Monodelphis_domestica Locus RPL30
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica RPL30
Monodelphis_domestica
RPL30
3
SNORA72
5065..5198
6548
TTTCCTTTGTGATTCTAGATGTTTGAGCTGTCTTTTTTGTGTGTCACATTTGGTAGACT
GGTGAAAAATGTGTGGGCTCCTCAGAATATATAGAACCGCAAAAGGAGACAATAATGGTG
AAATAGTGCTAGATGAGGCAGCGGATAGAGTAGGGTTTTGCAGTCTGGAAGACGGAACTT
CTAAGTAAGAGCTTTGTAAATCTTAAAGCTCTAAATAAATGCCAGCTGTGGTTATTATTT
TTTTTTAAACCCTTACCTTACCTTCCGTCTTGGAGTCAATACTGTGATTTGGCTCCAAGG
CAGAAGAGTGGTAAGGGCTAGGCAATGGCGGTCAAGTGACTTAGCCAGGGTCACACAGCT
GGGAAGTGTCTGAGGCCAATTTGAACTCAGGACCTCCCGTCTCTAGACCTGGCTCTCAAT
CCACTAACCTACCCAGCTTCCCCCAGGTGTGGTTATTTTTAAAAAGCCTTTTAAACCTCT
CATTTTACAGAAGTTGAAGAAACCGAGGCCAAAGTTGTCAAAAGATTCGAACCCGCATCC
TCCCAGTCCAAATTCAACGCTTGGGCTTTCCCACACCTACAAGACAATGGGGCTCGGCCT
AGATGTCCAGGGAGGACTTTCCTCGAGGTCCACTCCCGGAGTCTTGTCGCTCCAGACATC
ACCCACCGGCTTGTTTTCCCCACTTCCGGACTTGGCCTAGGAGAGAGAGAGGACAGAAGG
ACTGCATCTTCCACATACTAGAGCCGCCATTATCAATAGCAACTACCTACTTCCCCTTGT
CCCCAGCTCGGCGAATACGCTCTTCCGCTTCCGGTCCCGCCCCTGAAGAGTGCTGCATTG
TGGGAATTCCTTCCTTTCTCGCTTCCCGGCCATCTTGGCGGCAGGTCTCTGGTGAGTGGG
CCTCCGCGAGCTCGGGAATGGCGGGGTTTGGGGGTCGCAGGTGGGGAGTTCCGGATGCTA
AATTTCCCCTCTTGTCTCTCTATGCTCCAGACTGAGGGTCCTCCCGCACTGCAGGCAGGA
AGATGGTGGCCGCAAAGAAGACGGTGAGTGGGGCGGGCCCAAGCCGCCGGCGGCCTCCAC
ACGTGGAGCCACCCGGGCATTCCGGGCTGCACCCAGGGGCCCAAGGGCGGGCGAGCTTAG
GAGGGCCGAAATCTCTCCTTACACCTATACACTCAGGCTAGATTTCCAGGGTCGAGAAAA
GCGAAAGCCAGGTCAGGATGCGGAAAGGCCTGGCGGGGAGGCTTCATTTGCCCTGATCCC
AGAAGCTGCTGGGCATGGCCCGGCTTCGGATCTGGGTGGGGTTCCCTGGCTACCTGGAGC
CCTGGACTTAAAACAGTCTGAAATGTTTTCTGCAGAAAAAGTCTCTGGAGTCTATCAACT
CGAGGCTCCAGCTGGTTATGAAAAGCGGCAAATACGTGCTGGGCTACAAACAGACCCTGA
AAATGATCAGACAAGGCAAAGCCAAATTGGTCATCTTAGCCAACAACTGTCCGGCTTTGA
GGTAAGTGGCCGTGTTTCTGTGTGCTGTGGGAAACCTCCAATAGATTTTCTGTGGGATAC
CATCTTGAGAGGGCCATCATTTGTGCTTTCTTAGGAGGGTGTCTGTTGAAGTAGACGGAA
ACCTCCCTGTACTTGGGAGTCAGAATTCCAGGCTTAAATCTAATTTCAAACACTTAATAA
ATGTAGCATCTAGGACTAGTCAGAATCTGACCGAACTTTTCTGGGCTGTAAAATATGGAT
AATACACCTTCCTCACATGGTTATGAGAATTAAGTGAGAAATAGAGGTTTTACAGAGTTT
TAGGTAAAACAAAACTACTTTTGAAGACCTGGTTTTATATCTTGTCCCAAAAGTGTACTA
TCCATGTGACCAGGAACTTAAAAGCATCTGAGCCTCATTTATTACCTTGTCTATAAAATG
AGGATAAAATCTACACCACCTACCTTAAATGGTTGACTTGAGAAAAGATCTTTATAGACT
GCAGAACTCCAAATCTAAGAAATTGTGCTTATTAAAATTTGTATCTAACAACATAAACTA
GTCTTAATTTGCAGAAGGGCTTTTACAACATTGTTGCTTTGAGACTGGTATTGAACTATG
TAGAGTTGGCATTTGGGAAACAGGAAGGAAATTTTTAGACTCTTTTTAAAAGTTAAACAT
TTTACTAGGACATACACTAAATATGAAAATAACAGGTTGATGTTTCTGATTTGGAGATTT
GAAAACTGGTACAAATAGTGTGCCATGGACTTTCAGTACTAAATCTGATTGTAATCCTTG
TAAAGCCTTTGTATTGGAGCTGTAAGGGAATCCTATTCTTTTATATATAGGTAATTAAAA
TTGAAATGAGTATAGTTTTATCTGGAAAATGAGGGGATTAAAGTAAATACAGTAATAGCT
AGTATTTATTGCTTTGAGATTTGCAAAACATAAATATTACCTCATATAACATATTGGGAG
CTAGGTGTTATTTTCCTCATTTTACAGATGAAATGAGGCAGAAGGTTAAGTAATAGGGAG
ACACTGCTTAGTAAGGGGCCCAAGGTGGGATTTGAACTGATGGTCTTCTGATTTCGAAGT
CCTATATTCTACTTAATATACCAACTAATTGCCTCACATACTATGTCTGAGGGTCATATA
TTATGTAAATTAGGTAAAATATTTTAAAGTGGTGCTGTCAAAAGAAATGGAGGATGCTTA
CCAGTGTATGCCACATAGAAATCCACAAGTATACAAATAGGCATCTCCTTTACTGTATTT
TGTTCAGTGTTTCCCAATTAAATTTTTAATCTGTTTTGAGCAGGGTTGTTAACAACTGTG
GTAAAGCAATGGTGCACAATAGGCTTAAATCTTGAGGTCTGCAGAAATTTAGCTGGTCCT
AGGAAATTTTACTAAGCCATGTATAACACTTCTCAGGAGAAATGGTTTGGGAATTTAAGA
CTTAAAGAATCTGTTTTAAAATGTATTTTTTTTCCAGTTAATTTTTACATGCCCATGGTA
CTTCTGTTTTGACCATTGACCTTTGCAAATTAGCATGGCGAGGGGTTTTGTTCTTCCCAA
TTAGCTGCCTCTTATTCTTTAAGGTCCCTTCAAAGACTATTTCTGGGAAACCTTCTTTGA
CCACTCTTCACCAAACTATATCTTCCTCTGAGAAACTAGCACTTTTTGCCTGTATCATTC
ATTTGTCCTTTATAATGTTTTATGATACTAAGGATATGCATTCATTTATATACTTTATTA
TTGCAATCTAGATTGTAAGTTCTTTGGAGAACATCTAGTCAGTAAACATTTAATAACTAG
AGTAGGTAGCCTATTTTAGTTCTTTTTGTATCTTTTCCACTTTGGGCACATAATAAGCAC
TCAGTAAATTATTTCCTGGAATTCTTTGCCTCCTCTCCTGGCTTCCTTTACCTTCCTAAA
TATCCCAGCAAAAAATCTCACTTCTGCAAATTAACATTTTGTTTTTAATATATCTTAGTT
TCTACATAATTTGCTGGTTGCATCCTTTTAGTCCCTTATTGATTAGACTGGGCTTGAGAA
CAGGGAACTGTTGTTTTTTTGTCTCCCCAGTCCTAACAATGCTAAGCACACTTCTAATTT
GAATGTTCAATCTGGCCCAACTTTTCTTGATCCAATTTTGGGTTTTCTTGGCAAAGATGC
TGAAATGCTTTGCCATTTCCTTCTCATTTACAAATGAGTAAACTGGCTTGCCCAAGGTCA
CACAAGTATTGAGGCCAGATTTGAACTCAGGTTTTTCCTGACTCCTGACCCAGCATTCCA
TCCACCTACCAATTTAGCTGCTCAGTTCATTTGGATACTAATAGACTGGCTTAAAAGTGG
TTTTTTTTTTTGCTAGTTAAATTTAATTTTTTTAAACAAAATCAAAAGCTGTAGGATTAT
TGAATTGTTACTCTTTTCAACAAACATATGTGTTACATACATAAAACTGTTACTATACTG
AGTGCAAAGAAAAAAAATGCATGGAGCCAGTATGGGAGATCCCATGCATACCCTGAGAAT
GTTGCAAGGAGGAGGCAAATTTCAGAGGAATTGGGGAGGTCTTGGGTCATGACACTAAAA
GACTAGCCCTTGAAAGATAGGGTAGCAGGGAAAACTGTTCCAGACAGAAGGAATGGCTAA
GAAAAGGGATGGGCAGCTAAGTGTAGGATCTATTTTGCATTGATTTTATTGGATTATATA
GTGTGTATAAGGCTGAGGACTTAAGAAAAGTTAAGTTGGAAAAGGTAAGTTGAAGTATGA
TAGTTTCAAGTTTGATCTTTATTCAATAGACAGTGGCAAAGCTTCATTTATCTGGATGGT
GGTTTAATGTGTCGTTTATTTTATTTTCAGAAAATCAGAAATTGAATATTATGCTATGTT
GGCCAAAACTGGTGTACATCATTACAGTGGCAACAACATTGAATTGGGTACAGCATGTGG
GAAGTACTACAGAGTATGTACCCTGGCTATCATTGATCCAGGTACGTTGGTGTTTTTGTT
TTTGTTTTTGTTTTTGAATCAGCTAAACTATTAGTGTGCATCACATAGTATCTTTTAAAC
TTGATGGTTTATTTCATAGGCTAATGTCTAAGAACTTAATGGTGCCTACTTGTAGCCAGT
TAATTATGTATTTAAAGCACTTAAGTGTCAGAAATTGTGCTGAGCCTCAATTGTGAATTA
AGGTTGTAGATTTTTAAAAACAAAGTCTGCACAACTTAAAAAAAATGTATTTCATTTACC
TAGCCAGGCAGTGTTGTGGTGGACGAGAAATTTAATTATGATGGCATATTTTTATAGGAA
AGGTTGATGAATGTACAAAAAGTCTGGGCTGCCCAGGTTTTTGAACTTAAATGATTTTGA
AACACTAGGGCTCTTCTGAGAGACTTTAGCTTTTATACTTGATAAAATTCTAAAATGATT
AGAATGGGAAATAAGCATTGCTGATCTTTTGAAAGGGTGGGGGAATCATTAGCTTTAGAA
TAAAATTGTTAGCAAAGGCAGTCTAATGATTTCAGTGGATTTTAATTGGGATTCCCATTA
TAGATAATTTAGTTTGGTTTGGGTATTGCGAATATTCTCGCTGGCCTGATATTACTGTGA
TCTGGTCAGGCTAGACATTCGCTAGATTAAGACCATGCATTGTGCCTCCAGAACTAGTTC
TCTTCCCTAGTTTTGGTTTTATAAATGCTGGTAACAAACTAAAGGTAAGATGTATTTATC
TTCTGGAAATAGAAACTGGGATGTTTGGCTTTCTTTAGTGGTATTTTCTTGTTCCAACTC
AGAGCAATGAAAATTGCTTCTGAGTAGATAGTTACTCCTTAAAGGGAAGGAGGAAGCCTT
ATAATTAGTAACAGTATGTGTGGCAGTTTTTAAAGAATGTTGTAATTTTGGGGAGAATAA
TTCAGGAAGAAAATTGCTTTTGACTGATAATAAGCTTCATCAGTTGCCTTTATGTAAATT
ATAACACTATTTTGTTTTTTAAATTTTCTAGGTGATTCTGATATCATTAGAAGCATGCCA
GAACAGACCAGTGAAAAATAAACTGTACAAAGTATTCTTTAAATAAATTGGTGCAAATGC
TTGTTTTAAAAAAAAAATTGTATGTATTACTATTTATTTTCTCATAGAAATGAGAATCTG
CTTGATTTGTGTGTGTTAAAGTGAAGGAGTTATGTTACATATAACAAATCCCTGAAACTT
CTTTTAACCAAAATTTAATCTTAATAAAAATCTTATCATAGCTTTTAATGAATAGCAAAA
GTATTTAAAATCTATCTCTGGCTCTTGTCCCATTTTAGTCTGGGTTCGTTCAAAGATTGA
AGTTCTAATGTATAAAAAAATCACAATAACTTAATATCTACAATGATAGTTTTGTTTTGT
TTTTTTTTTTTGCTGGATGCTAATGGACAGTTTATTCAAGAAGGTTTAGCAAAACTAGAC
ACATCAACTGAAATTTTACAGTTGATCCAAACCTAGAGCCCCCCCACCTTTGCAAAGATA
GGAGGAGTTGCATTTTCAAGTCTCTTTGGAGTTCAAGATTGGTCACTATAATTTTACAGT
TTTCAGCATTAAATTGTTTTCTTCTCAGAGCACCTTTAAGGGGGCAGCTGAGTGGCTCAG
TGGATTGAGAACCAAGCCTAGAGATGGGAGAGTCCTGGGTTCGAATGTGACTTCAGACAC
TTCCTAACTGACCCTGGGCAAGTCACCTCACCCCCATTACCTAGCCCTTACTGCTCTTTT
GCCTTAGAACCAATACACTGTATTGATTCTAAGACATAAGGTACGGGTTTTAAAAAACAC
AACAACAATAACAAAATTCTGAGTGTAGAGTACCAGTAGGAGGAAGAGGAAGAAATGTAG
TAATAGAAAAGTAAACATCCTCAGTTCAGTTTTTTGCTAGCTGATACTCCCATTCCTGGA
ATGATAGTCTCCCTCTCTTAATTCTTTTATTTCCTCATCTTTAAGTAAGACCCAGTTTAA
TAACCATCTACAGGAGACCTTTCTGAATCATCCCACTGTCCCCTTTGAGATTATTGTCCA
TTTTATAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1042, 1355..1500, 4350..4480, 5491..5548
1022..1042, 1355..1500, 4350..4480, 5491..5537
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved