCAAAATGACTT
TTAGCAGCCTCATTTACAAAGAGGTGGAAAAGTATAGCCAACACAGAAGGCAGGGATCTC
CAGAACTAATCTCTCTAATGCCAGGAAGGGAATGAATGCTAGGCCATGTTGGTCTCTTTT
TATACCCTTTTTTCCCTCATCACTTCCCATCACTCCTCCTTAACAGAATCCAATGGTAGT
CTCATTTTGCCTAGCACTGCCCCCAGTGGGGGCAGGAGGTGGGGAAGACATTGGCCTTTG
GAGTTGTCACTTAAGTAATTGACTTGTGAACTGTCATACTGGTTTGATTAGCTAAAAATA
GGATTGATTCCCCCTTGTCTATCTTCACACCTTCCATTTCTAATTCTATATTCTACAAAT
ACTTTTTGATAAATTGGACTTTTTTCTCTTTAGAATTCAGACCAAGGAAAGGTATTGCTG
AGTTAAGGGTATTCTGTTTTATGAGTTTTTTTTCTTTGTTTTTAAACCCTTTGTCTTTTC
AATTCTAAAACTGGATTGGGCAAGGACTAGGCAAATGGATTAGTTGATTTGCCCAGGTCC
TCCTAACCCCAGGTCTGGCTCTCAATCCCATGGAGTCATCTAGCTATCCCAGAGTGTACA
CTTCTCAAATGATTAAACTCAATTACAACTCCACTAACCAGTGTATCTGTTTTTTCCACA
TGACTATTGATAGCTCTGATTTCTTCTGAAAACTGCCCGTTCATATTCTTTGCTCATTTA
TCAACTAGGGAATAGGTTTTTTTTCTTCCAATAATTTGGTTTAGAAGCCATTATCTGAGA
AATGCCTAGCAGTTTCTTGTTTTCCTTCTAATTTTGGCTGCTTACATTTTGTACAAGGTT
TTAAAAATTGCTTTTAGGTCTTCCCTAAGAAAGGATACTTTGCTCCTGACCTAAATTTCC
TCAATTTTCCTCTCTAAAGGGAATGGAAGTTCATAGCCTTTCCGCCTGGGTCCCTTCTTA
GGTCTAGGGGCTTAAGGCCTATAATTTTCTGTTAATTTTCTTGCTTCTCCAAAACCCTCC
CACCCACCCCCATCCCTTCTCTTCACTGAAGAAGAGATGAAATTCATATACTTCCACGTG
CTTTATAAGACTCAAGACCTACATCAGTTTAGCTGCTCAAAGCCTTGCTTTTTCAGTGTT
CAGTATTGAGCTGGGGTCTTCTGAAATAGAGCTAAAAATAGGTATGTATGGCTGAATAAA
TTCATACCCAAAGTAATTGACTCATAAGAAGTCTAGTTAAGTTTTCTTTTATGCTGAGGG
TAATAGATCTTTCTCCATGATACTTACCTGTAATTGAGTTAACAAAAGATTGAGGTGATC
CTCATCATAGGGTAGTTGACAGCTCAGCTACAGGTCTTTATGGTAGTAATTGGAGTTTCT
TGGTTCTTTGCTAAGAGTTTTTCTTGGGTGTTTTCTATTTAGGGGTGCCCACTGCTGTGC
AAAATTTATCTCCTAGACCCTCTGTAGCTACCCCTGCACCTCGAGCCGTCCCTCCTTACA
AATATGCTGCAAATGTCCGAAGCCCCCATCCAGCCATCCAGCCTTTGCAGGTAATGGGGG
AATCTCTGTACTGAAGTTAAGTTGGGCATGAGGGATGAGTTAGCTATTTGATTTCTGCTG
AGTTTTGAAAAGGAATAGAGGTTTAGAGGCCTGACCTGACAGAGGAACTTAAACTTGATG
TCCTTGTACAGGGAGTTTTTCAAGGTTTGGGAGGCATACATAATTGACAATACCTGCTTT
GGTTGCTCCCTGGGTTCATTTGTTGTTTGCAGTTTTCCCGCTACTTTACTGAACCTCTTA
TTCTGACCCGCAGACACCTCAACCAGCAGTCCATGTGCAAGGCCAGGAGCCCTTGACAGC
TTCCATGCTGGCTGCTGCTCCTCCCCAGGAACAGAAACAGATGCTAGGTGAGTGACTTAG
GTGTCCCTTTGGGACCCATCAGCACAACCTGCTCTCTTACAGTGAGGAAGCAAGCCATTG
TAGTAGCCAGGCTGACCCTAAATTTATTTTAATTTCTTTGGTAGGAGAGCGCTTGTTCCC
ATTGATTCAAACCATGCACAATAATTTAGCGGGGAAGATCACAGGTATGCTGCTAGAGAT
AGATAATTCAGAACTGCTGCACATGCTGGAGTCTCCAGAATCCCTCCGTTCAAAGGTAAG
TGCTCAATTCCATGGAAGGAACATTAGTGAAAGGCATGATGAGAAGTAACCTGGTGTAAT
TAATGAAGATCCCTTTGTTTATCAACCCTGTACTCCACTCAATTTTCCCATCTGTAAAGT
TAAGATTTGATAGAAATCCTTAAGACTATGAACATAGGAGTGGAAATAACAGCACCAAGT
AAGTTAACTCCTTAACCCAGGAATCCTAATTGTCCATTTCAGGTGTTAGACCTCCAGGAA
ACAAAACACTCCCCTATACAGTTGGGGCTTTTCCCTCAGGTTAGGAGTAGAATTTGTTCA
TTTTGTATCTTTGAGGTTACAGGAACCTGTGCATAACAGGTGCTGCTGTGAATTAATACT
AAATCTTGGTTGAGACAGCTAGGTGACTCACTGGATTGAGAGGTTCTATGTGACCCCTCA
GCAACTTAGAGGGGTCACTTGGCCCTCATTTCCCAACCTCATTGCTTTCCTGGTTTGGAA
TTCATTATGTTGAATTAATAAGCTCATTCATTATTGAATCTCGTTATCTGGGCCTATTCT
AAGGAACTGCTGAGGTAGATAAATTGTTATTGCTAAAAGTAAAGGGCATTATTTTCCCTC
GCTGTCTTGTACATAGAATACTTAAATATGTTTGTTAAATGAATGAATAATTGATAATGG
TCCAGGTGGAGGAAGCCGTAGCAGTATTACAAGCTCATCACGCCAAGAAGGAAGCTGCTC
AGAAGGTGGCTGTGGTTGCTGCTACCTCTTAGACCAGAAAAACTGGTAAATTGATTTACA
CAATTCACTAACAATTAAAAAGTGCATTGGAATCCTATAGGTCCCCAACTAGAACTCATG
CCAGCATCTTTACCTCCTCTTTCTTTCTGATTCTTGGGTCTTAGCTGAATCTTGTCATGG
GGTGGGGTTAGTTGGGGGGAGTATATGAGCTCTGATAACTTGATTGCTTTGAGGCCTTCA
AAGGGATGATGCCTTACTGTGCAGTAAAATAAGACATTGACTGCATCCTGCTAGGCTGAT
GTGACCCAAGGGTTCATGTTAAGATTTAGGAAATGTTTTGTGACTTCATCTGTGGAGTAA
TTGTTGTATCTAAGTAATGCCCATTTTCTTATCTTTACAGGATACTCTGAAGCTTCACAG
CCCCTTCATAGATGTTCACTGAGCATGTGGAGACTTCTTCACTGTACTACAGACTGGACA
ATAGATGGCAGAAGAAGCTGCTGCCATTCTGTATGTTTTTTCTTTGGGAAAAATCAATTT
GAAAGGTCAATTCTTCAAAAGCCTAAAGCTTTTTTTCAGTGGTCAAATTTCACAGGTTTC
TTGTGTGTAGCCTGGATCCTGTTAACCTTTAATTTAATTTAATTTTTCTCTTCTAAAAAA
GCTTTTCTGACTGTTTTGTTTTGGTTTTATCAGGAATTGGTTTTATTTGAAATATCCAAT
TTACAGAGTCTGGAAAAGTGTTTCTCAATAAAGAAGTAAAACCTTCATAAATTGCCTCTT
TGTTTTTGTCCCCATGTTTCCAGACTCCCCTGAAGTTTATTTTATTTCTTTCAAAAACAA
GTCCAAGTTTTCACTGGAAGGAATCTCAGGAACATGGATAAATCTCAATGGGACAGCTTT
GATATTTGGTTGCCCCTTGTTTGTTCTGGTTTTTCAAGCAGCTTACTATTTCCTAGCTAA
TGAAGAGGCCTGTTTTGAGTTGATGTTAAATTGTCATGTTAAAATATGATCCTGTCACAC
TTTAGCTGTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1242, 4299..4492, 5722..5837, 7111..7250, 7868..7962, 8473..8610, 9163..9261, 11788..12060, 12592..12679, 13321..13440, 14099..14173, 15342..15469, 15733..15826, 15944..16074, 16745..16831
1050..1242, 4299..4492, 5722..5837, 7111..7250, 7868..7962, 8473..8610, 9163..9261, 11788..12060, 12592..12679, 13321..13440, 14099..14173, 15342..15469, 15733..15826, 15944..16074, 16745..16828
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved