Monodelphis_domestica Locus ENSMODG00000008923
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000008923
Monodelphis_domestica
ENSMODG00000008923
4
SNORA27
4310..4439
7567
AATTTGTAAAGTGAGAGGATTGAAGATCGCAAAGATCCTTTCCATCTCAAAATTCTATG
GTCACGTGTTATCTTGCATACATTAAAGGCTACAAATTCCATCTATTTGATATAATTCTT
CCTTACACTGACAGCTGATAAAGTAGAAGAGAAGTGAACTGACATTAGAAGGAATTTGTT
CCTGGCTTTGCCATTAATTACCAGTCTGCCCTTTGGCAGTCCCTCACACTGGGCTCACGT
TTCCTCATTCATAAAATGAAAGGAATAGGTTAGTTCTAAACTTTAAAATAACAATTGTAT
TAGAACATAAAATCTGGAAGGGTTCAGGGTGGGGTGCGCAGTCTGCGAACTTGAAGAAAA
ATAAAAAATGTTTCCTTCATAAACCTATGCGTTTTGTTTTACTTATTTTATGTATTTAAA
CATATTATTCCGAGAAGGGAACTACACGATTCATCAGACTGTCAGGAGGATCTCTGAGAA
CAAAAGAATATAGAATCTCTTCTTTCAAAGCGAAGTTGAGAAAAACTCAATTTGTCCTTC
TACAAGTAAAAGAAAAAAAGAGTTCAGTGACACGTACGCCAATAGATATACGAAAAAAGA
ATCCGCTGCACAGGCGCAGAAACAAATGCAAAGAAAATGGTACAGCGTGTTACTTCTTCC
ACGTGACAACCAAGCCCAGGTCCCGCCAGCTCCAGTTCCGGTTTGGTAAGTGACGCAAGG
AAAAGAAGGCGGGCCCAACTAGGGTTTAGGGGTCTTCTCAGGCCATTCTTGAAGGTCCCC
TCCTAGGCTGTCTAGCCAATATCCAAACATGAATTTTTATTCGCCCACTGCCTCTTACTT
ATTAGGAAAAGGCAACTATCCAGACGGAGCATCTGTGTTTTTTGAGAGGGAAGCTTTACC
TCTTTGTCTGCTTTTTTTGCCCTTTTCGTGACATTGTAGTCAGGCATATTGGCGGGCAGC
CCTCACCGTCCCTAGTAAGGCGCATGCTAAGGCACGCCTTCTTCCTTTCCGCCGGCTCCG
CCATCTTCCAGGTACACTGCGCTCGTGCGGCTCCTGCCTTCTTTTTTTTCTCCTTAGTTT
TGCGGCGTCTTATTTCTTTTCCAGGAAAGTTTATCCGGAGTGGGAAAGAGCATTTCAGGC
AGGTGGGGTGAGCGGGCTTGGGAGAAATGTGCCAAGAGAGGATTTGAGCATTTGGGACTG
GGGGCAGCATGGTGAGAGAAAGCTGCGGCCTGCGGGGCCTAGTGTCTGCTGGAGGGCTAT
AAGGCCGCGGTTTTCTCAGGGGCCGCAGCGTGGGGTGAGGATGGAATGGGTTACGGAGGC
GGCCTTATGCTGCCTACACTGCCACTTGCACGCCTTTTATCAACGTAACCTAGGTTATTT
GCAGAACTAGTGACTGGTACAGTGTTCTAATTGAATTTTTATCCTGGGCTTTGAATATTC
CCTCTCCGATCCTCGGTTTGCTCATTTGTAAAGTGAAATTCTGGTACCTTGTCTCTGTAG
TTGATGCTAATATGAAGATTAGTTAGATCTTATATCAAAGTGCTTGGGAAAATTTATTTT
TCTGTAAAAGAATCATTATGATCTCAATGAATCCTTTGTTTTGGCATTTAAAATTTAAAT
TTGACCTCTTCTTGGGCCTTATTCTCTGCATCTGGTGATCCTGAATTCCTGGCTGTTCCC
ATGAACTAAATACTCCCCATATCTTGGCTCTTAAGCATTTTATTTAGTTACATACCTTGA
ACACTCCTTTGATTAAACTAACGACTTCTTTAGCTTCCTTTTAAGTCCCAACTAAAATCA
CATCTTCCACAAGAAAACCTTCCCCTAACCCCTCTTAATTCAAGTGCCTTCCCTTGTTAT
TTCCTGTTTGTGTTTTATAGACTCATATAGCTTTTTGTGTGTTATCTTATTAGATTGTGA
GCACTTTGAGGGCAAGGACTGCCTTTTGCTTCTTTGTGTCCCAAGCGCTTAGCTCGGCCT
AGCACTTTGTAAATCATAGAATAAATGTCAATGGATTGACTGATGATAGTATGGTTTTGT
AGAATCCTGCCGGTGAAAAGGGGTTTAGGAAGTAAAAATTTCTATAATGGTGAACAACAA
ATGAAAACAGCAACAGTTTGGGGGTGGGCGCTGCTAGGAAAATCACTTTAATTCATATTG
CCTTATAGTTTGAGGACATAATTTTAGGAGTTTATTAGTATTGGTATAGTGTGGAAAGAG
AACCTAGATTCCACTTCATACTTACTACCTGTGAGTTTGAGCAAGTCACCTAATTTCCCT
CGACCTCAGTTTCCTCACCTGTAAAATGAAGTTGGACATGGATTCTGTGATGCCAGATAC
CTCTTAAAGTTTGATCCTGAGTAAGGAAAATTGCAGTAACCAGACAGGGCCTAAATAGGG
CTTAAAAAATTGGTCTTGAATTTTCACTCACAATAATACTTACACATGGCTTTTTAGTGA
TCTCTTTGTAGATGCATGCTTTATTTTAGAGATTTGGTAGTTTAAAAGATGTCATGTAGT
CTTTTTTTCACCTAGTACCAAAGTACTAGGAAGAAAAATTAATGGTACATTGTGACAGTA
ATATATTTAGTAGAGTATGTAAAGTTACTTTTGTTGAACTATTTTCAAGGAATATTAAGC
TAGTAAGATGACCTGAATAGCTTTTACCTGTATATTATTGGTTACTATCTTTGTTTCACA
GATTAGAAAATGAGAATCAGGTTAGTGCAACCAGAGTACTAGAGGAATTCAAACTCATGG
GAACTGATTCCAAGTTTGGTGTTCTTTCTACTACATCACTTTAATAAAGTTGGAATGATT
TTTATTAATGAACTTAAATCATTTAACCTCCATGAATCTTTTTCTCCTCTCTCTCTCTCA
CAAAAAAAAGAAAAACTAAAAAGAAAAATCAGGAAAGGCTTAGAAGAATTAGTGGGTTGA
TTATCGTTTACATAAGACTAATTTATAAAGCTCTTTGCTCATAGTTTTATTGGAAAGAGC
ATTAGCTTATGGGACCTTGGGTAGAGCATTTTCTTATCTGGACTTCCACTTTTAAATAAA
GGATTGGGCTTGATGGCAGATGAGATAGGTAATATAAGTATTCCATTTTTCATATTATAC
AGCTAAAGTTTGGAGAGGTTAAGTGGCACAGCCATGTATACCTGCTTTTAACCCTGGCCT
TCATTCCAAAAGAGACAATTAGTAGAAAATGGTTTCCTTATACTTGATTGTATGTTTGGT
AATATCTGGTGACTGTTTCTGAAATAACATTTTCTTGTGCTTATTTGTTGCAGTGAGTTG
CCAAAATGACAAACACAAAAGGAAAGAGGAGGGGGACACGCTACATGTTTTCTAGACCCT
TTAGAAAACATGGTAAGTATACAATACTGGATTGAAAGTTGATATAGGGACTAATTTATA
CTTAATGCATAAAATATTCTTTTATCATTAAAACTCATTAAAATTAGCTTTCAGGTTACC
TGTTGATCAGTGTCTTGTTTTGAAATTTGAATAATAAAATGGCTAAATTTTACTTGGAAG
AAAAGTAGAAATTGAACATTGGCTTTATTTTAGGAGTGCATTGAACACTAGCACAACTGC
AGCTCCTTTTTTAAAAAAGTTTTCCTTCAATTTTTCTGATTGAGACTAAGTCTTTAGAAG
AGTTGAAATGTTTTCTAATGAGCCTTTTTAACCTGAGGGTATGAAAATATATTTTCACAG
GTGTCGTTCCTTTGGCTACATATATGCGAATATACAAGAAGGGTGATATTGTAGATATTA
AGGTAAGTTGTGAAACTTGATTTGATCAGTAAAGTCTGGTTTCATCTAGTATCTGTTGAA
TAAATGAAGCTTATTTCTACCACCTCCCTTTCACTACTGCCTTAAGAGAGATTTTAGTTG
TGTCTATTATTTGGTTTGTTTAACATTGGAGCTTGATGATGATTGTCTTATATGATTACT
TTTCTAATGAGTAAAATGAAAACAACTTCACCGGCTCTGAAAGCTCATCAGGTTGCCATT
AATAGGTGTAATTCATGCTAAATAAAATATTATTTGAATGGAGATGACCAATTTATTTTA
AGGGATTTATGTTGAAGTATTATGTATTAAGTGTTCTGTGTTTCTTTTTTTCCTCCACTC
TGCCTTCCAGGGTATGGGTACAGTTCAGCAGGGAATGCCCCACAAATGTTACCATGGCAA
GACTGGACGGGTCTATAATGTTACTCAGCATGCTGTAGGCATTGTTGTAAACAAACAGGT
TAAGTAAGTAACTTAGAGTATCTTAAAACTTGGTAATGCTAAGGTTATCTCTCCCCTCTT
TCACTTTACCAATTAGACACATCATGTCTTTATTGGTCATTCAAGTGGGGTAGAAGAAAT
ATCCTTTTAAAACTCAAGCAAACTGGTTGTTTGTCTTGCATCCTGTCAGAGGAAACAATC
TTAAGTTGATTAAAGCTGTATTTTGCTATGTGATTCTTTAATATTCTATTATTTAGTCAT
TTTGGAACTGAACGGCATGTGGTTTCCAAATAGTATATGTTGTGTGATGCTTAATCTCTT
CACCTTTCTGCATAATTGGATTTAATTATTTTATCTTCAAGGCAGGGATCTAGATCAGAG
AATTTCTTAGCCTTTTCAACTCTTAAGTTCTATTACTTAAGATGGTATGAAAGGCAAAGA
ATTATATTCCAGATTTTGGGAGAAGCCATAATGAGCAAAGGGAAGAGGAAATAAAAAAAA
ATAGTTGTATTCAGGAAATAAGAAATGTTTGACTGCAGTCTAGCCTAAGGAGAAGAGAAG
ACAAAATGGAGGGGAATCAGTCAAGCCTAGAAAGTTGGACTTAATTTTGTCAGCACTGGG
AAGCCATTGATCTAAGATAATGACATTTGGCAACAGGGTTAAGGATTGATGAGGAAGAGA
ATGGTGGGAAGAAATAATTAGATGATTGATTAGTTCAAGCAAGAACCCTAAGCTTAAACT
GACTGGGAATGGAATGGGGAGGTGTTGTGATAGGGGCAGAGAGTCTATATTCACATATTT
GTGAAATTATACTACTCTTGAGCTAAACTCATTTTAAGGATTACTTGGATTTCAGACTAT
TATTTGTCTTAAAAACACTAATAATGCTATTACATTTCTCTGAGTTTTACTAAGTTTAAA
TCAAACTGTCAATAATTTTTAACTGATTTCTGTTAAAATAATTTTGGCACTAAATGGGGA
ACTAAGAAGTATTTTATTCTAGGGGCAAGATTCTAGCCAAGAGGATTAATGTGCGTATTG
AGCATATTAAGCACTCTAAGAGCAGAGATAGCTTCCTGAAGCGAGTCAAGGAAAATGATC
AGAAAAAGAAGGAAGCTAAAGAAAAAGGCACCTGGGTTCAGCTGAAACGGCAGGTAATGG
ATACATTTTTAAATGTTGATTTAAAGGAGAAAATGTTGTGGTAAGAATACTCCTGAAACT
ACCATATTATTTCCATGTCAAATTTAGAAGGCAAACTAATCTGAAAGATCCTAATATGCA
ACCTTGGACAAGTCATAGCAGACCTGTTTTTCTATAACATGAAGGAATTTGAACTAGACT
CTAGGATCTCTTCCATATAATATTGTATGAGTGCTTATCACTGGTTGTTCTCTTTGGTAA
CTTTTTCTTGGCAACCATTATCTTTTAATTAATAAAGGTTGTTGCTGTTGTCCAAGTATT
CCAGATTTAAAAATAGTTTCTTAGTGAAAAGGTGGGTTAATTGGCTTATCTGTGTAAGTC
ATGAAGTAGGCAGTCAGTAAATACTTTTCTGGTACATTTAGAGGTGGGAATTTGCATAGA
TTTCTTTTAGTAAAGAAAGGGCCCTTGCTAGTTTGTTTTTGTTTTTTTTTTTTTTTTAAA
GAAAGGCAGTAAATTTGCCTTCTACTTTCCAGTTTCCTGCTTAATTGTGTTGCAGCCAAG
GTATCTCCAGTTACTTCAAGGACATGATACAGATCTTAGCACAATTCAAATACACTAGAT
GAAAGAATTTTGAAATGTGCCCCCAAATTGGGGAGGGGGGGAGAAGAAGCACCAGTTCTG
TAGCAATAAAGATCAAATATGTATTTCAAATTGGTTGGTGGGTCCCTTAAATTTATCCTT
AACTTTCTAAAGAATCTACCTCAGTTTGACTAAATTTTCTAATTAATGAAATATGCAAAT
ATGACATTTGGCTTTGTAGATAGCATGTGGCAGGACCCAAAATGATTGACTTCACCTTAT
TAAGATGACTTTATCTTGATTTAGGTTTTCCCCTAAATGTAATAATTTACAGGTTACATG
AAAATTGATGTGCACAATGATGATCTTCCTAAATGATTGCCTTTCCAAAAGGAACATGAA
TATGTTATTTCACCGGTTCTGAGAGCACATTAAAATATTTTGCTGCAAGATATTCAATAA
GCTTCAATATTGTAATCTTTTTTTAACCTTTTTTTCTTTTTTTCAGCCTGCTCCACCAAG
AGAAGCACACTTTGTGAGAACCAATGGCAAGGAACCTGAGCTGTTGGAACCAATCCCCTA
TGAATTTATGGCATAAATGATTGTTTAAAATAAAAGATTCTTGGATTTTGGCAGTATGTG
GCTTTTATTGTAGCTTTTGGATAGAAGTATTTTAGTGAGTTTTTAAAGTTATGGTTGACA
ATTCATTTGGCACAGGAGTTGATGATGGCATTTTCTTGTCCATTAAAAAATTCTATTTAA
TTTAGAATATTTTCCCTTGGGTTGCATGATTCATGGTTTTTCCCTCCTCCCTCTAATTCC
CAATGACCAATTTAACTGGGTTTTAGGTGTGTCATTGATCAAGTTCTATTTCCATGTTAT
TAAATTTGCATCAGGGTGATCATTTAGAGTCTGTATCCCCAATCATATTCCCAACCAGCC
ATGTGATCAAGGAAATATTTTTCTGTGTTTCTACTCCCACAGTAATTTCTCTGGATGTGG
ATAACTTTCTCACAAGTCCCTCAGAATTGTCCTGGATCATTGCATTGCTGCTAGTAGAGA
AGGCCGTTACATTCGATTGTACCACAGTGTATCAGTCAGTCTGTATATAATGTTTTTCTG
GTTCTGCTCCTTTTGCTGCATCAATCCTGGAGGTCTTTTCAGTTCATCATTCCTTTCAGC
ACAATAGTATTCCATCACCAACAGATAGTTCAGACATTCCCCAGTTGAGAGACGCCCTCA
TTTTCCAATTTTTTTTTGCCACCATAAAGAGCACTGCTATAAATATTTGTACCCATACAG
GCCCAGCAGTGGTATGGCTGGGTCAAAGGGCATTTTCTTTTTAAATAAAGGTTGCAAAAA
ATTAACAGCTAAAGAAAATTTGGTTTTGACTGCACCTAATGATAAGTAGAATAAGCCAGA
GTTACAAATTTTGTCTAAAACCTTTTGGGGAACTTAGATATTTAAAATAGAATCCTTTCA
AAATTCTATTTTTGTGCTAAAACACAAGGTAAAAACTTCTTATACATTTGTAGGAATTTT
CAGTGTGAAATGATTTGATGAAAACTAGAAATCTTGCAAAACCTTTTTTAGACACATTGC
ATACCTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 3293..3371, 3720..3781, 4150..4262, 5242..5392, 6466..6567
3296..3371, 3720..3781, 4150..4262, 5242..5392, 6466..6552
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved