Monodelphis_domestica Locus ENSMODG00000012958
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000012958
Monodelphis_domestica
ENSMODG00000012958
4
SNORD14, SNORD14, SNORD14, SNORD14
2396..2486, 3562..3650, 4380..4476, 4928..5020
6341
AAGGCCTAAAGACTGCTAGTTCTAGGTTTGCTCCGAGCTGTCAGTATTATTTAATAGAC
TTCCTTGCACATTTTAGGGGGAAAACGCTTAATTTCTTGGAAAGCTTACGCATTTAAATT
TGTTGCAATGCATTTTTCTACAAAGATTACGCCGCTTTAGGGGGACATTATGCAGGGGCG
GGTTGGTGTGCCGGGAAATAGGACCGCATTTGCTGTTTTTTTTTAACTAGATTTTTTTTC
CCGTTTACTGCAAAGCGAAATCCGCAATGTCAATCTCGGGCGGGGTGGAGACACGGGGGG
CCAGAAAGGGAAGGAGAAAAAGATAGTCCTCCCATAGAGAATTGCAAGGGGGGGGAGCGG
GAGCGGGGGCGAGTAGCGAGGACGCGCAGGGCCTTCTGGGGCTTACTAGGTCCCTTTCCT
GAGCCTTTGCGGGTGTCACGGGGTCAAGGTGGGGACGTCCTGATGAGATTTTCCGCTTGG
GCCGCGTGGCTTGAGTTAAGGAGCTGGGGCGGGATGCATGCTGGGTAATGTAGTTCGGGT
ATACCACGTGGTTCGGCTTTTTACAGTGGCCTGGCTTTTTTCCATCAGAAATTATCTCTT
GGTAGATGGGAGTAGGCAATTTGGCTCATATCCAGTGGTTGGGGAGTTCTGGAGAAGGGA
CCAAAAATAGCTGAGGCCATTTTGTTCCTTTTTAAAAGGGGGGAAGGTGGGGAGGAGCAC
CCGCCTCTTTTGGCCCAGGCCACGTGCACAACCAGATCCTCTGGCATTTAGCTTTTGCCT
TTGCGGGGGAGGGGTAGCGGCTGCTCCCTCTGAAATATATAGCGTTATCGTTTATTTTAG
GAAGTTGAATATACCTCGTTTAAGAAAAAAATTTTAATGTAATTTAGCAAGGCTTTTTTT
ACTGTTAAAGTGTTCTTCAAGGCAGCTTAAGGTTTAAAGGAGCTTGAAAAATAAGGTTGC
TGATGTATTACTGATGTCAAACCTATCTCTTTGCAGCAAACATGTCGAAGGGACCCGCAG
TTGGCATTGATCTTGGCACCACTTACTCCTGTGTAGGAGTCTTCCAACATGGGAAAGTGG
AGATCATTGCTAATGACCAAGGAAACAGGACCACCCCCAGCTACGTCGCCTTCACCGATA
CAGAACGTTTAATCGGTGATGCTGCAAAGAATCAAGTTGCAATGAACCCCACCAACACAG
TCTTTGGTAAGAACTCAACCTCAGCAATTGAAAGGTTTATTTTTCAGTAGTAAATTGTGA
AACCTTTGAATAAATTTACCAGGCTTCCAGAAGATTCCAAACCCAAGATCCTACTTTGTT
TCCATTCCCATGGCACTTGCTGGACAAAAATCCCAAATACTTATTTAAGGATGTATACTT
AAATGTTTTTAAATTTCTGTTAGGGTATATATGTACTGGTTACAAAAGGAAAATGCTTAC
TTTTTAAAGACTTAACATTTGGCAGTATAGCATTCCTTAACAGAAATTATGGTAGATGAT
GAAGTACATGGAATGGAGATTAATCTTGCCTTGGGGGGAGATCTGGGTAGCTCTGGATTA
AAAGCTAGGCCTAGAGATTCCTGGTTCAAATCTGGCCTCAGACCGCTTCCCATTTACTGT
GACCCTGGGCAAGTCACTTGACCCCATTTCCTAGCTCTTATTGCTCTTCTGCCTTGGAAC
CAATACACAGTATTGATTCCAAGATGGAAGGTAAGGGTTTGAAAAAATATGTATATACCT
TGTTTAAAAATTAAGTGGAATTAATTGGCACTATTAACTAGGATGACAAATAAGTGTTAT
ATAATGAAACAACAGGAAGGCAGGAATTGTTTGTTTTTTGTATTAAGTGCCTAGCACAAT
TTCTGGCACACTGTAAGTGGCTAATGAATAGAATATACATAATAGACCATTGAAAATTGT
TTTTCATCTTTAGCTAGTTACAAGTTAGGTTGGGATGTTTGCTTAGGATATAATTTTAAA
ACGTAGGCCTGATAATGAACCTTTTGTTTTCAGATGCCAAACGTCTGATTGGTCGCAGAT
TTGATGATGCAGTTGTACAGTCAGACATGAAGCATTGGCCTTTTACGGTGGTGAATGACG
CAGGCAGGCCTAAGGTCCAAGTGGAGTACAAAGGGGAGACCAAAAGTTTCTATCCAGAAG
AAGTATCATCTATGGTCTTGACCAAGATGAAAGAAATTGCTGAAGCTTATCTTGGGAAGG
TAAGGCTTAAAAAACAGTGGGTTTTTTTTTTTACACAATTTATCAGTGGTCAACATTTCT
AAAGCAATCAGGACTAAATTGTATTTGGGGATAGTGTTTGCAGTCTCAAATTGCATAAGT
AGCAGGCTTTTCCTTTTAATTGGCCATTCAATGTTACCTGTCATGAGTAGGTTGGCTTGC
TGTGATGATATTGGTACCAAAACCATTCGTAGTTTCCACCAGAAGCTTGCTAATGATGGC
AAGAACCTTCCTTGGATGTCTGAGCGAGCTTAATTTGTAAGACTTTACTGGTAGTATTTT
TAAGTGGCCATTTTACACATTTCAGGTGGAAAATGCCCTGAATTATCCGCAATTTTTTTC
AATGAGAAATCGAGTTGGCTTATTCAATAATTGGCAGCCATAATTGAACCTGAAATCCTA
ATTAACTCAGTAGTAGCTTAGAGTAAATATAATGGCATAAATATTCTAATAAATGACTTT
GTTTGCCCTAGACTGTCACAAATGCTGTTGTCACAGTACCAGCCTACTTCAACGATTCCC
AACGACAGGCTACCAAAGACGCCGGAACCATTGCTGGTCTCAATGTGCTCCGAATCATCA
ATGAGCCAACTGCTGCTGCTATTGCTTATGGCTTGGACAAAAAAGTAGGTGTAACTGAAA
AACTTTAGTTTCTAATGTATATTTCTCCAATCCTTCCCCATCCCAATAACAAATGTCTTT
GGATTAACAGGTTGGTGCCGAGAGAAATGTGTTGATCTTTGACCTTGGAGGTGGTACCTT
TGATGTCTCCATCCTTACCATTGAAGATGGTATCTTTGAAGTCAAGTCCACAGCTGGGGA
CACCCACTTGGGTGGTGAGGACTTTGACAACCGCATGGTCAACCATTTCATTGCTGAGTT
CAAGCGAAAGCACAAGAAGGACATCAGTGAGAACAAGAGGGCTGTCCGCCGTCTGCGCAC
TGCTTGTGAACGTGCAAAGAGAACCCTCTCTTCCAGTACACAGGCTAGTATTGAGATCGA
TTCCCTCTATGAAGGTATCGACTTCTATACCTCTATTACCCGGGCCCGTTTTGAAGAGCT
GAATGCTGACCTCTTCCGTGGCACACTGGACCCCGTGGAAAAGGCCCTCAGAGATGCCAA
GCTAGACAAATCACAGATTCATGACATCGTCTTGGTGGGTGGTTCTACTCGAATCCCCAA
AATCCAGAAGCTTCTGCAGGACTTCTTCAATGGCAAGGAGCTCAACAAGAGTATCAATCC
TGATGAGGCTGTTGCCTATGGTGCAGGTAATTTTAATTTTAAAAATACTAGTTTTCCATA
ATGAATACATTTTAAAAATCATTTGCTGTGATGAATGTTCCAAAACCATTCGTAGTTTCC
ACCGGAAGCTTGCTGATGATGGCCAAGTACCTTCCTTGGATGTCTGAGCGAAAGACTTCT
TGGGAATGCTTCTAAGTTATTATTGCCTTTTCCTTACTGAACCTCTTTTTCTTCATAGCT
GTCCAGGCTGCCATCTTGTCTGGAGATAAATCTGAGAATGTGCAGGACTTGCTGCTGCTA
GATGTCACTCCTCTTTCCCTTGGAATTGAAACTGCTGGAGGAGTCATGACAGTTCTGATC
AAACGCAATACCACCATTCCCACAAAACAGACTCAGACCTTTACTACCTACTCTGACAAT
CAGCCTGGTGTGCTTATTCAGGTATGTACACGTGCAGATCCATGCCACTTGTACTATTGC
CAGAAATGGTGGGCTTTATAGTAGATGATAAGCTGATCAATACTAAACCTGGTTAACTCT
TTCTTAAAAGGTTTATGAAGGTGAGAGAGCAATGACAAAGGATAACAACTTACTTGGCAA
GTTTGAGCTCACAGGAATCCCTCCTGCCCCAAGGGGTGTCCCTCAGATTGAAGTTACATT
TGACATTGATGCTAATGGCATCCTCAATGTGTCTGCTGTGGATAAGAGCACAGGCAAGGA
GAACAAGATCACCATCACCAATGACAAAGGTAAGGAAAAGTACCAATGGGGGGGGGGTGT
CTTGAGTGGCAAATCTGAAATAAGGGATATTCAGTTTGTAGTATAACACCCCTAGAACAA
GCCTTGGTGTAAGTTATGACTAAAGCATCCTGTGTGGTAAAGGAAAAGCAAAAGCAGTGG
CTGCTATGATGAAAGTGATGCAAAACCATTCGTAGTTTCCACTAGAAGTTGAAAAACTAA
TGTTGGCATTAAGTTCCTTCCTTGGCTGTCTGAGCGACCACTGCTTTTCTTTCCCAATCT
ATTTGTAAGTGGTAAAATTAAGTGGAAAGAGGAAGTTCAACATCTTTGTTCCTTTTTTCT
TTACAGGTCGTCTGAGCAAAGAAGACATTGAGCGCATGGTCCAGGAGGCTGAAAAGTACA
AGGCTGAAGATGAGAAGCAGAGAGATAAGGTGTCTTCCAAGAATTCTCTTGAGTCTTACG
CTTTCAACATGAAGGCAACTGTTGAGGATGAGAAACTGCAAGGCAAGATTGGTGATGAAG
ACAAACAGAAGATCCTTGACAAATGCAATGAAATAATCAACTGGCTGGATAAGAACCAGG
TATGTACTCAATTGTGCAGTTTTTTAAACTTAGGTTAGTGTTCCTTGGGTATTTCAATAG
CATTACAACAAGAGTTTAAATGAACAAGACTAAAAAAGGCTTCCCAATTTTGCCTTAAAA
TGAAATGGTTGCTGTGATGAAAGTGTTCCCAAAACCATTCGTAGTTTCCACCAGAAGTCT
TGACTTGTGTTGGCAAGATCCTTCCTTGGATGTCTGAGCGACCATGTCCTAAAATGTCCT
TGATAGGTGACTAGTCTCCTATCAAGTTTAAGTGATTACTTTTTAAGCTCAACATCCCTT
AAAACTTTCATGTCTTATTCTGAATCTGCTTTCTGAAATGGGTTCATCTTTTCCAGACTG
CTGAAAAGGAAGAATTTGAGCATCAGCAGAAAGAATTGGAAAAAGTCTGCAACCCCATCA
TCACCAAGCTGTACCAGAGTGCAGGAGGCATGCCGGGAGGCATGCCTGGTGGGTTCCCAG
GAGGTGGAGCAGCCCCATCTGGAGGTGCCTCTTCTGGACCTACCATTGAAGAGGTCGACT
AAATGTGCCAGAAGAAAAAGCATTCCACACAGCTTTCCAAAAATTGAAGGACTCAAATTT
GTAGCCAAGGCAGTAGCAGTTTAAAGTTAACATTAGGCTACTGTGTAAATCTGGGCATTC
TGAATACTTGAATGTGTGCAGAGGGAGAAGTGAACAACATTGCACTTTATCAGTACTGTA
TAAAAACAAGTGGAAATGCAATTCTTGTCCTGGAGAATAAATATTTAAAATTGGCACCAT
ATACAAAGGAGTGTCGTGGTTTTCTCTAAGAAAGGGTGATTACTCTAAGGAGTAAAATAA
GTACAAATCTAATCTAGGTGGAGGGAGGTTTGGATTGGGGTTCAGAATGAATGACTTGAT
GTGTGTATTAGGGGCCCTGGTTAAATTTAAGCCAAGGACACAGGTGTTGCCCAAGTATGA
CCTAACTCTTACACAAAGTTTAAATAAGGTTGTAATGCAAAGTTTATACAAATGACTTTT
GTGTCAGATGAGTGTAATGGTAAAAATAGAAAACTGCACACAGGAACCCCAACTAGAGCA
TAAGACTTGGCTTAATCCTAGAAACCTGTTCATACATGGTTCTTGGGTTATGCTGAATTG
AATCCTCAAGAGTGGTACCAGGGTATACTGAGAGCTCATAGTCAAGGGAAAAAATCCCAT
TAGAAATTAGGATTTTCTCACTGCCAAGTATTCTCTTGGGAAGCATGTAAAAACCAAAAA
CTTTTGGGGTGCCTTTGCCCCATAAGGGTGCAATGCCATAGCAAGATTCCTTTAGTGTTA
GGGAAGAGTAGCTGGAGTGAGGTTTCCCAGAGAAACTGCTCCAGGATATACTTATCTGTA
GGTGGATTCTGGACCACTAATATAACCTAGATTTAGGCAATTTTATGAACTAATTTTTTC
TAGACCTAGCTTATTTTAAAATGGACCCCAGTGAGTTCAGTAAAACCTATGGATCCCTTG
GATACTTCACATGACAAAATTGGTTGTCCAAATGTTAACAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1205, 2013..2218, 2711..2863, 2950..3505, 3718..3920, 4030..4228, 4566..4798, 5156..5341
1001..1205, 2013..2218, 2711..2863, 2950..3505, 3718..3920, 4030..4228, 4566..4798, 5156..5338
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved