Monodelphis_domestica Locus ENSMODG00000000750
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000000750
Monodelphis_domestica
ENSMODG00000000750
3
SNORD37
4213..4278
9654
CGTCAGCGTCCTCTTCCGTCGTCGCCGCCGCCATTCTCGGCGCGACTCACCCCAGTCGG
ATCGCGAGCCGGAGAATCCACCGCCATCCGCCACCATGGTGAGGGCCGCCGCCCGCCTTA
GGGATCGAAGCTGCGCTGGGACCCGTGCGGGCCGAGAGGAGCCACTCCTGGGGTGTCAGG
GCTGCAGAGGCGGGCTGGGGGAGCTTGGAGAAAGGAGATGGGGGAGAAGAGGAGGAGGCC
GCCGCCACTGCCTCCGCTGCCGCCATTTCGGGGAGATGCGGCAGCCGGCGGTTCCGGGCG
CGCGCTCCCGCCCAGCCCCCTATTTTCCTGGGTCTCGCGCGGGGTCGCGCGACGCCCCTT
CCTGCCAGCCCTGTCACTTCTCCCAGCCTCGGTCCCCTTGCTTTGGGCGGGCGGGCATTT
CAAGGGGGAGCGTGGTCGGATGGGAGCCGGGTGATGTGGCAGCGGGGGGAGGGGAAGGGG
TCGGGGGTGGGGGTGGGGAGGGAGGTGCCGGTCCCAGGCTCGGCCCCGGCTCCGCGGCGG
CTGCGGGCGGTACTGCAGCGGGGCCGCGCCCGGTGGGGACGAAAGCCCCGGAGCCTGCGA
TAACACCCCCGAGGCTGTTTGCGGGCTTTGGGGGGCCGCTGGCCGCACGGGCCGCCTCCC
GTGGTGGGAATGCCCAGGTCTTCTGGGTGACCTTGGACTTGGGGGAAGAGGAGAATTTGG
GCATTTTAGGAAGAAATGGGGACAGTCTCAGGAAATGGTCTGGGTGAGGACGCGAAAGGG
AGTAAGTATTGCAGGGAATAGAGAAGCCTGAAAGGAAACGGCGGGTCTGGCGAGTTGGCT
GACTGCTAATGGGGCCTCATCCAGTCTTGCCTGCCTGGGCCCGAGAGCAGATGACGTGTA
TCATGCTAACACCATCGATTTCTGAGTTGGCCCTGTTCCTGCCTGTTTCTGGGAAGGAAT
GAGTACCCGACTTCCCCTGATTGTTTCCTCTGGTTTCCTAGGTGAACTTTACAGTAGACC
AGATCCGGGCCATCATGGACAAAAAGGCCAATATCAGAAACATGTCTGTAATAGCTCATG
TGGATCATGGCAAGTCAACCCTGACGGATTCCCTGGTTTGCAAAGCTGGTATTATTGCTT
CAGCCCGTGCTGGTGAGACCAGGTTCACTGACACGAGAAAAGATGAACAGGAACGGTGCA
TCACTATTAAGTCAACGTAAGTCTTCTGTGGTGTCCATGATGATGCCAGGAAAGTTGCCA
TTCTGATGATTCATCTCTTCATTTTTCTTTCATGTGTTGACCTTCACCCATTAGAATGTA
AATCCCTTAAGGACAGAAACCTGCCCTTGGCCCAACTATCAACTCAGTTTATACTGTCTT
AATCACCTTGCCACTGGGGTTTTGAGGCTTTATACAAAGATGTTTGGTGATTGGAATAGG
CAGGTTCAGACTAATATTTTGACCTGGTTGAGGCTTCATCCCTTAGAGAAAGTCTCAAAG
CAGGCTTTTTGGGGGTCCCCGGCAGGGGATCTGAGGTAAAAAACTATTTACTAAGATGCT
TTAATAAGTATCATTAAACATATTCCACAGAGTGTAAAGGAGTCCTGTGACCAAGAAGTT
TGAAAACTTGATAAAAGGATTAATAGTGCTCTTAATGGGAGAGTTAAACCAAAACTACTA
ATCTGTCATTGGGAGGAGAGGGGAAAAAGAAAGTCGTGAATTAAGATCTAAAAATAAGGC
TGAGGCATCAGTTGTCATAAAATACCATCATGGCTAATGATCTGACAATTTAATGTTATA
GTGTCAGAATTTTTGCTTGTCAGTGTGAAGAACTTTTAGAGATGAGTTGAGTTTCTTTTA
AATTCCATTTAAAGAGTTTTAGTGTGACCATGTAAAATTTTATTAAATTTAAATTTGTGA
AGGTCCCTTTGCACTCTGTCTGTAAAACTTAAGTCCAAACTGGATTTCTCATCTAGGGAT
TTTTTTTTCCAGTGCCATTTCCCTCTTTTATGAGCTGTCAGAAAATGATTTGAACTTCAT
CAAGCAGAGCAAAGATGGTTCTGGCTTTCTTATCAACCTCATTGACTCACCTGGGCACGT
TGACTTCTCATCAGAAGTAACAGCTGCACTCCGTGTTACTGATGGTGCCTTGGTTGTGGT
GGATTGTGTATCTGGTAAGCTTGCTTTCAACTCAGTGGGAGCAATTAACTAGAAAGGAAG
GATGTTTAGATTGGGTTGGGGAGAGACTCCGGCCAGTCTACTAAAAACACTTCCCTTTCC
TCAGGTGTATGTGTTCAGACTGAGACTGTACTTCGCCAGGCCATTGCTGAAAGAATCAAG
CCTGTTTTGATGATGAACAAGATGGACCGGGCCTTACTTGAACTCCAGCTGGAGCCTGAG
GAACTGTATCAGACATTTCAGCGAATTGTAGAGAATGTGAATGTCATCATCTCCACCTAT
GGAGAGGGAGAAAGTGGCCCTATGGGAAACATCATGGTGAGTCTGAAGAGATTTCCAATG
TGTGCAGGCCAGTGATTAATCTGATTGAGATGAGTTTTTAGAGTTGACTCATTTCCATGT
GACCTAGCCCTCTAGGGTTTGTTAAAACATCTTAAAAAAAGATTGCCTTTGTCACTTTAT
ATGCCCTAACCAATTATAGTTAAAGCATTCAATTGCTAAACTAATTTTTCAAGTCAACAT
TTTTCTTCTCTAGCATGGAATAATTTTTTTTTTTTGGTGAAGGGTTACTATTGGGGCAAT
TATGAAAGTTCATTATTTGAGATCAATGATCAATCAACCCTTTTTAAGGATTCAAATTGA
GATCTCAGTGGTACAGAATTAGCAAGGAATTACATATTGGAAGTATAATAGAATATGGGA
GAGAATCCTCTTTGGGAGGATAAGAAAGGGAGGTGGGTGTTAGCTATTAGGATTATGGAC
TATGATAATATGCCCCATGTCACTAACTTGCCTTTAATAACTAGTTTGTATATATCCCTT
TCTGAAATGGTAACATGAATGTCTTATGTGATCCATTCATACATGTTAATACTACAATTT
TAGATGAATCTCCTTTTTACTGATTTCAGCATTAGAAGCTCTTTTCATTGTCACGTTAAC
TGAGAAATTTTGTGATTATGAAACTTAAAAAATATTAAGATGACCTGTAAACTTGTATCA
TATTGTAAAATAGAGATAGTGATAATTGTATTATATCTCTCAGTTATTTTAGAAGTCATA
TGAGGGGGGTAGCTGGGTGGGTAGCTCAGTGGATTGAGAGCTAGGCCTAGAGATTAGAGA
TGGGGTTCAAATCTCATACCTCAGATACTTCCTAGCTGTGTGACCAAGTCATTTAACCTC
CATTGCTTATCCTTTATTACTCTTCTGCCTTGGAACCAATACATAGTGTTGATTCTAAGA
AGGAAGGTAAGGGTATTAAAAAAAAGTTAGATTAGCTATTATGTGAATTACCCAAGGCTG
GTCACCTAAATTATAACTGAATCTTAGATCTGCATTTTTGAATAGTGCTATAGGGTTTTT
TTTTTGTTTTCTCTGAAGTTACTGGGCTGAGATTGTTTGATTTAAATGGTATTTGAGTTC
TTTTGGCCAGAAAACCCTTGGAGATAACTACCTGATATATTTTTCTTTAATCTTTCAGAT
TGATCCTGTCCTTGGTACTGTTGGGTTTGGTTCTGGACTTCATGGTTGGGCCTTTACTCT
GAAGCAGTTTGCAGAGATGTATGTGGCAAAATTTGCAGCCAAGGGTGAAGGTCAGCTGGG
ACCAGCTGAAAGGGCCAAGAAAGTAGAGGACATGATGAAAAAACTTTGGGGTGACCGGTG
AGTTGGCTTTGAGACAAAATGTGTCAGTTTTCTAGAAATAGCTCCCTATTTGATCTGTTT
TGCAGATACTTAGTTCCTGTAAGGCTTATTATATAAGTAAGATTATGAGTCCTAGAATAT
TACGTAATTGCTCAGCATCACTTTAAGTTGGAATTGTGTATGCTTTAACTTATCCTTTTT
CTCTAGGTATTTTGATCCTACCAATGGGAAGTTTAGCAAATCTGCTACTAGCCCTGATGG
AAAGAAGTTGCCTAGAACTTTCTGCCAACTCATCTTAGATCCAATCTTCAAGGTAAAGAT
AAAATTAATACTCATTTAGTCTCAATATTTTGAAAACTTGATTGTTGACTGTTAGGTGTG
AGATGTTATTTATGTTCATGATGATGGAATATTTCTTCACTTTGACCTGATGTCTAATGA
AGAAATCTAACCTCTGAGAAGCATTGTAATTGGTAATGTCAAGATAGCCAAATGGGATTT
TTATAAAACAATCCTTAAAATTTTTTTTCTGGGAAAATAAATTATCCCTAGGAATTTAAG
AAAGAATTCTGCTTGCATATCTAAAAATGCAAAAAATGTTTTAAACCATTACAGGGTCTT
CATGTCCTTTATCAGGCATGGACTTTGCCTAAATGTGTGTCCTTTATGATACATCTTATT
TTTTTCTAGTCTCTAGACTTGAAAAAACTTTGACTTAGCAGGTTTTCTTATTTTGGCTAA
GTGAACTGGTTTCTTTGCCTTAGGTATTTGATGCAATTATGACCTTTAAGAAGGAGGAAA
CTGCAAAACTGATTGAAAAACTTGACATCAAATTGGACAGTGAAGATAAAGACAAAGAGG
GAAAACCACTTCTAAAGGTGAGGAGGATGGGACTATGACAACTTTCAACTCAATTTAGGA
GTTTCCTTTTGTTGAAACTGCAACTTGCTTTCTTGGTCTTATTAGGCTGTGATGAGACGT
TGGCTGCCTGCTGGAGATGCACTTCTCCAAATGATAACCATCCACCTGCCTTCCCCTGTA
ACTGCTCAGAAATACCGTTGTGAACTGTTATATGAGGGTCCCCCTGATGATGAGGCTGCT
ATGGGTATGTTTTTTAACCTAGGCACAAGGGAAGATCTTGTGGATCTCTTGGTTCCCCAA
GGCAACATTGCTTGTTCCAACAAGGGTCATCCTGTCTAGGAGTGGTCATTCTAGTGTCTA
GTTCCTGATCAGTGACTCATTTTGTTGGATTAACTGAATATTATTCAGGTATTGTAGATA
CCAGCAGTTCAAATTGTACTGTTGCTTTAAATGATGATGGCTTACAAGTTTTTAAGAAAT
GTTAACCAACAAGATCAATTTCTGAATAGGGGTCAAAATATGATTAGGCTTTCCTGAATT
CATCTCTAGGAAGTTGAGTTTATGGTATTAATTTGATGACTATGCATGAAGCCAGTTATG
CCTCTCATTGCTTTTCAGGTATTAAAAGCTGTGATCCCAAGGGTCCCCTGATGATGTACA
TCTCAAAAATGGTGCCAACCTCTGACAAAGGCAGATTCTATGCTTTTGGCCGTGTATTTT
CTGGTCTTGTTTCCACTGGCCTAAAAGTCAGAATCATGGGACCCAATTATACCCCTGGGA
AGAAGGAAGATCTCTACCTGAAGCCAATTCAAAGGTCAGGAGTTTCTCCTTTCTAGGCTC
TTAAGGAATGAGAAATAGAAATTATGCATTTTTCCAATAGCCCACGATGAGGTTTTTTGA
TAAACTTGCTGGATCCCATATTGTGTTCTAATGTGATTAATCAACTCACTGTAGCTAACA
GAATTTTGACTTGTTCAGTGATGAAATGAGCTAGGATTGGGGCCAGTTTCCTCACTATAG
AGGCTAGGGTTTTATGTTGCTAAATTTTTCTTTGATTTGAATATGAAACAATACCCAGAG
TCATCCTTGTAACTATATTCTAAATTCACTTTAGATTTGTAGCAAAGTATTGACTGCCAT
GGACCAGTAGAAAGATAATTGCTATTTGTCTTAAATAAGTTCTTACTCTCCTCTTCCCTA
GATGAACATTTTGATAATTTCATTTGTATAGTAGCTGAAAGAGATTAGACTAGGAGTTGG
CAAACTGCATTGCTTGTTGGTTTTTACATTTTAAAATATAAAAACCATTCTTTAAAATTT
TTCTTGTTTATTTAATTTACCACAGAATTTTTTTCCATGGTTACATGATTCATACTCTGC
ACCTCCCCCTCCCCCAAGGAACAATTCACTGGGTATAAAAACCATTCTTAATTCACAGTT
TGAACAAATATAGGCAAGCCAACCTCTAGGAGAGATTTAAGATTCACTACTACTAATGGG
CTTTATTATATGATAGTAGTTTTTGACTTGATAATTTTTCCACAGGACAATTCTGATGAT
GGGCCGATATGTTGAACCTATTGAAGATGTGCCTTGTGGTAACATTGTTGGTCTGGTTGG
TGTGGATCAGTTCCTTGTGAAAACGGGTACCATTACTACCTTTGAGCATGCCCACAACAT
GAGGGTGATGAAGTTTAGCGTTAGCCCCGTGGTGCGAGTAGCTGTTGAAGCAAAGAACCC
AGCTGACCTGCCCAAACTTGTGGAAGGATTGAAGCGTTTGGCCAAGTCTGACCCTATGGT
CCAGGTAGGTTCTTTCCAATGTAAATTTGTCTTTATTTGGACTAAAATAATGAAATTTCT
TTCACTGGTCATCTTTACTCAGTTGAGATCTACTTATTTGAATTACCTGAAGGTCAGTTT
TAACTGTTTTAATCCTATTAAAATCTTTTAATTTAATCTTTCTTGTCCTTTAGGATAATA
AAGGAAATATCTATGGTAAAATAGTCCAGCTATTTATTGACCCATTTCTCTTTCCAGTGT
ATCATTGAGGAATCTGGAGAACACATTATTGCTGGTGCAGGGGAGTTGCATCTGGAGATC
TGCCTGAAAGATCTTGAAGAAGATCATGCCTGCATTCCCATCAAGGTAACCCCCTTCCCC
CATGTCTTTCTTTAGTCTTAAAGAAGGGGAGGGAGGGGTAAGATGTATGAATGTCCAACT
TTTATGAATCACATGAACTTAGGACTAGTGGAAAATGATTACTTACCTTCAAATACAGTT
CAGAGAAACTTAATCTTCCAGTGATTTAATCTACCATTAACTTGACATAGCTATCCTTTT
TATAGATGTGGAAATAGTTTGTATATCCTTAAAATGCTTTGTGCTTTTTGTTGGATGAAT
TTGCTTTTGGTTTAACTGACTATTTTTCCTTATGCAGAAATCGGACCCTGTTGTCTCCTA
CCGTGAGACAGTCAGTGAGGAGTCAAATGTTCTCTGCCTTTCCAAATCTCCCAATAAGCA
CAACAGGCTATACATGAAGGCTCGGCCATTCCCTGATGGCCTGGCTGAAGATATTGACAA
AGGTGAAGTCTCAGCTCGCCAGGAGCTCAAACAAAGGGCTCGATATCTGGCTGAGAAGTA
CGAGTGGGATGTGACTGAAGCCCGTAAGATCTGGTGCTTTGGCCCTGATGGAACTGGGCC
CAATGTTCTTACTGATATCACCAAGGGAGTACAGTACCTTAATGAGATCAAGGACAGCGT
AGTGGCTGGATTTCAGTGGGCTACCAAGGAGGTAAGGAGCCTTAAAATGTAGAAGTATTG
CATACTAGTTACTGAGTTATAGTTCTGTTAGAGATGAGGGAAGGGTTCGATGAAAAGTAC
TTATTTGGGGACAACTGAGGCTCTAAAGCAGATAAATTGTTAAATGTATCAAAATGGCCT
GCATGGAAGGTTTGAGTGTACTTTGGTCTTTTCCCTCCAGGGAGCACTGTGTGAGGAGAA
CATGCGGGCAGTCCGTTTTGATGTACATGATGTGACCCTGCATGCTGACGCCATTCACCG
TGGTGGTGGTCAAATCATTCCCACAGCCCGGCGCTGCCTATATGCCTGCGTACTGACTGC
CCAGCCTCGTCTTATGGAACCTATCTATCTTGTGGAGATTCAGGTAAAGAAATTCGTTAC
GTGAAATTTGTTCAGAAGCAAAAAAATGGGATAGGTCGGTCTGACTTTTTTACACACTGT
CATTTTAATAAGTTGACTTCTAAAAAAATTTCATTTAGTGTCCAGAACAAGTGGTTGGTG
GCATTTATGGTGTCCTGAACAGGAAGCGAGGGCATGTGTTTGAGGAGTCCCAGGTTGCTG
GCACCCCTATGTTTGTTGTGAAAGCCTATCTGCCTGTCAATGAATCTTTTGGTAAGTACT
AAATTCTTTTGAGACCTTTTAATAAAGAGGACATACCAATATTAATGACAGCTTCTTTTG
GAAACTTTTAACTTGGCCTTTATTTCTTTTTCCTAATCTTTTGAAATGGAAAATATGACC
CCTTCAGCCAAGAGTGATTGAGAGGATCAGATTAATTTTAATGATCGTAGAAAGTACATA
GTGGTAGACATCGGTTTAAGGGTTGTCATCAACCCAACTGTTTTTGTGGGGTTGAGGGAA
TATTTCTGAATTGCAAGTTGATCATTTTAATGTATAAGTAATGCTAAGTTGGTTGGAACT
TGGGGATTTGTTTCTAAACTCTTCTTATCTTCCCCCCCCCCCCCCCCCCCTTTTCTTTTA
GGGTTTACAGCTGAATTGAGGGCTAATACAGGGGGGCAAGCCTTCCCTCAGTGGGTATTT
GAACATTGGGAGATCCTTCCTGGAGAACCTTTTGACAGTACTAACCGCCCTTGCCAGGTT
GTGGCAGATACCCGCAAACGTAAAGGGCTGAAGGAAGGTATCCCAGCCCTGGACAACTTC
CTGGACAAGTTGTAAAAGCTCTCTCCAACATCAGTTCAAACTCCTGTTGGACTCTAGCAT
AACACCAATGCAGAAAATTGTTAAAACTGCAGTGACATCTCTTTGCATATACTTAATCAG
TTCATAGCAACTTGAGACTTTCAAAACACATTGATATTCAGCCTTATAGGTTTCTGTGTT
GCACATGACACATTTGGGGCCCACTCGGTGCCATAACTTGAAACATTTCCACTTGATGCA
ACTTGAGTTGCCTGTTTCCATATTTATTCAAGACTTCAAAGAGAAAAAAAGTCTCTTTGC
AGGGTATATTTGGCCAGGGGGGTGGGTTGGGGATGAGTACCTCTAACATTTTTTTTCATT
TCTCAAAGGGAAACAATAGTGCCCAAAAAATTGCAAATGAGTGCATTAAGAGGTTTTGCT
TGGGTAAATGGCCTGTAGTGGATCTTCAGGAAAGGGTGAAGGGAAAGTTTAGGAGATATT
TTCTAGTTGGCCAGAAACTAGAAGGCAAGAAAATTTTGTGCAGTGTGATTGTCATCATGA
ACATCTACAGATGTATTAGTGCCATTGGAATAATAAATTTGATATGGTGATGAATATCAA
TAGCAGTGTCAAAGTGATTTATTCTAGGTATGGGGGTCTTTTTTTTTTTACCTCTGGATG
CCATTCCTTTTCTAGAAGTGATTTCTCAGGACATTTACATGGGACTCAGTTAACAAGTGC
TTTCTTTTGTATTTTCAACACTCAAATGAGCAGGGATCTTGGACCATTTAAGCCCAATAG
TTAAGCATATATGGAGAACTTAATAGGTATTGCAAGAATAACTACGTTTAATGCTTGCAA
TTAAATAATTAAAAAGAATTAAAACAAAAATTGTCCATTTCTGACAAGTGTTTAAATGCC
TCATTTAGTTCTTGTGAAATCCAAAATCTTACTCATGAATACTATGGTTGGGCTGTACAT
TCTATTTCCATGACGTGTTCTCATGAAGTCTTTAACAGTATTTGCCTTTCTTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1215, 1992..2173, 2284..2495, 3658..3836, 4026..4131, 4583..4696, 4785..4923, 5298..5493, 6225..6483, 6717..6824, 7117..7470, 7660..7842, 7958..8090, 8461..8654
1001..1215, 1992..2173, 2284..2495, 3658..3836, 4026..4131, 4583..4696, 4785..4923, 5298..5493, 6225..6483, 6717..6824, 7117..7470, 7660..7842, 7958..8090, 8461..8651
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved