Monodelphis_domestica Locus PTCD3
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica PTCD3
Monodelphis_domestica
PTCD3
1
SNORD94
24944..25080
26996
TCAGATCCTGCCTCTTTGTTACCACCTGTGGGGCCTGGGGGCAAGTTACTTAATCTCTG
AAGACCTCTGTTTCCTAATCTGTAAAATGAAGGCATTTAAACCAGATATATAGGCATCCA
GAGAGTAGAGTAGATAGAATGCTGGACTTTGGGAGACAGGAAGACTTCAGGGCAAATCTA
TGTGACTAGGCAATTCCCTTAATTTCTCCCAGCCTCAATTGCCTCATCTACAAAGAAATA
ATAACAACAGTAATAATTCCTACTTTACAGTGTTACTGCGAAGATTAAATGAAATAATAT
ATGCAGAAGTCTGTATAAGTAAACCCAGTTTTAAAATATTCTGAGAAGCTAGTTTATTTC
TAGGTATGGACTAACAAATTCATTTTCTTTTTAGTTTTTTTAGGACCAACCTGGAAACTT
TAAAATTCTAGCAATTATTAAATGGCCTGAGTTATATTCTGGCTTTAAATCTGAGGTTTA
AATAAGTCATGCTTTTGTCACATCTTATTCACATCAAAAAGTAAATTTGTAATTTTTTTC
ACCCACTGATTAAATCACTGCTGTTAAAGATATTTAAAAATTCTTTTTTTGGTTTTGCAG
TTGGTTTGCAAGTCGGTCTAATAAGATCACCTTTCCAAATTTTGAATAGCAAGATTTCTG
TTCCCATTCTTTAAATTACACTAATAACTTGGAGATTCTGTGAATACAGCACAAAACAAC
ACATTAAACCAAAGTTAGTGGGATAGATACTAACCTGGTTTAACAAAAAAGGTTAAAAGA
CTAGAGTTCTGTTCCTGATTCTGCCACTAGTTAGCTCTATCATCTAAGAGAAGGAACTCT
TCTTCTGGGCTTCAGAGTATTGGATTAGAGATTTGACCGAGATCTTTTCCAATACTAATA
TTCTAGGAGGTCAGAAATTTAATACATAAATTCAATTTGCCATCTTTGGCATAGTTGAGC
ACAGTACTAAAGGGATGAACATGGTAGTCTTTTGTTTTCTCTGCAGGGTTTATTCTGGAA
GTGCATCCCTCCCAGAAGCAGCAGGAGCTGATTCTCCAGGTAAAGTACCTTCACTGTGCT
GATAGCATAATTTTGGTTTGTAGGCATTTTGGAATAGTAATTAGTTATTTTGTGGGAGAA
TTAACTATTCATTTTTGCAATTTTATTGAGAAAAACTAAATTATTGGGTTTTATTTTGTT
CTTTAAGGTTCTGAAGAAGTGATCATTCCAAAAAGAAAAATTTGGTAAGTGATGGTACTT
TTTTTTTAAGTTATACATAGAGATTATTTTTGACGATTGTTTTCTAACATTTTGTGATTC
AAGTTTTCTTCCTCCTTCCCTCCCCCCAATCCTGCAAGTGGTCAGTAAAATGATACAGGT
TATTCCAGTGCTTTCATGCAATGCCTATTTCCATATATATTGCTTGTGCCATGACAGAAG
ACACATATCACACATACAATAAAATGCTCGTTAAGGAAATAGTAGAAGATGGCATGCTTG
ATCTGCCCTCTGACATGTGTCCTTTGTGGATGTTTTGGAGACTTGCTTTGCTGGTGATGG
TTTTAGTCCTTTCCAGTTGATGTAAGATGGTATGTTTTCAAAATAGTGATCACTCTTAAT
TTGGAAGAAATTGCAAAATCTGTGGAATCAGTATAGCATCCGCATTTGTGTAATATTTGT
TGTTCTTTGGCAAGAACATCACTCAAAGAGTAAGAAGAATTAACTTCTAGTGCTAATCCT
GCCATTCATTGGCCTAGTGTTTTTCTGAATATAAAGTGACTGGGGCACATTTGGTAGTAG
GATAAACTCAGCCTCAGGAGAATGTCAGATTCCACATCAAAGACAAGGGCTAGTTTCTCT
AAAAGGCAACAATTGAACACTTTGTCTTAGCCATTGCCATTAGTGCTAAGGAGATGAGCT
CCATGAACAGTAAACCAGCAGGTAGAGCATAACAACCATGGGAAGTGAATGGCAGCTGTA
AGGATTGTGCATTAAGGGTGAGAAAAGCCAACCTACTGATTTTGATTTTTGTTTATTCTT
ACAATAGGCATTTATTAAACACTTACTGTGTACTCTTGAGTCACCAAACTCAGTGCTTTC
ACAAGTCTTCTAAGACTTACATAGCAGAAACAGTGCTGAATTTGCATTAGAAAAGGGAGC
TTCTGTGGAGATTTTGGAGGCTTATTGAATCTGCCAGATGACATGTACAGTTATAGCTAG
TATATACAGATTTATTTTGCTTGTCTTGAACTTGTTTGTTACAAAAGTTTTTGGTGGGGA
GGTAAAAGGTCACAACACAGAGAAGCAAAACCAAAAACTTACATGGGAACAGTCAGCTTT
AGAAGGTAAGCAAGGAGGTGTTGGGACTAGCATTTTAATATATACTTTAAAACTGTACAA
ATAGATTCACAGTTTCAAAAGTAATTCTTTTTTCCCTCTGTTCTCTGAATATGGGTATAT
TCACATGCATTGTTGATCAAAAGATATTTTGTTTTTAAAGGAAATTTTGGGGTGATTTTT
GGCTGGAAATTGCCTAGTATGCCATTCATTCTGCTCTGCCCTGTGCCATCTTGGAAAGGG
AAGGAGGTGGTCATCCACCACTCTACATGTGTATTTTACAACCTTATCCAATATTAATAA
TAATGTAAAGCCAGTGGTATTCTTGTGTTCATTTTACTGATGAGGTAACTGAGACACAAA
AGAGGATATGTGGTTTGACTAGGGCTGCATAGCTGAGAAAATGTCTGAGACAGGATTTAA
AACTCCATTCTTCCTGACTCTGGGTTCTATTCCTCCATTCCCCCTTGTTTTCCCATAGAA
ATTATTTTTGGATTTCCTATGATTACTTTTGGCAACTTTCCCATTATGTTTTCACTTATT
GGGTTCTCTGCCCTATACCACTACCAAATGAGATGTGGCTACAGTTCAGAGTGGACTTAG
ATGGCTCACACTTCTGCCAACAGATTGGGGCAGGCCTGAGGCCAAACCCCTTCCTCCCTC
TTCTTACCCCCCTTCCCCACCAGTCACTTGGTGAATGTGCAAGACTTTTTTCACATTAAA
ATTCTCATTTTTAGGGATAATGTTGCAGTTCTTCAAGCTCTTGCCTCTACCTTCCAGAGG
GTAAGTAGTGGGTTTTTTTGGATATCTCATCTAGGCCTTCCAATGATGCATTTGGTGTCT
TGAAACTTTCATCACATGAGCTTATTTCCACATACTCATTCTATATCAGAATTCTCACTT
GTAATAGAAACAGAATCATCTCTATTTCTAAAGCACCTTCTTCCCTTCAGCAAATTATGA
AGTAGATTATTCAATTATCATTATCCACATTTTAGTGACAAAGCTAGTAAGTACCTGAAC
TGCTTTTTCTTATTCTGATCTTTGATGAGCTTAAGGCTTGGACCTGCACAAGAAGTGTTG
GGCCCCTAGTGGTCCTGAAGGGGGAGAGCCATTTTTGCCACAGAAAAGGCATAGTTGTCC
ACTGAAAGAAGAGAGACTGGGAAACTCCTGAACAAAGATCTGGCTTTATCGTGAGTAAAA
AAATCACAGAGCCAGAGATCAGCAGGTTCTCTAGTTTGAAACCTAAGACCGTGAATTACA
AAATACACACAATTTTATAGTTTCATGTCTGTCCCCAAAACCCCTTCTTTCCAAGAAATC
CCCAACCCCCAGGCCCTTCTTGTCTTCTGTGGCCTTAGGATAAACTCCTGGTCTCTATAA
CCTCTTAGGTGAGTAAACTATCTTATGAAATAGATTTATATACCTAACACTAACATAATA
ATTTGCTTATGATTGATATGGTAACACTTCAGAATATAATTCACTTACTATCCTGGGACT
ATAGATTTAATCTGTTTCTATATACAGGCTCTTGCCTGGGTCTATATTTTTACTACAAAT
CACAAATTATAATTTGATCAAACTCCAGGTATTGAGTATTGATTTTCTGATTATAGCACA
TTCCCTTTTTTCTTTTTCTTTTTCTTTTTCTTTTTTTTTTTTTAATTTCCAGTTCCGAAT
TCTATTTCTTTCCTACCCATTGAGAAAACAAAAAAAAAACAAAACCCTGCTTGCCAAATT
TCAGGCCATACTCACTGACTCCTCCCTGGAAATTTCCACTTTGAATCTCAAGTCTTCACC
TTTACAGCAGAGTAGTAAACATTTCAGAACCTCCCTTGGGGTCATTCTTGACCATCACCA
GAACAATGAAACTAAAGAAACTTAATCTGTCTTCTCCCTAGGATCCCACAGCTGCCCATT
ACACATTTCAAGATGATCCTTTCCTCACTCCAATCTCATCTTCAGAAGCCGTGAGTGTGT
TCATATAACCTTCTTATAACCCCAGTCCACAGAGGAGCACCCACTCTGTGGAATGTGGCT
TGTCACCCAGCTTTATCCAAGCATACAGATACTGACTAGTAAAGTCATAGATTGTGATTG
CTCTGGGAACTGTGACAAGGAAATCACTTTTAAAAGACTGATATATATTAATTTAAGATC
GCCAAGGAATTCAGCTATGTAATTCCTAAATGAAAACTCAAGTCAGCCGTCAACCTTTTA
TAGAGTTTAATTACAGACAGGAGGAAGAAAGGAATTAGAGATAGAGAGAGAAAGGGGAGA
GAAGGGAATAGGGCTTAAATACCCCCTTCTGTTTAGGCTGGGCCAAAGGGCCCAAGCCCT
TAGATAGCTGGGGCAAAGAAAGGAGATCAGTCCCTATTACTCACGTGACCAAAATGGAGA
AACAGTCTCAGAGGCCTCCACCTCCAGCTTCCTTCAGAGCAAGCTTCTCAGAGCACCTCT
CCAACCACTCAGAGCCAAAATTCTCCAACCACCCCCCAGTCCTCAGACCCCTCTATCTTT
AAGGAAACCATCCAAGTTCCCTCCCCTCAGTTCTCACATCTACCAATCACTGTCCATCAT
TTTCCCTGTGCCAATGGTGGCTCTAGCTTAACCCAGGACCGCCCAGAGGTCTGTGGCTTT
GCACATGTCTGTTGGAGGTCATATTCTCAAATAATTAAATTTTGATCTATGCTGCAGCCC
TTCCTAAATCCTGTTAGGACTGAGTGGGGTGGAAATTGTATTTTCCAAGACCTGATTCTG
TCATTCCAAGTATCTCTATTGTATCAATTCTAAAATCAATCATGACTCAAAGAAATTCCT
GTTCTGTGCTTAAGCATAGGTCAAAGCCCTTTCCATTGTTCAGCAAAAGGTTTCTGTCCT
AAAGTAATCTTAAGAAGGGAGGAGGAGGAAACTCTCATGCCAATGGGGTTCACATTCCAA
TAGACTATCAGTAAGAAATTTTCCCAAGTATGAAATTTCCCAATGGTGAAATTTCCAACA
TTTATAAGTCTAAGAAATTTTAAGGTTTACAGAACAGTTGGTATTTAAGTGTAAAGATGT
GAAAGATAGGGGGGCAGCTGGGTAGCTCAGTGGATTGAGAACCAGGCCTAGAGACGGGAG
GTCCTAGGTTCAAATCCGGCCTCAGCCACTTCCTAGCTGTGTGACCCTGGGCAAGTCACT
TGACCCCCATTGCCTAGCCCTTACCACTCTTCTGCCTTGGAGCCAATACACAGTATTGAC
TCCAAGACGGAAGGTAAGGGTTTAAAAAAAAAAAAGATGTGAAAGATAGAAGTAGGGGTG
GAGAAAGAGACCAAGTGGATTTTCCCCAATATGGCCAAACTGGGCTTTTTATCTCAACTA
TAGATATTTGCCTTCTAAGTTTTTTATTGTTTTTCTGGATAAGTTTTAAAATTTTACCTT
GACTTAAGAAAGGTTAAAATTTGAATAAAACAATATGCCCTGATTTTAAATCCCATGTAC
AGATACTTCATTGAAACTTTGGGTGAGATAAGAATTTTGCTTATAAGAAAAAATATACTT
GGTTCAGATGTCTTCATTCTGCATTACAGTCATAGTGACTGTGTTTTAATCTGTTTTTCT
TTATTATAATAAATGATAAGGAAAAGATATTGAAATGTACAATTAATTTTTCCTCTTTAC
CCTTTGAATCTAAATAAAAATGAATACTTGCTAATGACTAAAACTGCCCTCTTTTTTACA
GCGTATGTTTTTATTGGCAAAGGATTCTGGAAAGAATGCCGCAAGATATGTTATTAACAC
ATATCCCAAATTTTTTGAGAAGGACATAGCTGCACCTCATATACCAGTAAGTGAAAGTTG
CTCATCTCTAACACCAGATAAGTTTATATTTAGATTTTCCTTGAGGCAATCCACATTCAC
CCAGCCATTAATGAGAAATCTTCTATAAGCTTTGTGCCAAGTTTGATAGCAAGGGGAGCA
GAAGATAGATTCCTTTGCCCTTAAACATCTTTTTCCTCCTCCTTTGTGTTAAGAAAAAAC
AAGAGGTGACATGGGGTAGTCAGTAACTAGCAAATACCTTTTGGGGTTACTTTCAGTAAG
ATTTTAAGAAACACATGGGCCTAAAGCCCTTTTCCGAAATGCTTGTCCTATGGAGGAGAG
CAGGGGGATGCTGACGGTTGTTGGAAATTTGCCTCCCTGTAGTCTGACTGGCAGTTCTCT
TCACCCTAACGTCTGGCCTGTTTTAGTGTCTGATGCCCGAGTATGTGGAGCCTCAGATTG
AAGACAAAAGCGAAGCTGCCCTTCAGGAGCGCATCCAGCTTCGCAGAGTCAGAGCCTCTG
TGGACATGTTTGACCATCTCCTTCAAGCAGGTAACCTCAGCTCCTGGGGAATAGGCCAGC
TCTCCACTTCTAACACTTTGCCCACCTGCTGCTTTTGTGTTCTCTGACAGTTATCTGGAG
ATGTCTCAGATTTCTCCTGTGATCTCCCAGGGCATAGACTTGACTTTGCTTTTCTTTGTA
CCCCCAGAATTTAGCTTGATGCCTGATATGGGACAGGGGGTAGGATTCAGCAAAGGGAGT
CAGACCTGGAGAGGGGAGTCCTGGGTTCAAATGTGACTTTTGATACTTCCCAGGTGTGTG
ACCCTGGGCAGATCACCTGTAATCAGCTCTCAGTTTTCTTATTGTGGCAGTGATCTTTTA
CCTCCAGACTGCCATAGGTCCTGGACCATTTGTTGTATAGACCTGGGTTCTTCTAGTTCT
CGTTTTATCTTTTTTTAGTGTTTTACCTCTAGACAGGTCACTTAGCACTGGCTGAGCCTT
AGTTTCTTCATTTGTAAAATAAGAGTAATCAGACTTGCCCCTGATATCTCAAAGAATTCC
TTACTGTGGACATCAGATGATTCTATCTCTGTCATAGATCTTGGGTTTTGAAGTCAGAGA
AAATCTTAGAGAGCCCCTGATATTTTAAAGATATGGAAATTGAAACTCAGAAAAGGGAAC
CTGTTGTTTTGTTTTAACTGCCCTTTGGGTGTCTTGGTACCATCCTGCTTCAAGTCCCCA
GGCTTTAGGCTTTGGAGACATTTTTCTTCTAATTCCTCTCCTTCCTGACCTCTCCCCAAT
ATATTTAGCTACCAGATCATGTCCTTCATATCTGTACCTGTCCATCAGACAGATTTGTCA
TCTCTGCAGATAACTCCCAAATCCATGCCTCCCCAAGGCTTTCCTCATTCTCCTGAGCTC
CTGTCCCACTTGCCAGCTGGCTGTTGGGCCTCGCCTCATAGATTTTACATAGGATCTCAA
CTCCACTTGTTGTGTTGGGCAGTCACTGAACTTCTCTGTCCCTCCATTCTGCATTTTTTA
AAGGAAAAGGTAGAACTGAATCAGAGGTGTTAAACCCATCCAACAGCCCCCACACTCCTA
TTGCAACTAGAACCAGATGAACATGTAATAGAGAAATAATGAACAAAAATAAATTAAAAA
TACAGTAAAACAAGCGTTAAGATGTGGCTTTCTAAGTTATTGTGTAGCCACAGGGATCCT
TACATGCCATTCAGTGGCTTTCTGACTCTAAAGTTAGGTTCCTTCATCCAAAATAGAATT
TATCACCTTCCTGTCCCCCCCCCCCCCTCCTCTTAATAATGTTTCTATTGTGGGCACTGC
CATACTTCCATACATTGAGTTCTTAACCTCAGGGTCCTTTCTGATTCATCCCTCTCTTAA
TCCATCCCCATAGCTAATTACATGCCAACCCCTGTTGGTTCTCTCTCTCCCTCACATGCC
AACCCCTGTTGGTTCTCTCTCTCCCTACAACATCTCTCTCTCATCAGTTGCCTTCTCTCC
CTGCTTCAGACCTTCTCACCTTCCCCTTGTGTTCTCATCAAACTAGCCCTCCCAGTGTTG
CCCTCTTCCCCACTGACTCTTAACCTCCCTCTTCCTTCAAAAACATCTTTCCTGTTTCCC
TGAATCCTGGTGCCCTCCATTCTTGAATTTATTTTGTATATACAGGTACTTTTTGACCCC
CACCCCCACTCACTCACCATTGGAGTCAAAGCTCCTGGAGAATAGCCATTGTTCATTCTT
TATATTTTCATACTCAAGGCTGGGTGCTTAAGAAACCATAATAAATGTGTGTTGGTTGTT
TGGGTGATTGATTTTCTTTGAATGCCTTTCTGCCAGCTGTGGGATCTCTGGATCAAGGTG
GTAAATTATTGTATTCACTTTCTTAGTCTTAATTGTTTTGGTTTGCATTTCTCTTATTAG
TGGATTAGAGCAGTCTTTTGCATGGTTACCATTTCATTGTTTTTCTTTGTAAGAACTGTT
TGTTCATATCCATTGTCTGCTCATCCATTGGAGATTAGCTCTTGGTCTTACATAGTAACT
CCCTGTATATCTTGGGTGCCTTTACAGAGATGGGTGATGCAAAGTCAGTGGTTTCTATTA
TTGTCCTGGCTTCCTTGATTTGATCTTACCTTTCAATTTATATCATCCAAATGGCCTGTA
CTCTTGCCCTTCTCTTTTGTTCAGTTTTGAATTACTTACCTAGCCCTGGCTGCTTTTCTA
GTTGTTGTCAATAATAATCATTATGGTTTGGGGGCATCACTTTATAGATACCATCTCATT
TGATCCTCAAAACAGCTCTTGAATTAGACAAGGGCAGGATAGTGTAGGTGACATCTGCTT
TGTAACCTATTTTGAGGTCTGAAAGTATACTTCTGGCTTCATTCCTGCTTTTTTGCTGTC
TTTGCAGGGAATGTTTTCTACATCCCCGTTCTTAGTGCTTAATAACTGGGTTGAATTGGA
GCAAATGGAGTCAGAAAAGTCCCATGCACAGATCCTTGCTCTGGGACAGGCCATTTTGAG
TGACCTTGGATGAGTGACTTTGTCTAGGACTTCTCTGAAGAATGGGGTTGCCATAGCAGC
TTCCCTAGCCTATTGCAAGGAAGATGTTTTCCAGACCTTACAGGGCCCTTATACTGGTAG
AAGCACTGGTAGGCAGGTTGGCAGCAGAGCACTCAGGTCCTTTCAACTTTCATGGCCTCT
TTTGTTTGCTTGTAGGGACTTCTGTATCTTTGGAGACAACAAACAGCCTCTTAGATCTGT
TGTGTTACTATGGTGACCAAGAGCCCCCTAGAGAAGACCAACCTCGTCAAATTGATGGAT
CAGAAGAATTGGTAAAGATCAGTACATTGTGGTTTGGGATAGATTTTGGGAAACCTCAGA
AATGTTCTCAGTAAATACAGAAATAAGACAGGGAGGGAAAGCTAGGTGGCTCAGTGGATG
GAGCACCTGGCCTGGATTTGGGAGGTCCTGGCTTCAAAACACATCTTAGCTGGGCAAGTC
ACTTAACTCAGTTTGCCTGGTTCTTGTGCTTCTGTCTTTTGAGTTGTTATTAAGATAGAA
AGTGAGGGTTGAAAAAAGAAGATGTTGCACACGCGCCGCCCCCTCCCCCCCCCACCCCCA
CTCCTTTACTGTTAGCACTAAGAGAGAGATGTAAAGGCGGAGCAGACATGGAAAGCCCTG
TTTGTTGCTCACCTGACAGCTTCTTTGGAAAACCAAAGTCACTAAAGAAACTAATGGAGA
CAACAGACAGCTTTGGTAAAAGAAAGATCATCTTTGATTCCTCAAAAATCAATTGCATTC
TTATATAGAACAATAAAATCTATGAGGAAATAGAAGCGGAAACCTCAGAATTACTATGAA
ACAAGATTTTCCAAGGCTGTGAAATTGCACTTAGAGATTGTGAGAGTGCAACTGCTAGAT
TTGCTTTAGGATTTGAAAATTGTTTAAAAGTTTTGGAGCAGAAGTTATTCCCTGCTCTGC
ATGGGCATTGACCTCAGCCATAGGGGGGGAATAAGGCTTTCCCAGTGGCCTTAGGCTGGA
TTTTGCTGACTTGGGAAAAGCTTCATTAGGAATCTGAGTTTGTGAAGCAAAGTGCATTGA
GAAGAGCCAAGTCCTGATTTCATCTCTCTGGCTAATTTGTCCCATAGCCTTAGGTCACTT
TCCTCAGTCTACTTCAGCCTCTTTCTACAGGGTGTCCCAAAAGTCTTCTTGCCACTTTAA
GTGATTATGGTTTGAATCTGTACTAAGAATTTTGAGACACTTTGTTACCAGAAAAAAGCA
CCATTTCCTCTGCTTTACATTGCTGCTTTGAGCAATTGAGAATTTTTTAGATGTCCTAGT
GCTATTTATAGGCTTTATACTCCTGAACAGGTTGGCTTTTGACCATCTTCTGCTGATCAC
TCTGAAAGAGGAGGCTTCCCTGCCTGTGCAGATTCAATGTTAGTTCCAGTGCTATCGTGA
TAGGATCCCCAAAAAGGTCTTCTTCAATTTTTTCCTCCTCCCCCTAAAAAAAAAAAAAAC
TGAACTGAACAACACAAAATACACCTCCTTCTTCCAAGAATTTTGTCTCAGCTAGGGAGA
CTCTTTTGATTTCTTTGAAGCTATAACTTGCAGACGTTTAAATACAAATTTAGTTTTGTC
TTTCTTATTTTTTTCCTGACACTACACTGAAATGGGGACCTGAGCTAAATGAGAAGTTGA
AATAAGTGATAAAGCTAGCGTGATTTTGAATTTGGGACCCCTGGGAGAAGTAGAGGTACT
TACTGATGGCAGATAGATATGGGAAGGAGCTTTCAGTGAAGAGCTTTGGCAGTCAGACTT
CAAAGACATGGATACCAGGTTGGCACTGAAAGGCAGGTTTGAGGCATAGAATGTGGATTG
CTGCTTACTTATGTTGGTGATACAACTTATGTGACTCCTATACTGAGGGTAAGTAGGTAT
CTTTGGAGTGATGTTAAAAAGACAATGAATGCCCAGGGCAACTACATGGCTCATTGAATA
GAGCACCTGAGAAGTGGGAGATCCTGGGTTCCAAGCTGAGCAAGTCACTTAACACCCATT
ACCTAACTCTTACTATTCTTCTGCCTCGGAACCAAAATACAGAATTGATTCCAAGCCAGA
AGGTAAGGGTTTAAAAAAGAGAAAAGAAAAAACAGTGCCCAGACACACTGGTCTCAAGTA
CCCATGCAGTAGGCAGTAGCAGTGCCTTTCTCTGCCAGCCTCCTCTCCTCAAGGACCTTG
TCCCTTCCCTCAGCTCCTGAAAACAACCTGTGGCATAACTGAGAAAAGAAGAGAATTTAT
GTTTGGTCTTTGGTTATAAGATACATTTTTTTATATTTTCTTTTGGGAGTAACAACATTT
AGATTGTTTGGTATGTTGATATAAGGTTCAATCAGGATACAGACTCTACGGGCAGGTAGT
TTGGGGTGCAGAAAACTGATTCAGTCTGGCTCTTTTCTGCTCATTCCGCATGTGTTAGTT
CTTTCCCTTTGGCCAAGCCTAATTGTTCTCAGCTCAGACCTCCCTGCTCCATCTTCTGGG
CACACCTTTTCCTGGCTTCTACCTCATAAGCAAGAGCTTGCCCCAACTTGGGCCCATCCT
CCTCCAGGTAGCCTTGCCCAAAGCCCAGGGTGTCTTGGCCATGGCAGCTTCCTGGGTAGC
CAGCCTGCTGAAGTGGGAGGGTTTTTCCCTTTGCTCTTCCTCTCCTGCTTTCCATTTCTT
TTTCTCCTTGCTAGACTGCTGGTGGTTGGGGGCCTGTCATGTCCTGTTTATCCCCAAATG
TTATCCAGTGTGTTAGCTGTGGGGATCCTTTTAGGATGATCATATGTTCAGGAAGGACAG
CGGAGGAAGCTTATTCATGGAGGAGAGAGGATGACATCATTTGGGTTTTCCTCACAAATT
CTAGGGAAGGAAACATGGATGTTTTAGAGTCCTGACAGGAGAGGAGGTTCAAAACTCAGC
ACTGGTCTTGTATGGAGCTAGTGTACACAGTCCTTCCACCCCAGGCCTGGGCTCCTCACT
TTCAATTTAGGCTGTAACCTATAGGGTTCTTTGGGGGATCATTTCAGGAGGAGGCAGAAG
AAAAGCTGAAAAAGAAGGGGTCGAGACGGAAAGCAGCAGCACAGCCTCAGATTACCTGGA
GGTAGGTGTGTGGCCTCTAGCAGTTATGTTTGGGGATGGGGGGAGTCTCAGGATGTGGCA
AAGTGTGGGGGACTGAGGGCTCAGAGGAGCTCTACCAAGAGGTACCCTGCAGATTTCTAA
AAGGGCCTTCAGAATGCATTTGGGAGGCCACCTGGTCCATGACAGGTGCTCATCTCCAAA
CACATGAGTGTTCTAACTAGAGCACATTTTCCCTTTTTTTCTCTTTGTGGGAGATTCCAC
TCCTACTGTGTCTTTATTACTTGTCCAGGACAGCAACACCACTAGCTTTTCTGAAGCCCC
TCCCTTTCTCTGGGAGAGTTTTCTGTGCCTTGGTCTTAACCATGCACATGCATTGTTCAG
TACTGGCCGTATGCACTGTACAGTCTCCACTCAGAACCAGAGGACAGTAGTGTCCGCCTG
GACCTGAGCTTGTGAGTTGACTAAGAGAAGCTTCATTGGTACTGGTCAGTGCCACCCACC
CATATACATGGAGAGAAGGAACTTGAGTGTGCAGACCAAGGCTCCTTCCCATTGGTCACC
CTCCTGCCCTCAGACTAGTCAGAATGCACTGGGGACCAGAGTTCCAGAGCACACTCCACC
CCCACTCCCCCAGCAGCTGTTGTGGGAAGGTTGATGTAAGTAGCTTCATCCCCATCTGAT
GAGAAAACTGCAGTACAGGAGAGGCTCCCTAGTCATGTAGTTGGTCTGCATCAGAGCCAG
AATCCAAGTCCAGCACCTTTTCTTCTGTACCATGCCGCTTCCCTTGGAGAACTTCATGTT
GAGTTGAGACCTGTGGCACACCTGAAACATTGCCAACCGAGGGCCTAACATGAGGTCTCA
GGCATGAATCATTAAGGACTGTTGAAGGTGCCCCAGAGGCAGCTCGAGAGTAGGCTGTCC
TGGATTTGTTTTTTCTGCTGTTGTTTGCAGCCTCTTGATGTGCCATTTCCTCTTTAATCT
AGAGAAAACAATAATGCAGAAAGAATTTTCAATCTAATGCCAGAGAAAAATGCACATTCC
TATTGCACAATGATCCGAGGAATGGTCAAGGTAGGCTCTGGGCCCTGGGGCATCTCCTTG
TTCTCCTCTCCCTTGGTACATTCTCTCCTGTTTACTGGGCTTCCCTTTCTCTGCCTGTTC
TAGTATCAAGCCTGCGAGAAGGCATTTAGCATGTACACAGATTTACTGAACAACCGGCTC
CGTGGTGAGTGCTTTGGGGACTGTGAATGGGGCTGTGTCCTTGTGTTTCTAGCAAGGGCA
CAGAACCTGGAATGTTCTAGGCATATGACAGAAATGTTTGCTAGGCTGCCTGTTTGAGCC
ACTAGATCTTAGCTCAGTCCCTGGGTGGCCTCCTCTTCTCTTGGGGCAGGAGTATCTGAG
GCTTGACCTCTTCCTTTTAATTGACATGTGGTCATTAGCCTAGTATGGTGTTCTCAAAAC
ACTTTGTTTCTTCCTCCGTCGCCGCCACGACCCCCCCCCCCCATACCCCTTTTATCCTTA
TTCCCAAATGGTTTTTTCTTCCTACCTTTGCAGCTGATGTTCATACGTTCAATGTACTGA
TTGAAGCATCGGCCTCAGTGAGAGAGAGACATGAAGAAAGATGGAATCTTATATTGGTAA
AGTTGTTTTATCTTCTAGCAGCTTATTATATGAGAAACTGTAGCTGACCTGAAAATAACC
ATTTCCATTTTTAAAATTGTAATAATGAATTCCATTGTAAATGAGGAGAACAAGATGGTG
ACAAGGTTGTTCTGTAATTCAAAAATCCTGAGTAAGTTTTCCTCTCACTGACACTGAATG
ATTGAACATGTACCAACCTGGACATTATAGAAATAGAAAAAGAGCCTACTCATATTTCCC
TTTCTTGTAGGGATGCTGTGTGGAGACTTTATGGCTGGTATTTCCTGCATAGTGGGCAGT
CCAGGCAGAAAACAGCCTATAGAGGATTCTTGAGTTTGGCTACAGCTTCTTGCCAAATTC
TGGTGACAAATAGAAGGCCAAGTTTGGGAGATGGTCACTTAGCTGACAAATTTTGGGATA
GGTGAAAAGAGAATGCCAAAAAAAGTAAATCATTCCTGGACTAACCAAAATCTAGTTTTA
ATAAAAGGAGATAAATATGGCTTCAGGGATCATAGAATCATTCCCCCAGGGCCATCCCCC
CTCCAGATATATATACTTGAACCTAGAACTGCACTATTTCATTGAAAGAATTTTTTTATC
TTTATTCCACTAGGATTTGTTGAAACAGATGATTGAACAAAAGGTGAAACCAAATCTTCA
CACATTTAATGCCATTCTTCGAACCCTTAGGAAAATGGGTGCCTTTGGGAAAATTCCTGC
CTTACAGACCCTGTGTGAAATGAAAGCCCTCAAGATAGGTAAGGGAGGATCCGGTTTAGG
ACATAGAATGGACCTGGATAGCCAGTTCTGGTTTTACATCCTGTCCTGTATATTCATTTT
TGGTTTTGACTTGCCACAATTAAGAAATGTTATGGGGCAGGTAGGTGGCTCAGTGGATTG
AAAGCCAGAAGATCCTGTTCAAATGTGGCCTCAGATACTTCCTGACTATGTGACCCTGAG
GAAGTCACTTCACCACCACCACCATCACCCCCATTTCCTAACCCTTATTGCTCTTCTGCC
TTAGAAGCAATGCATAATATTGATTCTAAGGTGGAAGGTAAGGGTTATAAGTGTATAGGT
GTATATATAAGTGTATGTGTGTGAATAGATGAAAGACAGAAAGACTAACCTTTATTCCTG
TCTTTGACCTCCTTAGGGTATATGCCCAGTGATGAGATCATCAGCCAAAAGATGTAAATA
GTTCATGACTATACTTGCATATGAATTATCATTTTAAACCTTCATCTAAAATAGCTTTTA
CAGGAGAGATTTTCTCTTTGAGTTCCATAGAATAATATTTTGTGATTTAAGTGCCTCTGA
AGAGGGTTAATTCCTGCTGGTCTTGTTGTATACTGCCCAGAGTAGTACTAGACTGTGTGG
AGTGTTAAGCTATAAGTTAGAGTGTATTGTATATATATGAGGCAGCATGATGTGGTAGCT
CAAGAATCTGGAAGACTTGCTTCTGATATTTCCCTCCTCAACGTCTTTGCTGCTCCATCA
GGAGTCTAAAGCTTTAGGGGGCAGCTGGGTGGCTCAGTGGATTGAGAGCCAGGCCTGGAG
ATGGGAGGTCCTGGGTTCAAATCTGGCCTCAGATACTTCCTAGCTGTGTGATCTTGGGCA
AGTCACTTAACCCCCATTGCCTAGCCCTGACCGCTCTTCTGCCTTGGAACTAATACCCAG
TATTGACTCCAAGATGGAAGGTAAGGGTTTTTTTAAAAAAAAAAATCTAAAGCTTTAGAG
CAGACTGGGGTCTGCATTGTTTATTGCCGTTCTTCATCAGGGGCTCTTTATACCAATGAA
ATCATAAGTCAAGTCTGGAATAGAAATGCCCAAGTGTCAGTCTCCCAGGGCCCACCTTCC
CTTCCCATTGTGTCTGTAGGTATTTCAGGAGCTAGAATAAACAGGTACAGAGGTCTCTTG
GGTACATTAGAAATCCCTGATGAGTTCTCATTTAAAATGCTCTGGTGATTCAATCCTTCC
TTAGTCACTTTGGCCAGAAGAGATTCTGACTTTCTCATCATGCTTAAAGCTCTTTGGGCA
TGGAACTGACCTAGAGAGTGTGTCAGCCAAGCGTTCATGTCCGAAGAGAAGCAGCCATAG
GATGGACCAGTGAACTTTGCCTCTAATTATTACCTGTGATCATTCTGAATATCGTCTGTC
ACACTTTACTACTCAGGAAGATGTTAAGATATCAGAGTATTGTGTTGTGTGCAGAACGAC
TCGTTAATTTTGACCCTTTTAATAGCTTTAGATTGCAGTCAGAATATTCCTATTGACCAG
AGCTCCTTCCCCCGATTTAATTTAAAAGACCAGGAAATAGGTCTCTTTCTATAATTGTTA
GTACATATTTATTTTGACAATTAAGATTTACCTGTGTCCAACTTTATGCTGTGTACATGC
TAATACAGCCTTGGCTTTGTGACCAGGAGGCAGTGAGTATTGGGGAAAGAATGATAGGCT
GGAAGCCAAGAGAGTCTCTCTCTCTTTTACTTGCTATGCTATATGGCTGAGAGCAAGTCA
TGTGACCACCAATGGCTGTGAGAACATCTTGTAAAATGTAAAGTGTTCTATAAATGTAAG
CTATTGCAACTTAATCTTTATTCTTTGTTTTATTCCCTTCCTGGCGATTTTAAGAACCTT
CACTTGCAACGTACCACTATGTTCTTGAGATATTTTACAAAGCCGGTATGTATGACTTTA
TATTATCTCTGTAGGACCTTTGCTTTAAAAAATGGCATGCATGCAAACAGTAATCAAGCA
CACACGATGGGCTTCTGAGGGTGTGGTTACTTCTAGAGCCGTGTATGAATGTCAGACTGT
TGGCCATCATTTGATCCACTTTTTCCATCTTCTAGTTCAAGTTTAGAGTGAGTAGATGAC
AGACAGACAGAGTCTAACCTTTATTCCTGTCTTTGACCTCCTTAGAGGTCAGTGATGAGA
TCAGCCAAAAGATGTAAATAGTTCATGACTATACTTGCAAATGAATTATCATTTTAAACT
TCATCTAAAATAGCTTTTACTGCATAGATTTTCACTTTGAGTTCCATAGAATGATATTTT
GTGATTTAGGTGCTTCTGGAGAGGGTTAATTCCTGCTGGTCTTGTTGTATGCTGCCCAGA
GTAGTACTAGACTATATGGAGTGTTAAGCTATAAGTTAGAGTATTGCTCATGGTCCTTAC
AGAAAGATCAGGGTACAAACAAGCTGGCCACCGTCATGAATATCATTTGATACAGTTCTA
GAAATGCTTGCTATAGCAATAAGACAAGGAAGAGAAATTGAGAGGATAAGCAAGGCAAAG
AAGAAACAGAAGGGGATACCCTTGTCACAGATGAAAGTTTACTTAAAGAACACTAGAGAG
TAAACTAAAAATTAATTGAAACAATAACCAGTAAAATAGGATCATATAACCCACAAAAAA
AGTAGCTTATTGTACATTACTAACAAAACCAAGCAGGAAGGAGATAGAAAAAGAAATTCC
ATTCGTCATAATTACAGAATATCTAAAATACATGAATGTAACTACGAAATACTATAGCAT
TAGAGATAGATCCAAAATGTTGGAGAGGGATTAAGTGCTCATTGTCAGGCCTTGTGCCAA
TTTGATGAAAATAGTCCTCCATTATACTCACTTCAGTACCCTTCCAATCAGAGTACCAAA
GGATTACTTTGTAGAACCTGAAGAAGAAAAAAATGTATATGAACAAAAAGACCTAGAATC
TGATGGGAAATCATAAAAAAAAAAAAAAGTGGGAAGGAGGCCTAGCAATACCAGATCTCA
ACATGAATACAAAGCTGTATGTTCCTGCTGGTATAGGGTAAAAAAGGAAAAACGTGGTCA
GTATACCAGATGAGATTCCTGAAACCAGATGGACAGGCATCATTTTTTTTATCATTCTTG
ACCAAATGAGACATAGATGATAGTTTTTATCCAGTAGAATGGAAAAGTTTCTAGACAAAG
GTCATTGCAGTTAGAAAGGAAACAGGTGAGAGCCAGGCCTAGGTTCAAATCTAGCCTTAG
ATACTTTCTGGCTGTGTGACCCTGAGCAAGTCACTTAACCCCCATTGCCTAGCCCTTACC
ACTCTTCTGCCTTGGGCCTGTTATTGGTAATATTGATCTAGTTTGGGTTTTAAATTTATA
GCTGATTGATCCTTATCAAGATAGGCTTGAGATGTTAGGGCAACCTAGTTTTAAACGGTT
AATGAATTTGCTGGACACAGTTTAATCCAACTATGAGTATAGACAGGGACAGGATAAAGG
AGGTATGAATAAAGTCGGAAAACTTTTATCCTAATTCTAAGATTTCTAAGTATAACCTCC
CAGTCTAAATCCTTGCAGATTTGCTTCTTATTCACCAAAGGTGAACCCCCTTTAAACTAT
TCTCAACTATCTACCTAAGACCCAATTCTGTCTATCTAAATTTATTCTAATACATAAACT
TCCAATATTATTAACCTCCTTAAATTATTTATGAAAATTCACAAGGTGTCTCAACTAATT
CTCTAGATGTGACAGAAATCACTAGCCTCCTCTGACTCTTCCCAGCAGGGGGTCAGACCT
CATGATGTTCCAGTGAGAGCAAACAGCCCTCTACTGGGAGTTTTTCTCTTTCTCTCTCTG
AGAAAAAACTCTAAAAAATCCCAAAAATGTTCACAGATGTTCTTCCAACTTTTCATAGTT
AACTTTAACCGAAATAACTAACAGGTAGTCAGCCAATGAAAATCTTCCTTAAGGTTACTA
CCATGATTTTTCTCTGGCTGTGCTTTAGAAGGGGACGAGGAAATAATTCTTTTCTCTGGT
ATTGATCTCTAGTTCTAATTATGCTAGATAACTAATTAAACTCATCAGAACTAAAAATAG
TATTGATTCTTGGGTGGAAGGTACAGGTTTTTTAAAAAAGAGGGAAGTTAGAAGGGGGAG
AAAGTCTGCAGTAAGTTTCTCAGATAAACTTTTGATGTATAAGAGTTTATAGAGAAATAA
TTTTAATATATAAGAATCATTGCTCAGTAGACCAAATGGTCAAAGGATATAAACATGCAA
TTTCAAAAGAAGGAAGTCAGGTTAGTAACAATCATATGAAAAAATGTTCCAAATAGAAAT
GATAAAGGAAAGCAATTGTTGCCATCAAATTCGCAACAATGAAAGACTAAGTGGGTTCCT
GTCAATTGGCACAGTTACAATTGTGGCATATTAATAGAATTTGGTTGCAGTATAAGAAAT
GAAAGGGATAGATTCAGAGAAACTTGGGAAAGATGTATGAATGGCTAGAGTAAGGAAGTG
AGCACATCCAGGAGAATAATTTATATAATGACAATTCCTTGACAATATTGTCAAGAAAAA
TGGGATTAATCTTAAGAACTATTCAGCATGGTTACAACTCAAGGAAACCAACATAGTGAA
TTGTGAGTCCTACCTTGTAGCCAGGAGATAAGAGACTAGAAATAGTACAGAATAAAGCAG
ATTTAATCAGATGGGATTCAAATTTTTTATTATATTTGTTACAAGGAATGGTTTTTCTTT
TTTTTTGAGGATTAAAGGAGAATAGTCATTATTTTTAATAAAAAAAGAAATATTAATTAT
TAAAATACCCAGGACAACAGAAAGAACTTCACGAGGGGGCACAGACAAGGAGGACACTGT
TGCAATTACCATGTGACATTTTAGTTAAACCCCAAAATACTTCTATGTAGAAGGGGGAAA
GGCAATGCTACATAACAAGTATATACAGTTTCCTTTATGTTTTTCTTTATGTTAAAATTA
CTTTTTTATGTTTATTAAATCCATAATTCTTTAAGATGAAAGAAAGAAGTAGAAATGTTT
CCCGTTTTAATTGGTTCCTCAAGGTTGGAGAGACAAACCAAAGTCCTTCAAAGATGTTCT
TGTTCACTTGTTCTGCAGGCCCATCTGGTAAAATCTTCCCTGGTCAGATGACTGACATCT
TGAACGAGCTCAAAGGGAAGAAGCTATATGTACAGGACCTGGATGATGGTGAGTACCCTG
AATGTGTCAAATGGCCTTTTCATCAATACTTAAAGACCTTTGGGAGATTTGTGATTCCAC
CCCACCAAGCTAACAATGTTTGTGAAGACACTCCTGGAACATTTCACTTGAGCAAATTCC
ATTGGGATGGGATTTTCTTATTATAGGTATTGTTTATTTGTCGTATTTTCTTTTTAAATT
GAGTTCCAGATTCTCATCCTCTCATTCCTCCCATACACACTGAGAAGGCAAGCAGTGTAT
CGGTTACATATGTGAAATTGTGTAAGATGTTTCCATATTAGCTACATCATCAAAAATCAT
TCTTTTTAAAGGCAAGAAAATTATACTTCACTTTGCACTCAAGAATTCATCAGTTCTCTC
TCTCTGGAGGTGGAGAGCATTTTTTCATCCTGAGTCCACTGGAATTGTCTCAAGAGTAGC
TAGCTAAGTCTTTCACCATTTATCATCATTACAACATTGCTGTTACTGTGCACAATGATC
ACCCAGTTCTGCTCACTTCTCTTTGATACAATTCGTTTAAATATTCCCAGTTTTTTTCTG
AAACAGTTTTTCCTGCTCATTCTTTCTTACAGCACGATAGTCATGTGCTACAACTTATTT
GACCCTTCTTCAGTTAATGAGCATGCCCTCAGTTTTTCCAAATTTTTGCCAGCATAAAAA
GAGCTGCTATAAATATTTTGGTACAAATGAATCCTTCTTTGATCTCTTTAGAGTACAGAC
TTGGTAGTGGTGTTGCTGAATTAAAGGGTAGGATATGCAGTTTTATAGTTCTTGGTATAT
AGTTTCCAATTGTTCTCCAGAGTAGTTGTACCAGTTCACCACACCAAGTTTATTAATGTT
TCTATTTTCCCTCATCTCCTCCAACATTTGTTATTTCTGATAAGTATGAAGTAGTACCTC
AGTGTTATGTTAATTTGCTCTTCTCTAATCAGATGTGATTTAGGGCCTTTTTTCATCTGT
TTTGATTTCTTCTTTTGAAAACTTCATGTTCATATCCTTTGACAATTTAATCTATTGAGG
AAATGGTATAAGTTTACCCCTTTCCCATATATTTGAGAAAATGAGGCCTTTATCAGAGAA
ATTTGCTTTAAGATTATATTACTTTAGATTTAAATCACATTTCCCTCATCTCTTTTAATT
ATGGCTATTTTTGCTTTGTCTGAGATCCGTGATCACCAGGGCACTGTTACTTTAATAAAC
TGATTAATATGGACTACAGATCATGCTTTTCACTAGATTCCTTTATGTCTTTTTGTCAAA
GAAAACTTAAAACTTAAAAAAAAAAATTTGAAGCTGTTTCATCTTTGCTAACTAGGTGTT
AATACAACCTTTGTGTTTCTTTTCAGACAAGTTTTTTCTATCAGCTATGAAGGTGGTAAG
TATATTTCTTGCTACTTTCCTGTTTTCAAGGAGACACTTCTCCATCTCTAAATCAGACTC
AAAACTAGCTTCCACTGTGCTTTGCACCTTTCCTACCCTTTGTTTCCCATTCCATTGCTG
TCCTTTCTTCCATACTTTGCTTTTTTTTTAAACCATCCATCTTAAGGCAGGGGGGGTAGG
CAATGGGGGTAAGTAACTTGCCCAGGGTCACAATTGAAAGTGTCAGAGACCAGATTTCAC
CTCCAGGCTTGACTCTATCCGTTGAAGCACTTAGCTGCCCCTCTTTCTTCCAAACTTGAT
TGAGTTTCAAATTTTGAAGGTCAGAGTGGCAGATTATCCTGGCTGGGCAGGCCTTGATTC
TGGTGTGAGACCAGTTGTGTCCCATCTGGAAAAGCTCAGGTCTAGCCTGGCTTCAGCAGG
GAGATGGTGACCTCCAAACCCCTCAGCAGTAAAGGTTACTTATTCTGAGATTGAGGCTCC
CTGGGCTTCACGTGCAGCCATGTGGGTCTGTCCCCATTCCCAGCCAGTGAGGAGGCGATT
TCCCTGTAGCTCGCACTCATTTATTCCCCTTCCCTCCTCTATAGTGCTTCATGCTGAAAG
ATCTTGACCTCGCCTACCAAGTCCATGGCCTTTTAAGGTCAGGTGACAACTGGAAGCTGA
TCGGGGATCCCTTTCAGAGTGTCTTCTATTAGTAAGTTGGGAGAAACATACAGGAGCATT
GACTGTTTTCGTTATTCGTGCATTTGCTTCTGGGCCTGCGTGACTAGACAGGTTGGAGGC
ACAGACTGTTCTCCCCACCAAGAACCCAGAAAATGGGGGGCATCAAATGCAAGATGATTA
AAGAGGTGTAGCAAGGGGGTGTGGGTGTTGTATCCCAAAATAGCAAAAAACCTGACATGG
GAGGAGGAGATCATTGGTTAGAGTTCCCCTAGAGTTTGTCTGGTTCTAGTGTTTTATTGA
AGGAAAGCTTTGGACATGCCAGAGCCTGTCTAAAGTGTGGGCATGTCATAGAAAAATCAA
AATGCTTCACGTTTAGCTGGACTCGTGGAGGGATCAGAGGCCATCCATCATGTAGATGTT
GGGTCAGAAAGAGGCTGAACTGCGGGTGTAAAAGTGTGAAATCAGCCACCTTAGGAATTG
GTGGATTCCCCCATCCCTTAAGGTCTTCCTTTGTGCAGACGATATTTGGACCCACTTCCT
GGGGCTGTTGGAGAAAGTATTCCCATATAGCACCAGGGCTTCTGGGGCCGCCTCCTCTTT
GAGATGCTGGGGGGCCTACCTTAATGGCGAGAACAGCTAGACTAGTCCCAGATTCAGTGA
GCCCAGCACGTGCCACACACAGTTGTCCCAGAAGAAGTGCTTGCTTCCTGGCAGCTTTGA
TTGCCTGTGATCGGAGCTGGGACCCTGAGTTTGTGTCTGGTTGAATGGCTCCAAGGCCTA
GAGAAATGTGTTTAGTCTTGACAAAGCTTGTTGTCTTCCTGCAGTCAGAAGTTCTTCGGC
TTATTGTGCCTCATGGAGCAAATTGATGTCACTCTGAAGTGGTACAAGGCGCTGATCCCT
TCTGTAAGAAGCTTTGTCTCTTGTCGTCGTTTGAAGATGCCTTTGTGTCTGAGCACCTGA
TCTCTTGGAATGTGAAGGCATGTTCTTCTTTTCCAGGTCTGCTTTCCCCACTCCTACCTC
ATTCTGGATCTTCTCCAGGCCCTGGATGTGGGGAACCGATTAGAGATGATCCCCGAGATC
TGGAAGGGTGAGCAGTCGCCGCTCGGACTCCCTACCTTCCCCAGAGTTCTCCAGCCATTG
GCAGGGTTTCTTAGATAAGCTATTGAATGCCTCTGGGCTTCAGTCTCCTCCTTTAAAGTG
ATGAGGTTAGATTAGACAAGGCTCTTACAGTGCCAAAATCTTAGCATATTCCCTAACCAT
CCCCCACAAATTTGGCAAAGTAATATGGCAGCTCCTTAGTGCAATGGAAAGCTCCAGGCC
TTAAGGTGAAGTTCAAATATGACCTTGGACACTAACCCCAATTCTAATTCCATCTTGGCC
TCCACCTGCCTCGGTTTCCTCAACTGCAAAATGAGAATCATACTAACTACTCCCCCTTCC
TAGGGTCATTGTAAGGATCAAATTATTTAACATGTAAAGCTTTTAGCACTGTGCTGAGCC
CATAATAAGTACTAGATGTAATTATTTTCATTAATAGTATTCCTATTATTGTCATCACCT
GTATCTGGTCATCTTACTGTATGAGGCCAGTGTCTCAGCTCTCAAGGCTGATCTCAGGGC
AGCCAGGGCAGGTGGGTGCTTTGTCCAGAAGCTTTCTGCCAAATGCCAGGGTCACAGCAT
GTGTTCCTTGTTTCCTCTAGGAGCAAGGGGAAGTGGCAAATATTTAGCTTCTTCCATTTC
CAACACCCTCTCCCTTTTTTCTGGGAACTTGGGGGGGAAGGTGGAGAGAATTGTCAAACC
GAACTTGCTACTTTGGTGTCCTCTCTCACCCAAAAAACCTAGAAGTGGTGGGATTTGGCC
AGCAAATCTGCTTTGACGGTGGAGGCGATCACTCTGGCCACACTTTCATTTATTTCTACT
TGTGTCTTATTCCAAGATTGCAAAGAATTCGGTCTGAGTAAATGGAATAATGTGAGGGAG
GAGATCCTGGAGCTGATGGCCAGAGAGAAGCAGCCCCCAGAGGTAGGACAATGGAAGAGG
CCCTTCACTCCCCGAGGTCAGGGTGATCCTTTGTGTCCACATGTGAAGGCAGAGGAATCG
AGAGCCTTGCTTCCTCATTCCCTGCCTCAGTTTCTCCCTCTGTACAGTGAGGATACTGCC
TTCCCAGAATGCCTCTAGCAGTGAGTGCAAAGCCCATGTGGCAGTTATGCTGATGACCAC
TTGTTCTCAGGTCCAGGAAGCATTTGCTGACTGTGCTGCCGATATTAAATACACTTATGA
AAATGAAGACGGGGTCAAGGTGGTACCAGAGTGGCCCTCCGGCCCCATGAACTATATCGC
CCTTCTCCTCCTCCGAGGGGGCAGGACCCGGGAGGCCTGGTAAGGAGGATCCTGGGGCAC
GCTGGTGTTCAAAGCTTGCCCCTCCATCTCTGAGAGATGGGGCTCCAGGGCAGGCTGGGC
AGGAAGCGTTTTGTTTTGGGGAGAGTGGTTCTTCTCACACTGGCGCTTAGGGGTCATTTA
CCCCATGTTTGGCATTTGTGTCTGACCTAACTGGGGGCATGCTGCCTTAGCTGGCTTGTG
TACACCGGCGGTTCCCCCTCTACTCCCTCTGTCTCTTAGAATATAGTCCGAGACTGAGGC
TCGGAGCAGGCAGAGTGGCTGCTCAAGACTATGTGAGTAAGTCTCCAAAGCGGGATTTGA
ACCCATGTCTTCTATGCTAATGCTCCTGCCACTGTGCTATGCTCTTCACTTATTTTTAAA
TCCTCTCCTCCCCTCCTCTGGGGCTAGGCAGGGGGGGATCACCCAGCTAGAAAGGATTTG
AAGCCACATGTAAACCCAGGACTAACCATCTCCAGGCCTCTCGTTCATCTTATGTCCAGA
CTAGGACCTAGGCTTGTCCGTTAGCCAGTTGGGTTGGCCATCCGTGGGTCTGCCTGCATC
CCTGTGAGGTGGGGCAGATGGAACTCTAGTCTGGCCCATACACAGAGGCTGTGATGATTG
GCGCAGGGGTACGGACCTCAGCTGAATCATGGGAGCTGAATGTATGTGTGTCTCTGCCCT
CCTGCATGTGGCAGGTTGATGGGGAGCACTTACATGAGACTGGTGCCTAAATCTGAGCCT
CAGCCCCACACGGCGCTGCCTTGGGGGCTTCCACACAACGGGGCTGCCTGATGAGGCTCC
AGGGAAGCTCGGAAGGGGGCCCTGATCCCCGGAGCCTCTCCGAGTGCAGTGTTCTCTGGG
CGTTTACACTTTAGTCTGATTCTGCTGCAAGCTCAACCCCCTGGCCTAGTGTGTTGTGGG
AGGCAATGAGGCCTTTGGGAATTTTATTTCAAAAGAAGTAAGCAGTGATATTCCGTTATT
CATCCTCGGACAAGAGGCAGGAGCTACGTAGCTCCTTTAGTTCTACTGCTTTAGGGCAGA
GAGCAGGAGCTTCCTACGTGTTGGTCAGTTCTTGACTAAACAGACTCTTCTGATTCTAGA
CCCCAACCTCCCACCCCAGTTCCGGTCCTTTTTTAGACCCAGTCAGCCCCCTCCACTTCC
CCCGTTTCTCGGGACACAACTAGAGTCTCTGGTCTATTTAACTATCGTTCCATCCCCATC
TGTCAGGCAATGTGGGGATACCCCTGGAGCGCTATTTAGGGATCCCCTTTGTGAATGCCT
GGGAGGAATGGAAGCGGCAGGTGTCCGGGCCCTAAAAGATCCGTCATCTTCTCTCACACA
GGCAAATGTTGGAGTATTTCAAGAAGCAAAACAGAATCCCCCAGTGAGTTCCCGTGATCT
GCTGCCCCATCCTGCGGGGACTTTCTGCCATCTTGGGTGGGTGGGTGGTGGTGATGGGCG
TGAGCACAATTGCCATTGGATTTCTCTCTCGCAGAACTGAGCTGATGAATGAATTCATGG
ACAGTGCCAAGGAACACCACAACTCTGCCCAGGCTGTGCACTTGGTGGAGCTGGCCCGCG
CACTGAGCCTGGCCGTTTGTGAGCCCCTCACCCAGAGGGTGCTGGCTGATTTCGAAGTCT
CCAAGGAACAGAGGTAAGCAGTCCCTTTGTTACTGCACCCCTGCCTCGGGGAAAGCACTG
CTAGGGAGCAGACGGAGAGTGGGAAGAGCCTGGGTGGACCCAGGCTCAGGAGGCCCGAGG
GGTCTCTTCCTACATGCTTTGAGCTTCATTGTCTCCTCTGCAGAATGGGAATGACACTAT
TCTGGAAGGGGTTAGGGGGCAGCGAGATCAGAGGCGATCCCTGCTGTCCTATCCTGTAAT
CTTGTTATCGGGAAAGGCCCGTGGAAGAGCGTGACAGACAGAGCAGATGGGCTGATGCGG
CTGTGCCTGGCTGCATGCTTAGCACCAGGAGTGGTCTTGGAATCTATGGGGGGCCAGGAA
ACCTGTAGATAGATGGTCACCCTGGGATCCCTTTGACTTTTTTATTGGTATCTTGTGTTT
ACAAAATAATTCCCCTGGTATCGCCCTTCCTTCCACCCATGTCCCGTTTAAGATCTATTT
TTAATTGAGTAAATAAACAGTCCATTTTAATCTACATTTGAGCCGGCACTGGGTGGGAGA
TCCTGAATGCACTGGCCGAGGCTCCTCGCCTTTGGTCTGAAAGTGAAGGGGGCTGGGATC
TGTGGCCGCGTTAGAGAACAGGTCACGCCTGGTTGTGGAGATTGGGAAGCACCCAGGAGA
CAGAGAATGCCTGAAACTTGGTTTTCCTGCAGAAAAGCCCTGGAAGCCTTTTCTGTGACA
ACCAGCGACAGTGACAGCAGCAGCGACAGCGACAGCAGCAGCAGTGACAGCGAGTGAGGG
GCCATGAAGGACTTTGCTCCCAGGTGTGTCTGGAGCCGGATTGACCAGTGATGGGGGAAA
GAGGGGGCTGCAGGAATAAAGACGTTCCTCCCAAACCCAGCCGACTTGTCGCTCCTGGAA
GGAGGGGAGGCGGGAAGGCACTTATGTTAGAGGGAGGATGGGAGGGCTGGGATCCAGGGA
TCGATGCCTCAAACCCAGACCACACAAGCTCACACTTTCCAGAAGACGTGTACACCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1058, 1207..1243, 3074..3119, 4241..4309, 6061..6165, 6566..6689, 9375..9490, 12230..12300, 13262..13349, 13443..13503, 13833..13915, 14533..14677, 16554..16604, 19818..19907, 21266..21294, 21884..21990, 22784..22862, 22956..23046, 23896..23981, 24190..24338, 25681..25722, 25834..25996
1001..1058, 1207..1243, 3074..3119, 4241..4309, 6061..6165, 6566..6689, 9375..9490, 12230..12300, 13262..13349, 13443..13503, 13833..13915, 14533..14677, 16554..16604, 19818..19907, 21266..21294, 21884..21990, 22784..22862, 22956..23046, 23896..23981, 24190..24338, 25681..25722, 25834..25993
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved