Monodelphis_domestica Locus ENSMODG00000023391
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000023391
Monodelphis_domestica
ENSMODG00000023391
4
SNORD32, SNORD35, SNORD35
4006..4086, 4334..4423, 5451..5536
6698
AATGTACCAGTGGAATGGAAAGGGTATGAAATGTCAAACCGCTGCATATTTCATTAGAG
AAATGATATGGAGGCATTCAGGCTTGGACAGGCTATAATCCCTTCTCTGCCTCTTTCCCT
CCTAGTTTTTTTAAGTGAATCTCCTGTCATGTGTTTATTTCTCCATGGCAATATCTATAC
TGCTTCTCTGTTATTTTTTTGTTGCCATCGCTCATCTTGCTGACCAGAGTTCACGGACTT
CCCTTTCTGCCCATTTGGTCACTTTCCCTCTGGCCTCACCCACAGAGCTTCAAGGGTTTG
AGAAATTCCCCAGTCCAACCTCCTTCCTTTCCAGGAAGAGGACAGAGCCTGGGATAGGGC
TGGAAACAGGGACTGCAGAGGCTAGAACTCAGACCTCTCAGACTCCCAGCTGATTCAACC
CTAAGGAAGGACCCAGGCATCCCCTGCTTCCTGCAGCTCAACTCAGAGCCACCAGAGGGC
TCCCCCCCTGGATTCCCAAACTTTCTCCCCCAAATCATCTTTCACTTTCGATCTCTGATG
TTTGGGCCCAGACCTGCCCTGGGCCTTCCCAGCCTGGACAGGATGCCTGGTACGGGGCTG
GGACAGCATGTCTGCGTCTCAGAGGGACTGGGGGAGGGGACACCTAGGCCCCCAAGAGGA
GGTGCCTGGGTTCTTGATTGGGCTAAGATAGGGAGGGCTTGCCTAGATCTCCATTAGGGC
TGGGGGATGCTTGGATACCTGAGGAGGGAGGTGGGGGAGGGAATGCCTGGCTCTCCAAGG
GGGTTGAGAAAGGGGGTTGCCAAGGGAACTGAGGCATGGGATGCCTTCCTGGAAGCTTAG
GCATAATTCGCAGTAATGAGGTAGGGGCAGGAAGCAGGGCGGGGGAGGAAACTTAGCCAC
ATGAAGGGGCTGGGGGAGGGCACCCGGACGCCTGGGTCCCTGGCTGAGCCGGCTCTGTCC
CCCCCAGGGCCCGGCAGCGGCATGAGGGGCCCCAATTCAAGATGACCAGCCCAGCCCCAG
CCTGGCCCCTCACTGTGCGTATTCCCAACAGATGGAGATGGCTGTGGGAGGTGGGGACAA
GAGCAATGGGAGAAGCATCAGCAGCCCTGAGGAGGATGGGAGACAGGGCCAGGCGGGCAG
GGATGAGAGGAGGATGCACACTGCCGGAGAGGGAAAGGGAACACACAGGGATGGGAGAGC
GCAGAAGGGGGACAGATGTGGGCGCTGAGGAGGCTCCGGATGCTGTCTCCCAACGCCCCA
GGCCTCCACGCTGCTGCTCCTCCTGCTCCTGCTGCCCCGGGACCCCAGCAGGGCCGCTGA
GCCTCCGAGCTGCACCTTCCCTGACAGCCCCATCAGCTCCACGTTCCTCCAGGCCATCGG
CAGACTGGTGAGAGCCAGACCCCGCAGGGCCCGCCCCTGCAGCCTCTGTGTGCCTCTGCC
TCCCAGGCTCCTGAAAGCTTGCTTTCTCTCCCTCCAGTCTGACTACTTGCTCACGGATTA
CCCTGTGGAAGTCCCTGATAACCTCCAGGTGGTGAGTCTGGTGGGAGAAGGGGAGAGAGT
TGGGGGGTGACCCGGCCAGCCCCAGGGCCCCCGGGCTTCTCGGCCCTCCCTCAAGAGCAC
CGGTCCCCAGGATGAGCGCTGCCGGGCCCTGTGGCACCTGTTTTTGGCCAAGAAGACTCT
CGACCGCCTGGAGCTGGTGGCCGGGAAGGAGCTGAAGAAACTCCTGGACAAAGTGTGCAC
TGAGATCAGCTTTGTCAGGAAATGCTTCTCCGAGGTCAGTCCCTCGCCAGGGACTCCGGC
CTCCGCCTCAGGCTCTTTGGGCCCGGGCCCTGGCCTTCCCTAGTGACCGTGGGTGGCTGA
AGGGGCTGGGCGGCCTCAGAGGCATGAGGAAGCTGCCCTGGGAAGGGGGGTCCGTATGGC
ATGTGACCCCCACCCCTCTGTCCGCGGCTCCCCAGGCCCTTCCTGGCTGCCTCCACTTCC
GCAAGGCCAACATCTCTCACCTCCTCCTGGATATCTCCAGCCACCTGGAGGCCCTGCAGC
CCCTCATCAGCAGCCAGGACTTTGGGCCCTGCCGGCGGCTCCGCTGCCAGCCAGGTGAGG
TGCCCAGCCAGTTGGCCGGCCTGAGACTCCCACAGGGGAGTAGGGGGCTCCCTGGGGCCC
CTTCCAGCCCCTCACCAGCATCCCTGCCTGCCTCCCCACAGAGCCCTCCACCGAGTCCAC
ACCGCCCTCCCCTGGAGGTCTCGGGGCCCTGGGAAACACTCCAGCCCCCCTCAAACACTC
CACCTTCCTTCTGCTGGCCCTGGGGGGGCTGTCAATCCTGCTGCTCCTAATCCTGGGGGC
TGCCTGGAGGTGGAAGCAAAGGAAGAGGCAACAGAGGCCCACAGGATCCCCCATGTCCCC
CGTACCCCAGGTGAGCTTGGCTCTGCTCAGTGGGGGGAGGAAGGTTGGTGCCCCCAGTGG
AGGCAAACAGCAGCTGACCCGTGCTGGGGGGTCGTGGCTAGAGCCCCCCAGACTCTGTCC
CCCAGGAAAGGCAGCTGATGGTGCTTTGAAAGAAGATGTCAGTGTCTGGTGGACCTTGAA
GGCCAAGCCCAGGAGCTGGGGTCACCTGCAGGAAGCCCTCCAAGAGCCCCCCAAGTTCAG
ACCAGCGGCAGTGGCATCTCTTGCAAGCCCCAGTGCCTCTCTTCCCGGGGTTCTGGTGCC
CTTGGCAACAGGCACCCGATGCCCCTTCTCTGTCCTCCAGAACGGGGGAGCTGGCAGTGT
CCCCTGCGCCCCCCAGAGCCAGCCCTGAGGATGTATATAAAACGTTTTCCAATATCTTTC
GTTGGGTGGAATCTGTGGAGGGCACGTGGGGCTGTGGGGGGTGGGTGTGGGTTGGAGGGG
TGGGAGCGGGCGACACACCCCCAGGAAGAAGGGGGGCCAAGGGGAGGGATGTTTGATCTG
GGCAGAAAAGGCCTGGGGCGAGGGGCGGGCCCTGGGGATGGGAGGGGGCCATTTGCCCAG
CCCCGCCCCTGCGTTGTGGCTCCAGGGGAAGAGACTGAGCCTGGGGACAGGTAATGAGCT
CCTAGTCTCGGGAGGGTTTCAACAGAGGCTGCATGGTCAGGCAGGTCCCACGAAAGGTCT
GGAAGTGTCTCCTGCAAAATGGGGACGGGGAAACTGAGGCCCGTGGGGGGAGAGGTAACT
CGTCCACACTCCCGGCCCAGCGCTGGTAACTAGGCTCTGAGCTTGGTGATCGGCCCGTGG
GCGGCATTGAACGCCGGGCTAAAGGGCTGAGCGGGAGGGGCCAGAAAGGGAGCGGGAAGG
CAAAGTCGCAGGCCCGTAGGGATCCCGGACGCGGAGGATAGCAGATCGCCCCTCACAAAG
ATGGCAGGAGCTCGCCCGGAAACAGCCCTTCACCAACTTGTAGGCTTGCAGACCACGTGA
CTGTCCTGGGACCCGCCCCATCAGAGGCCCAAGAGTCGGCCTAGGCTGAAGCGTCTGCCT
TTGCGCCTGCGCCAAAGTCCAGCGCCTCACAGTCTCTTCGCAAGTGCCGAAGCCTGTGAG
GGGAGGGGCGAGGGGTTTCTCCACCTATAGGGAGCCTCGGCGGCTTTACGTCAGTTCCGG
CGCCCCTGCGAGGTGGATAAGGAGGCCCCGACTGGGAGCGCGTCCTTCTTTTCCCGGGCG
GCGGCGGCCATGGCAGACGGTCAGGTTAGTGCTCCAACCTCGCGGCGGGCCCTTGCTCGT
CCGGGGCCTCGGCTAGCAGCAATGTGGCTCCGCACGGCTGTGTTCGGGCTTGCCGGCAAT
GAGGAGCAGCGGGGTTTGGGCTGAGGGAGCCAGAGAGAGGCTCCCGAGGTCTCGGGGCCG
GGTCACGTGGCCCGGGGTCTCGGGCCGGTCTTGAAATCCCGTGTCTCTGCTGGGCTTCAG
GTGCTGGTGATCGACGGGCGGGGCCATCTGCTGGGCCGCTTGGCGGCCATCGTGGCCAAG
CAAGTTCTCTTGGGTAAGTGCACGTGGGCTCGGTAAGGGGGCTGCCGGGCCGGTGACGAG
GAATCTTCACCATCTTTCGTTCGAGTCTCGCGACTATGAGACCAAACCATGCACCGCTCT
GAGGCCCGGTGTGGCCCCCGCTGGGGACCCAATCTCTCATCTCCCTTCCCTTCCCGTTCC
TCTCCGCTGACCCCTACCCTTTACCCCCTCCAGGCCGGAAGGTGGTGGTGGTCCGCTGCG
AGGGCATCAACATTTCTGGCAATTTTTACAGAAATAAACGTGAGTTTGTGCGAATTTTTC
CGTTAGCAACTTGGGGGGGAGGCGTGAACAGGAGCGCAGCGCAGGGCCCGCAAGGGGTTA
GTGCTGGGGCAGGCGGCATGTGATGGCTTTTCTCACGATGGTCTTCAGAGGCTCCCCCTT
GGGGTCACTGCTGATCTGCCTCAGGGCTTAGCTGATGCCGATGTCAACTAGGGCCGAAGG
GGGGGTGGGTAGAGTACTAATCCAGGGCCCCTGAGACGCCTTTCTTGTCTTTCAGTGAAG
TACCTGGCCTTCCTCCGGAAGCGAATGAACACTAACCCATCTCGAGGTCCCTACCACTTC
AGAGCTCCCAGCCGCATTTTCTGGAGGACTGTGAGAGGTGAGGACTCATTCCCCCCCAAT
CTGGGAACCTAGGGCCTGAGACTGTGATGATAATGCTTACCAAAGCACGTTCGAGTTTGG
CGACCATGAGATGAAAAGCTCCATGCACCTCCATCTGAGCTCTCAGGCAGGTTCTAAGCT
GGGCCTGAAACAGGGTAGGCTTGTCTTTGAATGTGATTTCTTATTTTAGGGATGCTTCCC
CACAAGACCAAGCGAGGCCAGGCCGCCCTGGAGCGCCTCAAGGTGTTCGATGGCATCCCT
CCTCCCTATGACAAGGTGAGCCCATCCCGGGGGCCCTTTGCCCTGGCGTCTGTGATGTCT
CCTTTACCTACATTGTTTGACATCTCCCTGAGAAAACATTGTTGCCTGAGACGCTTTCTA
CTAGATCCCTAGAGGGAGATTGCCTGCTGCCCTGACATTCTGTCTCCTTCCTATCTCCCA
GCATCCCCACTGATTGGTTCCTTCTCTATTTTAGCGAAAGCGCATGGTTGTCCCAGCTGC
TCTCAAAGTAGTCAGGCTGAAGCCAACTAGAAAGGTAAGTGCCAATAAGGGACTGGCTTG
GGTAGGGGGGCTGGGGGCTGTGCTGCGGGTATAAGTCCAAGAAGAAAGGGAACTCCCTTT
CCTAATGGAGTGCTCCTTTCAGAACCCTATTCTTTTGAGGTAAAAGTTTTTAATCTGTTT
CCTCTGTCACAGTTTGCCTATCTGGGGCGCCTAGCTCATGAGGTTGGCTGGAAGTATCAG
GCAGTGACTGCTACATTAGAGGAGAAGAGGAAGGAGAAAGCCAAGATTCACTATAGAAAG
AAGAAGAAGCTCACGGTGAGATCTGGGTCCTGGGGGTGGGGGCCAGCACCTGGCAGATGA
TGTTTGTCATCACGATGGTCTTCGGATGCCTAAGGGTACCTGCCGACAAAGCCACAAGGC
TCAGCTGATGCCAGGAGGAGTGGGAAGAGGGCCCTGGCTCTTCTGCCTGTTTCCCTGAAT
TGCAGTCACAACTTGTGTTCTTTCTCCCACAGAAACTACGCAAGCAAGCAGAGAAGAATG
TGGAAGGCAAAATCCACAAATATACAAAAGTGCTGAAGAAGCACGGGCTGCTGGTGTGAG
TCCAATAAAGTCTATGCTCTCCTGGCCACTGGACTCCTGGGTCCTCCTTCTGTCTCCTCG
GCCAGTGTTTCCCTCAAGTGGGCCCAGGGAGCCCTCTGGGAGCCCCTCCAGAAATGGCAG
GGCCTGGGAAGGACTTTTAAATGCTATGGGCGTGTCCTTCACTAAGCTTGGAGGTGGGTT
TCCTGCCTCTGAGGAGTGGCTTCCCCTCCTGGGATAAAGTAGACCATTGGGAAGGCGGTA
GAGAGGGGCTAGACTATAGATGGGTCTATAGCTCCAATTTGTGATGAGAGACCCTGGGAT
TTTGGAAAGGGACTTTGGAGGTGGAAGGGAGGGAAGATCCCCATCCTTCTCGGTCTCCAA
AAAACCTTTGAGGACAGTTTGTTTTATGGTGCTGCTTTGTACCTACAGCCTAGGTGCTTA
ATAAATAAAACGTTGAATCTTCTAAAGCATACTTTGGTTAAAAAGGCCCAGTGTTGCCCG
TTTCCTCCTCATGGGTCTTCAAAAGCCCTAGTTCACTGTAAATTCCTTATCAGACTTGGT
TTCCACAAAATCTGCTGCCTGATCTCTGGAATCCTCATCCTCCCCTTTCTGGCCCCAGAG
TGTCCCTGCTCATTTGCCCACTCCTGGAAGCTGGCTCATGGTGCTCTGGCCTTCTCTTAG
CTGCCTTCCCAGGCTGACCCTTTAACAAGGCCCACCCTGCCCTTCCTACTGGCACCATGT
GAGCCCCTTCCCTGGTGCTATCCCAGCTGTAGGGTACAAACATGAAGCACTCCCTTAGTC
TGCCTTCAAAAGGGAAGGAAAACAAGTACTTGGGAAGCCACTGGCAAGTGGAATTGGGAA
GGTAGTCTTCCCTTTAAAGAACCCAGCAGGTCCGTGTCATTTTATTCTGGAAGTAGGGAG
TCCAGAGAGATGGTCAGAGGGCAGAAAGGTGGCCAACCAGGAGTCTAGAGTTGGTTCGGG
CTGAGGGTTCCATAGATATTTAAGGGGAAGGACCTCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 1261..1386, 1477..1527, 1630..1773, 1955..2093, 2201..2348, 3813..3855, 3900..3972, 4173..4238, 4495..4596, 4789..4874, 5074..5133, 5292..5414, 5612..5698
1001..1033, 1261..1386, 1477..1527, 1630..1773, 1955..2093, 2201..2348, 3813..3855, 3900..3972, 4173..4238, 4495..4596, 4789..4874, 5074..5133, 5292..5414, 5612..5695
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved