Monodelphis_domestica Locus ENSMODG00000020301
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000020301
Monodelphis_domestica
ENSMODG00000020301
3
SNORD72
3261..3340
4503
CGCCAAGGATCGAGGTCTGATGAAATGAACCACAACAAATGCCAGAAACGCCTCTCAAC
CCACAGCCAAGAACCGGAAGCTCGCGCAGCGACCGCGCTTCCCGCTCGAGAATCAATAAT
CCACATTATTGACCAATCAGCGCCGAGCCCCAGCCGTCTCCTCTCTCAACCCCTCCCCTC
ATCCCCACCCACCGTCTCCGCCGCCGGAACTTTTTCCATGGTGCACCGTGACCGACGGAA
GTACTATCTCGGCGGAAGCCCAGCGAACTTGATATAGCGGAAGTGCTCTTTCTCTTCCGT
TCTCTTTGGTCCCGGCTGCAGAAGGAAGATGGTGAGTTCTGCCTTTGGGTCTGGGTAGTA
TCGGTATCCATCCTCTCTCCCCAAATGGCTGCGACGGCCAGCTATAGTGGCCATGGCCTC
TGCGGGCATCGAAGAGCTCGATACGGCGGAAAATCCTACTCAGGGGGCCTAAAATAAAAA
ATTGTGGGTCCCCGAAGAATTCCAGGGCCAGCTCTACTTGAGGCCGAGCCCTTTCGTCCG
AGAAGCCTCACGCCCCCACCAACCGGGCCTGGGCATCGGGACCCTCATGTGTGCCCAGAG
ATTGGAACGTGATTTTGTCTGGGAATGCCAAGGACTGACTGGTGGGGCTTTTAGTTATGC
TCCTAGGGGTGGAACTAGTGATCGGCCTGGCCTGACGTGTGGTGGGACATGGCGAGAAGT
TTGGGACAGTGAAGGACTAATGTTGTGAGAGTGGCCTAAAGTGAGTTATTTCCCAGACCT
CCTATTCTGTCCTATAGTAAAACTCCCATGTTCCCAACATTGGATGGGGAAGGGCATTGA
CGATTCAGGTAGACTTGCTTCTGTGAAATGTGAAAATTTAGGAGCTTAGCAATCGCCGTT
CATTTGGAATTTGTAACTCATTTTCACGTTAGAATGTTTGCTGCCATTTTTTGTTGCGAT
AGATTGTGCTGTATCTCAATTTAAAATGTTCGTGTTTTCCAGACGAAGGGGACTTCTTCC
TTTGGTAAGCGCCGGAATAAGACGCACACTTTGTGCCGTCGTTGTGGTTCCAAGGCATAC
CACCTTCAGAAGTCAACATGTGGCAAATGTGGATACCCTGCTAAACGCAAGAGAAAGTGT
AAGTTTCCCATGGAGTAGGTATTCCTTAAGGAAAGGGGCAGGTTTTTTACCATTTTGTTT
CGTCTTGCTAGTTGCAGACTTTGTCCATTAAAAATAGTTACTGTTCCATGTGAACAAATG
AATAAGGATGGAGTGAAGAAAGGGTTTAGAGCTGCTAAGACACGTAGAGGCTACTGCCTC
TAAGAGAAAGTAAGACATGGGGTGGGGGCTGTAGAAACATGGTTGAACTCTTTAAAATCA
GAGGAATTCCATTCAAATCATTGCTCTGTCGTCCTGGAGAAATTATTTAACTATTGAATC
TCGATTTCCTCATCTATGTAAAAAGTAGGGAAATTTGGGGTGTGCGGTTTTTTTATTAGA
AGAAAAGCTTTATGATGTAAAGATTTTCTGTCAATACTCATGAAAGGAATGATTAGGACA
GCGAATGGACTTAAAAATATTTTTCTTTTTATTTCATATGCACAGCTAAAAATACCAAAT
GTAATTTTAGAGGGGGAATCTTTGAACTGGTACAAATTTAGAGCTCATTATGCCACAGAT
AGTTGCTGAAGAACTGTTGAGAATCATTTGGAAATATTAAAACACTGAGACCTGTAAATA
ACTTTGAGGTAGTATCATTAAATGTTGGCTTTCTTCAAGGGTCAGCTTAAATGCCACCTT
CAAAGGGAAATCTTTCTTTTTTTTACACTTGATTTTCTCCTAATCATTTATTTTGTGTAC
ACATGTCTGTTTCTCGCAGTCATTTCTCCTACCTCTTTTCCTCTAACAACATGAACTGAT
TTTCCCCCTTTGCATCCTTGAAATAAGATATGGTTGAAAATTTGAAACAGCTGGGGGGGT
CACTGAAAATAATTTTGGGGAAATGAAATGGGACTCTTCAGAGACTTCAGGCCTTGAATT
GTTTGATTTTGTATCCTAGATAACTGGAGTGCAAAGGCTAAGAGACGCAACACCACTGGT
ACTGGTCGAATGAGACATCTAAAAATTGTATACCGCCGTTTCAGGTATAGTTTTGTGTTT
TCTCTTGCTGAGCTTCTAAAAAAAAAGGAAAGCAAAATTTAAAATGCTTATTTTAAGTAG
AATTATCTTAAGGACATCATTTCCAACAATGATATAGCTTTAGGAGTGGTTTTCAGATAA
TTTTGTAAATTTAAAGTTGGCTTTTTGCTGCTTTTATTTTTTCACTTTGCTACATGAAAT
ATGGGTGTCCAATGAAAAGCAAAAGAATTTAATATTTGAACAGTCAACACAGTATTTGCT
AGAGTTCATTGCCTATAAGGTACTCTTAATATAGAACTGCCTATACTAATGCAGACTTGC
TACTTAATAAGAGGCTTTCAAAGTTGCCTCTGACACTTCTCAAGATGAAGAGCTGAAATA
AGTATAAGGCAATTTAGTCTTGCATTTCATCCTTGGGTGTTCAGTATTGCATTTGGGAAC
ACCAAAGATATAGCAGTTATCAAGATGGGTGTATGCATCTAGGAACAAACTAAAATTTCT
CAGTCGTTGCCATAATCTACTAATGCAATGTGGATTTTTGAAGATGCTATTTATTGTCAG
GGTTACATTTTCAAAAGTTTTTCTAGAACTATATTAGAGAAGTAACAGATGTTTCTGTTA
AAGACAAGTGACTGAGGTTATCAAGTCCTTTGACTTTTTAATTTTATTTTTTTTTTTACC
CATACTTTCTGTCTTAGAATCAATATTAGGTGCTTCAAGGCAGAAGAGTGGTAAGGGCTA
GGCAATTGGGGTATCTAGGACTGGCTGTCTCAATCAACTGAGCCACCCAGTTGTCCCTCC
TCGAATTCTTGGGTTTGGGTAAGATATTTAAGGCTAATATCACAGACACTTGTTAAAAAA
GGAACACTGACATCACAGTCCAGAAATGGATATCCTGTGACAGGTTGATTCCAATTTTTA
GGATCCTCTTGAACTTGAGTAGATACGGATTTTGTAGTCAACTGTTAGACTGACTTCCTA
TGTAATCTTGAGCTAGCTGAGCTTGTGTTAGTGGAAAGTCCAGAATTGATTGCATATTAA
AGTATTTTGATATTTGGATTTTTTTTAAATGGATTCTGTCCAACATAATGTTCTGAAAGG
AAAATCCAAGGGAATATTTGCAGCTTGTCAGTGATGTACTTTGAAAAAAATGTCTGAACA
TATGAATTAATAGTGATTTCAGCATTTAACTGAGATGAGCTGAGTAAAATGTTTGCAGAA
TGTACCTCCACAAAATTAAATAAATGAAAAATTAAAACACTTTTTTTTTAATGGCATAGG
AATGGATTCCGTGAAGGAACAACACCTAAACCCAAGAGAGCAGCTGTCGCAGCATCTAGT
TCATCTTGAGGATTCAACTGTTTGTTAAAATAAATGTTGTGAATCAAAAGTAATTGTGGT
CAGTTTCATTTGATCCATTGATCACCCTTAGTTAAATTATTGGAGTTTTGTATACTTTGG
TAAGTTCTAGCTTGTGGGTGTGGTGATTTAATAACCAAGAATGGGTTTATTTAGTAATAT
TATCTTCATCTTAAATCTTTTGCTTTTTGGTAGTTCTCTCTCACCCTTTGTGACTTTATA
GGAAATTAAGAATGTTAGATCATTAAGAGGGATGTGTGAGTCCTTATACTTTTTACACTG
GCTATGTACCTGAGCATTTGCCACTCACATCTGTAGTACCTACCTCACAGGGTTGTTGTG
AGGTTTAAATGAGATAATGTATATAAGTGTGTTACAAATTTTGAAATAGTATATATAAAT
ATTAGGCTTATTTAGTAATTAGATTCCTTTTGTACTGTTTGTGTAGCAATGAAACTTGAT
AACTAGCAAAAGGGAATAGGTATTTTCACAGTAATTAATTAGCTTGAATTTGATTAGTAA
ACCTTTAAATGGGGCAACAAGTCAGTGTGCAAAAGTGCTACATTTGGAATCAGGGCAGAT
AATATGAACCAGAAATTCACTTCCTTCCTTGAAACATTGGAAATGCCATCAGAAAATACT
CCCTTCGGACTTAGTTATAGGAAAGAGAAAAATAACCTCTAGGTCAATTTTTATAAAACT
TTGTATATGCATATATGGTTAAGTTAAGTCATTGAATAGATTTATCTTTGTATTCCAGAC
ATACCCCAAATCCCCTCTGATGGATTGGGGTACTACCTGCAACAGTATGCCTCTCAACTC
ATTTATGGGGCTCCCCCCACTCAAATTCAATATTTTGTATTCAAAAAGCACTTAGCACAT
TTCCTGGCTGGACTATATACAAATGCCCTTTCCATCTTGTACAACAGCATACTGGTTGAT
GGAGCATGTTGTCCATAATTCCTCAATCTCATTATTTAAACTGAATGGGGAATCAACCTT
ATTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1137, 2059..2143, 3419..3503
1002..1137, 2059..2143, 3419..3485
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved