Monodelphis_domestica Locus CNOT1
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica CNOT1
Monodelphis_domestica
CNOT1
1
SNORA50
59521..59658
97192
GCCAGGTGTAAAGCACAATAGACTACAATTCCCAGCATGCCTCACACCAAGAACTACTC
CCTCAACAACTTTTGACCCCCAGGGAAACTACACATCCCAGAACACAACGCGCAAGTTCT
CGTGTCCCTCGCTCTGGGTTGTGTTGCAGCATGGGAATTGTAGTCGGGAGCTTTGGGGGG
GGGAGTCCAAAAGAGATGTTTGGAATAGGGTTGCTAGGGAATATCCCTCATTATTCCAAA
GGAGAAGTGGAGAGGGAGATCCAAACTGTCACTCTGGTCTCTTGAATGGGGATCCTTGAG
CCATGTTACTTTTGAAAAAAAAAAGAGAAGAGAGAAAAGCACTGCTGGTGCAAAAGAAAT
TCCCGCCTGTGGTCTTTTTCCTATCGCCCTATCCCGTCTGCCCGCCCGCTCCCTTCCATT
TATTGTTGCTCAGGGATGCAGCGCCTCGATCCTATTGGCCGAAATCCTCGAGAGCAGGAG
GGACGTAGGAGAAGCCCGAAATCGAAGCATCGGCGCACTCTCATTGGCCCAATACACGAG
CGCAGGCGCGAGCGGCTGTCTCCAGGTCCCGAGGGACCGGTCAGCGGTCATTGGCCAATG
CCCGCGAAAGATGAGTTTGGATTGGTGGTTGATAGAAAGAGCCGGGCTTCTTCCTTACTT
TCCTCGAGTGATAGCATGTGATTGGTTTAAATCCGCGGTCTCGGGCCGCTGATTGGGTAC
AAGTCACAGGTCGGGAACTATGATTGGTCCGGGTCCAGGACCTCCCGCCCCGTGCAGGCA
GCGAATGGTGAAATGGAAACGGGGAGGGGAAAGGCCGCGACGTGAGCGCGCGACCTCCGG
CGCCATTTTGTCGAGAAACAAGCGGAGTTAACCGAAGAAGAGAGAGGGAGAGAGAACGAG
AGAGGAGAGAGGGAGAGAGAGAGGAAGAGAGAGAGAAAGAGAGAAAGAGAGAGAGAAAGA
GAGAAGGGGGGGGAGGAGGGACGAGGAGAGGGAGAGCCCGGGACCCAGGAGCCTGCCTGT
GTCCAGCGCCCCCGGAGCCGCCTGAGGTGAGCCCGGCCGGAGCGGGGCCCGGCGAGTCGC
CGCCGCGTCAGCTCCGGAACGCGGACGCGGGGTTGGGGGAGGGGAGCGGGGCAGGGGCTG
GGGGGGGGGGGTCCCGTGGCCATAGGAGGCGCCTCTTCCCGGGCCGCCGAGGAAGGGAGG
CGGGCGGGCAGGGCCTGGGGCCCGGCCGCTCCTGGGCCCTCTCCTGGGCCCGGTGGGAAG
GCCCCGGCGCTGGAGCGGGCCGGAACTGGGCCGGGGCCTGGGTCGGGGCGCGCCGCAGCC
GCCAGCCCGGGGACCGACGGCAGCTTGCCCGCCGGGCCGCGCACGTTGTCAGCGCCGAAG
CCCGACCGGGCCGCGCTCCTCGGGAGGGAGGGGAGGGTGGCCCACACCCCGGCCCACTCC
ACGACACTCGCGCGTCCCCACGTACACGCGCGCACACATTTACTCACACGTGCCGCCCCC
TCCCACTCCGCAGGGGGCCCTGAGCCCCACATCCTTACTTTACTCTTTGCGAACTGGACC
CTGCAGGCCTCTTTGCAATGGAGGTGGGGGGGGGGGGGAAGCCGGCCGGAAGCACCTACT
GTGTGCTTACTCTTCAGGGCCCTCTTTGGGCCTTACTTTTTATAGTCAAGCCCACAGGCA
CTTAATAAATTCTTACTGTGTGCTTAGCCTTCTGGGTTCTTTCTGGACCTTGCTTTTTAA
ACTGAAGTCCATATAAGCACCTACTGTGTGCTCATCCTTTAAGGACCCCTCATGACTTTG
CTTTATAATAGTTAAGTCAGTTCGTACTTAACTTACTGTGTGCTGAGCCTTAAGGAACTT
TTTGCTTTTTATAGTTATTAAGCCCCCTGGCACTTAATAAGTGCCTGTGGTGTATTGATA
CTTTAGGGTCTTCTCTTAACTTTGCTTTATAATAGTTACACCAAATAGTATTTAGTAAGC
CCCTACTGTGTGCTCATCCTTCAGGGCCCTCTCTGGTCCTTGCTTTTATAGTAGTTCCCT
GGCACTTAGTAAGCACTTAACTGTGTGCAGATCCTTAAAGCCCTTCCCCTAATTTTATAA
TAGTTAAGTCAGCTAGTACTGAGTAAGTGCCTACTGTGTGCTCATCCTTTACTCTCCTGA
ATGCCTTACATTAGTTATTCCAGTGAGTACTTATTAAGTGCCTACTGTGTGCTGACCTTA
AGGGACCTCTTTCTTTTTATAGTAGTCAAGCCCACTGTCACCTAGGAAGCTCCTGCTGTG
TGTTGATCCTTAGTGGCCCTTCTCCAGACTTTGGTGAATAATGGTGGAAAGGTCAACTAG
CACTTGGTGCCTACTGTTTGCCAGGGCATACATACAAGGAAATATAGAAAAGGGAAACTT
CTGAATTTCTAAAACAAAGCTGTTTGTTATCCACTTGACTTGAAATGGGATCTCTAACTC
CACTGGTAAAAACTTTTCCCCCCTCTCTTCTTTTAACAAGTAACCCAGGTGAGAATACCT
CAAAACCTAAAGCTTTTTTTTTTCTTCCTCAGTCCAATGAGTGATAATTCCTTTTCTCTG
CTTACCTTACTATCAATTAGGTTAATTGGGTTTGTCTGAGATTTAAAGAGGAATAGTAAA
TACTTTGGGATGTGTGAGGAGAGAATAACTTAAAAAATGAAAGCTGACGATTTTTGGAGA
GGTTAGTTTTCTGTAATCCAGATGAGAATTACTTAGATTTCAGAGATTGGCCATACATAG
TATTTTAGCAGTGGGTTAATGTGACATAGTTACTGTTAATAGCTCACATTTCAAGAGACT
GAAACTTGTTACATTGTTTTTTTCTGAGAAAGACTGGAACTAAAACTACATATCTGTAGC
TCCAATAATAAGTTTTTAGACCTCTCTTTTGAGTGTGTGTATAATGATAGCATTTTGATA
AGTTCTTTTGGCAGTAACAGTTTGGGTCCTGGACCCTTTAAAGGAAGTTGAATAAGGTAC
CAAAGTTTTAGGTACCAAAAGTGAAACATCCACAAGGATTAACTGAAGCTGTTCCCTTGA
TCCCCAAAATGGTCCACTTCAGATTGAAGAATGTCACAACCTACACATCCTTGAATTTTT
CACCATTGTGCAAATGCCAACAAAATTCTGTTAACTAAAATGTACTTAAAATGAAGTAGC
CACTTAAAACACTCACACATATTCTTGACTGAATTTAGAAATACAACTTTTTCTTAAATG
TAATTGCAGTTTTGTTAAGCCAGACACCGAGTTTTGGATCTAATTGCCTAGTTTTTATAC
TACCTAAAATTTGTGATCTCCCAGAATTTAGGCAAGATGTTGACCCAAAAGGAATGTAGC
ATTTTTTCCAAAAGAGGGAAATTTCTTTGGTATAGTACTAGTACTATGCTTTTAAACAGT
TTTCAAACAAACCAACCAAAATTGAATAATATTGGCACTTCTTGTGGTAACAAGTGGGAG
GCTGCCATTTTGAAATAGCACTCTTCAGTAACTTGGTATATTTAATTATGGCAATAGAAC
AAAATGTTATTTTCAGGAATCTTTAAGAAAAAGAAAGTATTGACTAATGTACTGACAGTC
TAAAATTCTGCATTTACTTTGTATTCCTGACCATATTCCAAGTCCTCAGACCAAATCTGA
ATTTCCTGCTGGGAAACTTCAAAATGGCATCCTAGGGAGACTTATCAATTTTAGCTATGA
AGACAGAAAAATTAGTAATGCTACTTTTGCTTAAATCTTGAATCTTAACCATTAAAAGTA
ATAGGCATAAAATTGATAGAAAAATTTTTTTCTGATAGGCAGTTAAAACCAATTAGAATT
TCTTTTGCTTGGACTTGTAATTATTCATCATTTTAAATTAAAAACCAAACTAAACATGAC
CTTTGAAAAATGTTCTGCATGAGGAAGCAAATTGCTACAATTGAAGAAAAGCAGGAATTG
AAGGAAGTTTCGTTGTGTCCTATAGTATAGTCACTCCATAAAACTAGAATAAATATTTCT
GGGTTCTATCAATGTTTGTCATAGTTACTAAAAGATTCCTAAAATGTTTAAGTGGATCAT
AAGATCTATAACTGTAACATTGATGGAAAGTTTTTCAAGTGTCAGAATTTCTGGCTGAAA
CTTACCCATGTATTCTCAGTCTACTTTCTGTAGCATTTTACCTTTCTGCACAAATATATT
TAGGAAGCCTCAGATTTGTTAAATATTTCCTCACCCAGACAAGCAATTTAGTTCTAAGTA
AGTAATTTTATTTTTAATTCAGTAAGGCTATTGTGGGATGAGAAAAGGCAGTAAATTTTA
TGTCAGTAGAAAAGGTGTCCACTTTGGAGCAAGCCAGAAAATAGTTTTTAAATGTAATGA
TGTTTTGAATTTAACTTGATTTTAATTGTTTTGTGATTTAAAATATGCTTTTAAATGTAA
TTTACTTATTAATCTCTTAATGATTTGAATAACTTAAATACATATTGGCACCTGAGATAG
TCAGAATCTGAGCCTTTACAGTGCAGAGTGAATAATCTATATATTATAATGTTTCTTTAT
ACGAAAAACAATTTTTGCCAGGTACTTTGAATTGCTTTGGAATATTCATACTCCTGTGAC
CTGACTGCAGTTCAGTGGATAGAGAGCACTGGGCTTGGAATCAAGAAGAATCTTTGTTTT
GTTAGTTCAATCTGGCCTTACAAACTTCCTAGCTATGTGACTTGGGACAAGTTCACTTAA
CCCTGTTTACTTTGGTTCCCCATCTGTAAAATGACCTGGAAAAGGAAATGGTAAACCACT
TCAGTATCTTTGCCTAGAAAACCTCAAATGGGGTCACAAAGAGTTGGACATAATTGAAAA
ATGACTGACTTTTATGTTGCATAAACTTAGGCCTTCAGGAAAACATTCCTGTTCCCAAAG
TCTGTCATTTCCTTAAGAACAGATTGGCAATAAATTGTATTGCTCTCAGCTTCTATTACC
AAGCAAGGTTGGATCTGTGAAGTTTTATCAATGTATTTCCTTTCATAGTTCAGATTGAAA
CCTCTTTATACCTGTACTTTTTCAGCCTGTGTACTCATCTCTCTGTGCTGTTAAATCAGT
CCTTCAGGAGAGGTTGGACTAATGTGCTGAGGGCTTTCCTGTAGTTCTCTTGTCACTCTT
GGGTTGTAACTCTTTGATTTGCTTCTCTTGGTCCTCCCTCCTTGGCACAGGGCCTGCCAC
ATCACTAAAGTGCTTCATAACCATTTGTTGATTGATCTAACTCCGCCTTTCCTGTCAAGT
TTTCTTGATGCCTTTTACAATTTACACTAATCCTCCCCCAAAATTCTTTGGTAATGTGCT
GCTGGTCAGTCTTATCCAACAAGCCTCTCCATTACTCTTTGGATGACTTACAACTTTAAT
ACTTTTTAGACCACTATCTTAGATCGTAGAGTTTTGTAGCATCACTAGAAGTCTATTGAT
AAAAGGATGGGTCTTTGTTTCAGGAGATGCTTGAGCTCTTCAAAGTTGTTTGCAGTTTCC
CAATTACAATCATGCTTAACTTTCTCTCTTTTAATTCTAGGTCCAGTTCATTCATCCTCT
ATATAGTGTTTGTCCCAGAAGTATATGGATTGCTCTATATAATTTAGATGGCAGTTGTCC
TTTATCTACTTGTTTTTTCTTATATTGATAGTTAAAATTCTGGGCCATTATGGATTTTAG
GGGCTTTGAAATGTCCTGGAGCTTAACATAACTAGCACAATTGTCATTTTGTAAAATATC
CTCCCATTATAAAAGATAATTTCAATTTGAACTCTGCTGGGGTATCCACCCTTATTCTTT
GTAGTGTCTTATGTTTATCCCCTTAAAGCTCTTCTAGACTAATGCTAATTGCTCACCTCC
TTATGTCATTTAATCTCCCTTGGTCCAGTTTTTTTTTTTTTTATCTGTAAGGGAAAGGGT
TATGTTAGATAACTTCTAAGCCCCCTTTAACTCTTAACACTATGATCTTTCTCTCCAATA
TATTGTCCAAGGTACCATTTTTAAGAACTAACATCATTGTGGTTTTGTGTTCTTATTGTT
TTCAACACATCTCTTACTCAGTCCTTCCTTATAGTAATCTCTTAACTAGTCTTTGTATAG
AAAAGGGCAACAAGGTAGTGCAGTTGATAGAGCACTAGACTTGGAATAAGGAAGCTCTGA
GTTCAAATCCAGACTTGGGCCCTTAGCTAGCCGAGCGATCCTAGGCAATCTGTCTCAGTT
ACCTCAGCTGTAAAATGGGGATAACAACAGCACTTATTGGAGTTGTTGTGAATATAAGTG
GGTAAATATTTGTAAAGCACCTAGCTCAGTGTCTGGTACATAGAAGAGGCACTATATAAA
TGTTAGCTAATATTGTTGTTAGTCATTACATAAAAAAAGGTAAATATTTCTTGGTTCCAT
AAAAATGTCATCGTTTCTTGTCTACATTTCTTTCCCTCCATTGTTCTTGGTATTCCTCTA
CTTAGACAATCATTTGGGGGGAGAGTCTATTGTTAAGCATATCCAGCCTAAATTCTAATT
TGACTCTAAATGAGAGGTTCTTAAGTTTTTTGAGTGTGTTAAATTTGTGAATTCATTCTC
AGAATAAATATTTTTAAATGGACAAAATAAAATATATAGAATTACAAAGGATACCAATTG
TATTGAAATACAAAAAAAAATTTTAACATTCATGAACCCTGAGTTAAGATTACTCTTACA
TTAGACCCTGAACTGATCCCCATTCATCTACTTAAGGCATACTCTTTTGCTTTGCTATTC
TTTTTGCCTAGCATGTTCTTGCCTATCTGTTGAAATCCTTCTTTATTTCAAGGACCAATG
AAAAACTTCTATGACCAACCTTCCTTGGACTTTCCTTGTTTCTTTCAAGCCAGAAATCAA
TTTTTCCTCTATATTACTCTACCACTTTGCTTGACACAGTATATGTTCTGTTGTATTTTT
TTTAAACCCTTACCTTCTAATTTAGTATAAATTCAAGACAGGATTTCCCCCCTCCCCCCT
TATGGTTGTAAACTTATTGATGACTTTTTGAGCAGTTTTACTGTGGAAGAGTAAATAGGA
GCAGTAACATTATCAGAACTGAAAGCAAAGAATTAAAGACTTGAGTTGTTGAGTGGTCAT
AAAACTGATCATGAGGCATTTTTCTGGGTTGTTGCCTGAACAAGAAATCATTTACCATCA
CAAAACTTAAAAGATATGGCGCACAGTGGAGTGGGTTGACTTGTCCAAGTGAGAGTTGAA
AGGGATACTTTTCGTTACTGTGCACCAATATGCTTGGTGTTGTAACATAAGCAATTTACT
TATCACACAGTGAATCCTTACATATACTATGGAGAGGAGAATTATTTGGCATTAATGCTG
TTTCATTCTTAAAATAACATTTAAGAGTTTTTAATTCTACCATAGCTGTAGATCTGGTGC
TCTCTCAAATCCTAACTTTTGCTGGAAAAGTTCACAAGCATGCTAATGTATAAAAAGGCT
GTCTCTTAAGAAATGCCCAGACAAAGCTTAATTTTGTTGTAATTTGTGAATCTCTTAAAA
AGGAAGTAAATTAAGGTGGAAAAGTTATTTAAGGAAGAAATGTAATAACAGAGAAGCCCT
CAGTGAGGCAGTCACTAATAATGTTTACTTGAAGTATGGATTCAAATCTCAGACTCTTGA
CAACTTTGTTAACATTTTCTATCATTCTGCCCTGTTTGACTCTAGGTAGATTTCAAGGTT
GACTACTTTCTTTTTTAATGAAGTTACTTAAAGAACACTTTACAGTTGTTGATATCTTAC
ATTCATACTTACTATGTTGGAAAATTGAGTTTAAAACACTGGAGAACATACTACTTAAGT
ATCCATTTAAATATTAGAGTTAAGTCTTAGGGGGTTAGAATTTCAATTCCAATTTTCCAA
TCCCTCCATTTCCCCCCCCCACTCTCCCTTAGCCTTAACCTTTCTGGCTTCCTCTTGTTT
TTTAACCTTTAAGATATGAGGGAACCTAAGTAAACTACTATGTTCAATAAAATTGATTCT
TAAGCTCTATTTACTATTGCAGACACTCCTATCAATCTTTTAGTCTTTCTTAGATGCCAG
CAGCACTGAGAGTTTGTCACTTACTGACTCACTTTGCTATATGTATTTGAGGCACGACTC
GATTCCAGGTCTTGACATTGAGGTTAGCTCTGTCCACAGTGTCATCCTGCCATGTGTCAT
GCAAAGTATGTTAAGATTTACAAAATACTATTAGATGGAATAATTTTCCATCTAGTCGTA
TAGTCTGGGTTGATTTTTAGTAGACCATGAAAGTTAAAAAAAGGTTTGTATTTTAAATTG
AGCAAAGCAAAATGCTTTTCCTCACTGTTTACAATCTAACCATTTTAATGGCATATTCCT
GGCAAATTCTTAATTTCTAACTAATCTATTCCTGCAACTAAGCATCTTTTTTATTTTATT
TTTTTAATATAGCTCCTTCCTCCTTCTAGGAAAAGAGTAAGCTATTCAGTATCTTTCACC
TATGAACATAAATTATTTTGGTTATCCATGTTTGGATTAGTTCTAGTTGTCCTTCTATTA
ATAATCAAAAGTTAATATAGGAACCACTGATAGCTAGTATGCATTTAAAAGAAAAAAAGA
AATGGAACTTGTGGGTTGGAGTGTTTTTTTAAGTTTTTTTTTTTTTAAGACTACAAAGAA
TATTAAAAGTGTCACAGTTATACTGTTAAATAACTGTTTAACAGATAAACCTTAAAAGAC
TGATGCTACATTTATCCCCTTTTTACTCATCGCAAAATGACCAGTCTAGATCAGTGTTGG
TGAACCTTTTAGAGATGGAGTGCCAGGTTCTGCCTCCACCCCCAGACTGAGTGCTGGGTA
TAGGTGCTGCACACACCCCCTTTATTCCATCCAGGGGAAGGAGAACACTCCCATTGGCCT
ACTGGGCAGAGGGGCCCATGAAGTAAGGACTGCCCTCAGGAGTGTAGAGAGGAGGAGGGA
AGTGTCCTGAGCTCTCTGTTCCCATCCTGCTCTGCTGCTTGTGAGCCACCCATCTTACCC
CCTGTGCACTCCCAGTGAGCTGCTGGGCAGAGGGGGGCAGGTGATGTGAAAAATTGTCTT
CAGTCACTGTGAAGAGGGGGAGGGGAGCCAGCTCTGCCCGAGTTGTTCTGCCTGTCTAGT
AATGAAGTGGGAGTGGGGGCATGGCCCCTTGCCCACAGAGAGTACTCTGCATGCCATCTT
TGGCACCCATGTCATGGGTTTGCCATTACTGGTCTAGACCCTCCTTACCCCTGGACTATA
TTTTCCTAATCAATCTTCTCACATCAATGGAGTCTCTACTTCTGAATCCGTTTTCTATAC
ATCTACCAAATTGTTGTTCTAATTAAAACACACATCTGATCAGATCACTCACCTGTTGGA
GAAGCTTCTGTGGTGCCCTGTTTCCTCTAGGATAAGATAACACTTCTGGCCTTTTTTCAG
ACTGAAACATTTATATACTCCTCCAATCTTCCTTACTCCCCAACATAAGCAGATGCACAA
AGTTTTCCAGACAAGTTAGTTTGCTTGTTATTCCTTGGATCTTCTTTTTACTGTATTCCA
CCTGCCTATAATATTCTCCTTGTCTCTACTTGGAACTCAGCTTCCTACAAAGCTTAACTC
AGATATCAGCCTAGTTTTAATAGTCATCCTGTCCCCCCACGTCCCCCCAAATCACTTTGT
ATTTATTTTGCATGTATCTTACCTGAATGTGTATCTGGCCAGTTGAATGACTATTTTCAT
TTTTGAATTTGTATGTCTAGCACCTAATGTGTACTTGGCAGATTGGTGTTTAGAAAATGC
TTACTTATTGATGCTTCATTTCTTGATGAGACTTGGGACTTCAGTGGTGACTGTGGTTTA
AGAGAAAAAAAGCCCCTTTTTTAAAAAAACAACAACCCTTACCTTCTGTCTTAGACTCCA
TAGTATTGGTTCTAAGGCAGAAGAGCAGGAAAGATTAGGCAATGTGGGTTAAGTGACTTG
CCCAAGGTCACAGCTAGGACCTGTCTGGGGCTAGATTTTAACCTAGGACTTAGCATCTCT
AGGCTTAGCTCTCAATCCACTGAACCACCTAGCTGCCCCCCCACCCCCCAAGAGAAAATT
TTTAAAGAATATGATGTATGAAAAGAATTAATCAATTAACAAGACAGTAAGCCCCCTACT
GGGTACCTGGCATTGTTAGGAACTGGGAATACAACAAATTCAAAGTGAATTGGATCGATG
GCCCTCTGGAGATTACATTCTGCTTAGGATGCTAGTGTAGGTTGGTAGTATAAGTAATAC
AGGATGCATACAAAATAAATGCAAAATGATTGGGGAGGGAATCTTAACAACTGGGAGAAT
TGGTAATAGATACTTGAAGTCAGGACTTGAGTCTAAAATAGAGGCAGGAGTTGAGAGACA
GCTGTATTCATGGCAAATAATGAGTGAACACTTTCTAGCTGTGGGGAGCATCTGCAGACA
CCTCCAGATATTGATGAAATGTTAGTTTCAAATGTTAGGTGTGAAGGGGGGAGAAATAGC
TAAGGAGGAGAAAAAGTATTTGCAGCCTGTGTGGGGAGTCTCTGAATGCTAAGTAGAGGA
AATAGGGAGCCCCTGGAATTAAGGGAGTAGGGGGAGTCATCTGATGAAATGCACACTTCA
GAAAATGTTGATGACAATTGTGGAGATTCACTGAATGAAGCAAGGAAATTTAAGAGTTGG
AGAGAGATTGGAAATGCTTTTCTTTTATCCTTAAGGTTGAAATAATTATCATTGATAATG
AATACTTACTGACATTAGGAGTTTGTCCATTCTTCCCTTCCCCCCAAAGATAACATTTTG
GATAGATGGAAACCAGGACTTAAAGACTAAATGAGGCAGCTTTGAGTCAGAAAGAGTGGC
TTTAAATCTCACCTCAAACATTAGCTATATAATTCTGGGCAAGTTAACTTCACTGTGTTT
CTGTTTCCTTTTATTCAATAACCTTTAAGGTCCTTTACAACTTGAAAACTATGATCCTAT
GGCCAAACTTAAAGGATTTTATCTTAAATCTTCCTCCTTCACCCCTACCTCAAAAGTGAG
AATGGAGAGAAATCATTTCTCTCTATGAATATATTTCTTATTATTAGCACATGTGATTTG
TGAGAATTTGAACTTTATGAACAATAATATATATTCTAATGAGTTGTAAATGAAACTTGT
GAACATCAATCAGAAAATGACCTGGCCATTTAGTGTAAAGGTGATTTGTTCATGTATAGG
AAGTGGGAAGAGAAAAATAAAGATGTAGACCCACTAGATTTAGGTATAACCAAAAGAGCA
AACACAACCTGCTGTAACTATTGACTGTTCTAATGAACTAGAAATACATATAGTCCCTTT
GTTTTAAGGTTGACAAGGATGGCTTCAACAACTTTATGACACATGGTACTAAATAACTAC
CCTTTAACCTAACTGATAAAATTGTTGCTTCTGATTAAGGAAATATTTTTCAGAGGTTTG
TTCAAGTTGTTTATGTTGTGTTCAACTCTGTGACCCCATATGAGATTTTCTTGGCCTTTA
AAGATTCTGGAGTAGTTAGCCATTTCCTTCTCCAGCTCATTTTCCAGATGAGAAAACTGA
GGCAAACAGGGTTAAGTGACTTGCTCAGGATCACACACATTATGATTCTGAGGCTCCATT
TAAACTCTTCCTTCCTGACTCCAGGCCCTGTGCTCTTTTCACTGTCTGTTTCAGAGGCTA
AATTCTTTTGTTGGATGCATACAAGTATAGGTTTAAAATCCCACCATGCAGTTTGCAATT
GTTCCTTTAATAAAACATGTAGTCTGTTAAGACATGTTGAACATTTCACTAATGTGTTTT
AATTTGGCAGTTTAGTGACATGATGCAAATTTTGTTTATACAAATTTGCTTGGATGTTCT
TGTTGAAGGAGATGCATTTTCAGAAGATCCTATAAGTTCCATTACCTTAATGTCCAAGTT
GAATGATAAGTCAGTGTCTTCAAAGAGTTATTTATTACTGGTTTCAGCCCCTATACTTAC
TACCTGGGGGCTAAGTAAGGAAATATTTTTAGGTAAAATTTCTTGAAAAACTGTGTCTGT
CCTACTAATATTAACTTCAATATCATGCCTTTTGTTTGCTATTTGCCCTCCTGGTCCCAG
CCATATGCTGAAACTATTTCAAATATTACCAGTGACTTCCTAATCCATATCTTCAGTATC
CTTCCTGATTTCTCTATAGTTTTTGACACTGTTGATTACCCCCTTTTTTGAACAGTCTCT
CATCTATTGGCTTCATATATATTATCCTCATGGTTTCTCTTTATTCATTTCTCTTAAAGG
TCTTTGTTTCCTTTGTCTTCTCTTCTGTATTTTCACTTTGGCCATGTAAGTAGCTTCCAT
AACGTATTTATCATTTGTATGCAGTTGATTGCTAAATCTTTATCTCCAGCCATACCTCTT
TTCTGAGCTCCAAGTAGTTTTATCCAACTTCCTACAGAACATAAATAAATCAGCTGTCAT
ATCAGTCACCATACCTATTCACCTTCCTAACATCACTACTGTTGTTACTGATAGCACCAT
TCAGCCATTTTCTTATGTTTAAATTTGGTGTCATCCTTCTCATAACTAGCCCAGGCTCTA
TTTCTTTCATTCTTTTCTCTTATTATTTGTCCTTTTTTCTATTCCCATTCTTACCATCTT
CCTTTACTGTTCTAGCCTTCTAATAGATCTTCCTGCCTCTTCCCCATCTAATTTATTTCT
CACATCCTCATTGTACTACTTTTTCAAGCGTGGTTTCTAGCTATTCTGCTGAAATATCTT
CAGTGGTTCTCTTACTTAACAGGTAAAAAGTTCATATAAGATCCTTGGGGGGGAGGGACA
GCTGGGTGACTTAGTGGATTGAGAGCCAGGCCTAGAGACTGGAGTCCTAGGATCAAATCT
GGCCTTGCCCTGGGCAAATCATTTCACCCACATTGCCTAGCCTTACCTCTCTTGTGCCTT
GGAACTAGTACACAGTTTAAAAAAAAAAAAAGATCCATATCAACCTGAAGCCCACTTTGC
CTTTCCAAGCTTGTTTCATACTATCCTTTCCACACCCACTTTTCTAGTCAAAATATTTAC
CCACAGTCATTTGGCCTCCCCTTGGCCAATTCTCTGGCTTTTGTCTGGAATATCCTTCTT
GGTGTACCTGTTGAATTAAAATATATATATATATACACACACACATTTATACACACTTTT
TAAAATCAATTACATGTAATGACAAATTTCCACACAAGTTTTCTTAAGTTATATGATTGA
ATTTGTCTCCCTTCCTCCCTTCCCTTTCCCAGTTTTGGTAGGCCATTTGATCTGGGGTTA
TACATGTATTTTGCAAAATATAGTTGCATATTCATTTTTTAAGTGAGCAATTTTATAAAA
TCAAAACCCCAGAACATAAACCCAAATAAATAATTGAAAAATGCCTGTTGAGTTCTTAGC
TGTCTTTTAAGGGTTATTATAATACTTCCTCTAGGAAGCTTTCTGAAATGTCCATGCTTC
CATTTTCTCCATAAACACAGGAATGACCTCTTGTCCCCAGGAACCTCTCTTTGATAACCT
CTAATACATTTGTGTATTATGGTTATGTGGCATATTCTATTAGGGTAGGGTTGTCTTAGC
CAAACTTTGCATTTTCCCTGTACACTATAGGCACTTAACACATGTTCTTTGAGTTAAATT
GAATAATAACTAAAAAACAGCTTAGCTAGCATAACATAGGGGCAGCTGGTTGGTGCAGTA
GATTGAGAGCCAGGAAGACTAACTCATTTTGCTGAGTTCAAAGACCCTAGCTGTGTGACT
CTGGGCCAGTCATTTAACCCTGTTCTCTTCAGTTTCCTCATTTGTTAAGAAGAGCTGGAG
GAAGAAATGGCAAATCACTCTGGTATCTTTGCCAAGAAAACCCCATGCAGTCATAAAGAG
TAGGTCATGACTGAACAAGAAACACGAATAAACATGAACTCTACCTTCATTCTTTCCCAT
TTCCCAGTGGAAATGATCTATTCCCTTGAGCTAGCACTTTCACCTCTCATATTCCATTCT
ACATTATATTTATTTGTACACATGACTTATATTTCCTACTAGATTGTGAGCTCATTAAGG
ACAGGACACGTATTTGGTACCTTGTACACAATTGAGTTGTATGAGGCAGCTAGGTAGTAC
AGTGGATATAGTGGACCTTGAGTTGGGAGGACCTGGGTTCAAACTCAGATACTTATTAGC
TGTGTAGCCCTGGGCAAGTCACTTAACCCCCATTGCCTACCCCTTACCACTCTTCTGATT
CTAAGACAGAAGGTAAGGGTTTAAAAAAAAATCAAAGTGCAAAAGTTAGAATGAACCTCC
CTCAAACATAAGGAGTTTATTTCCTTTTCCCATCTTACAAGACTGTTGTGGATTCAGCAA
ATTATATTAAAATAGAAATTTTATAACAGTAAGTTTTATAAGCCTCTGTATTAATGAAAA
TTGTGAGCTTTCCCTTTTGGCAAGGTACTCAGTTATACAGTTATTATATTGTAATACCTG
TATGGTAAATGTCATTTAAGATATTGAACCCGTGATTTAAGACGACTTTTTATCTGCAGA
TAAACTGCCATCGAGTTTCCAAGTGCTTTAAAGTATTTTATAGTGAAATAGAGAGGTGTG
GAACTCAAGATCATTTTAATTTGTAAGAGATGGCAAGATGTACTTGTTTGGAAGGGAAAG
GTCTGATTTTAATAATGTTGGACACTGTTACAAGAATCTGGGCCAGGTAATTTTTTTGGC
CTGTCATAGTTTTTGCTTTGAGGTGGCTTGGAGCTTGAGGTATTATTAAGTGGAAATTTC
ATGGGCCATTTCTGTTCCAGAGAATGAGTCCCTTTTAGACAGTATAGACCCTATTTAGAC
AATACGGGCCCTAAAACGTAAGTGAAATAATTTGAACTGCTGCCATAAGCCTGTCTTCAT
AGATGTGGCAGTTTGCAGAGCACACCACAGTGGTTGTCTATTCATATTCTTGTGGGGAAT
TTAAAATATATTTACTCCTTTCTACTTATTTTAAATAATTGGATATGTAATTTCCCATAG
AAATAGTTAAGTATTACTAGTACAGTGCTCTATCCAGATTTTTGTGGGCTGCTCTGAGAA
TTTAACCACCATAAATAACATTTCTAGCGTGTCTTTGGAGTTTCACATTGGACCTAAATC
AATTTCTGAGCACATCTTCTGTTGGCATTGCTAACTTATAATGCTGATATTTTTATATTA
GGCTATCTTACTGCTTGCCTATTAAAAGGTAACTAGAAACATAGTAGGATTATTTATCCC
CCAAGGCAGCAGTGCTTTGTACACTGCCCTGCATATATCCTTTAGCATATCTCCCCTCCC
CCCATTTCCACCCTTTTCTCTGGGTAAACAAACATTTGCTTTGTGTTCACTGAACAATAT
ATCCTTTCTAATGCAGTAGTAGGCTTCTTTTATGAAACTGGAGGAGTCTTTGAGAATTAG
AAGGGAATTTTTTAGTAATCTTCTAGTCCCAGCTCTCATCTTGCTGATAAGGAACCTGAG
GCCTAGAGTGTTAGTGTTCTAATGAATTATCCAAGGTTAAGCTGCTAGTTAGTGACAGAA
CCAGGACTAAAACTCTAGTTACTCTGACTTGATAGATTTTCCAGCATAGCACTCTGCTTC
ATTGTCTATATTTCTGAGTTGATACCACATAAAGATTGTTCCCAACAAAGTAATTAAAAT
TGGATTTTTTCTTTTAGTTTTTGAACTAATTATGCAAAGTAGTTTGTAAAACAAAAGCGC
CCCCCCCCCCAAAAAAAAAAAGCTGAGTACTGTGGGAGCAGAGGGAATGGGGTGGCTAGC
CAATTCTCGTAGAATGGAAGGCAGTTCTGTGATGCTTCAGGTGGTTAGAATTAAACTGAG
CTTTCTTTCCTTTGAGCTGTTTTGCCGTTTTCCTGAATATCTTCTATATGACTAGAAGGA
ATGTGATTCTAATAGTTCTTCCTTGCCTTTCAAATAGGTATTTTGCTGTCCTACATAACT
TTCAACAAAACAACAGAATTATATAACTCTTTCTTAGGAAGTTCTTGGGTAGTAACTAAT
GTGTGTTCTTTTATTTATGAGCTATCAATTTTGCAAAGTTGAAAAGAGATTTAAGAAAAA
GTGGAATAAATGGGTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCCCCTCTC
TCTCTCTCTCCCTCCCTCTCTCCCTCTCTCCCTCTCTCCCTCTCTCCCTCTCTCCCCTCT
CCCCTCTCCCCTCTCCCCTCTCCCCTCTCCCCTCTCCCCTCTCCCCTCTCGGAGTATTGG
TTCCAAGGCAGAAGAGTGGTAAGGGCTAGGCAATGAAGGTTAAGTGACTTGCCCAGGGTC
ACACAGCTGGGAAATGTCTGAGGCCAGATTAACCTAGGACCCCGGGCTTCTAGGCCTGGC
TCTTAATCTACTGAGCTCTACCCAGCTGCCCCTGGGTCTCTCTTTTTTAAAACTAACAAA
TTGGAATATTTTCCTATTACAGATGAATCATAACAAAAATAAGTTTACTTATTATTAGCA
TAGTAGAAAACAATAAACTTGGTAAGTGGTGGTACTTTGATAGAACACTAGAAATGATAA
CCATTTTTCAGTGGCATTTCAAATTGCTTAAAGCTCAGCTTGATTCCAAAGTACTTAATG
CTATAAAACCACACCATACCACCATTCCGAAGATATTTAAATAATGAATTCTCTTTGAAT
GTCAAGATTTGAAATAGCAAGCTAAAACATTTGGTCTCATTCCTATTTTCTTTAGTTGTA
CCTACACCATCTTTGAATCTTTTATCTCTATGAATTTAAGTAGCATTTAAGTGACAACCA
CTGAATTTATAAGGAAATAAATACAAAGGAAAATAGTCTCTATCCTTACAGAGTATCTCT
TTTAAGAGTGGGGTTCTATACATAGAGAGAAGTGGTGCCCAGAGTAAAGGCATTTTGGTT
CAGTTTATAGGGGTGGTGAATGAGTCACAGAATAGTAGATGCTCTTGGAAGGATCAATTT
GATACTGCTGGAAATGGGTGTGGGGGAACAGCTTGACAGCTGTAGAGGAGAAAGCCAGGA
AGTAGAATATATACCCTCTCGACTTTTTTTTTTAGGTTTGTTTTTTTTTAATAGACTTTT
TATTTTGAAAGAATTGAGTATCATTTGGAATTCTGAATCTTTTTCAGGTGCCATGTTTCA
GAACAGAATAAGATCTTTGGTAAAAAAGAACTGAAGAAATTCTACAGAAATCCGACATAG
GCTAATTACAAGAAAGAATTAACCTGTCTCTGAGGTGACTAAAGGGGAATAATGGTGATT
TTGCGCCGGGCTCGGCCGCCTGCTTCCGCCCCAACCAGCAATGAATCTTGACTCGCTCTC
GCTGGCCTTGTCTCAAATCAGCTACCTGGTGGACAATTTAACCAAGAAAAACTACCGAGC
CAGCCAGCAGGAAATACAGCATGTGAGTAAACTTGACTGCAGGAAAGTATGCCATCATAC
AAATGAAGGGGAAGCTGAAAAGCTTTTGGGGTTTGCTACCTCATTGTTCTTATGTATTGT
AGAGTACCCCTGCCAACCTTTTTTCTAGTCTGCTACTTACAATCTAGATTGAGAATTCAG
TGACTGAATCTCTTTTTGGCCAGCCTCTTAACTTTGATTTTTATAGCTGTTTACTTGCTG
GTACCCTTAGTGGATGTTAAATTAGAAATTGTTTTTAAGGGAGATCCCTCCATATCCCAT
GATACAAATTTTAATAGTTTTTCTCGGGTACAAAGCTTCTAAAGATTTGTTCTCTAACTT
AAGGCTTTTGTACTTGTCTTATTCTTCATTTAAAAACCTTAACAAAAAATATCTGATACT
TGTTATATAATTATTATAGACACAACAGAAAGGTCTTGACTTTGGTAGTTATTTTGACTG
TTAGAATCATCTAGCTCTTTGACAGCATATGTAATGGGGGTTGTTTCCAGCTAAAACAAT
AGGATTGGGGAAAAAAAGTTGAGCTATATGATTTCTTAGAATTAGTATTAGTCACCTATA
ACTGTAGCATAAAATCTGCATTTAATCATGGAAAAATTACTCTTAACGTGACATTTGTCT
GAACATCTTGTTTAGAAACTTATGGATGTAGAAGATAAAGATGAAATCAGTTGCAGATTT
TACTAATCTGAATAGCATGTTAGAGCTCAGTTGGATTTCACTGCCATACAGTTCTGCTAA
TGAAAGTATTTTGATTTCATTTCATTTTAACATAATTCTGTTTGCAACTAAATTTTTGTC
ATGGCAGCTGAGCAGGTTGGAACTATATTTTCTTGAACTAGTGTATTATAATTCCTTGTA
TATGTGGTATTAAGGGATGAGGTTATTCCATGTAAGTGGCAAATGAAACATACTTTGAGT
GCCAAAATGTTTTTTATTGGAAATCTTAAAACTTTTCTGCCTTAATATGCACAGTATATG
CAGATCTTTTTTTAAGTTACATGACTCAGATTTTTCATTGTAAATATCCATAATTAAACT
GTCCCATAAGAGAGCAATATCTTCAGAGGCTATTGAGATATACTTTAAAAATGCATGGCC
TCAGATTTCATGGAATCACAATATTGCACAGTTGGAAGGACCATTCAGTCTAGCCTATAC
ATGAATAAGCATTGCTCCTCCATCTTATCAAACAAGTCTTGCTTTAAGCCTCTATGGGTA
TAAGTGTGTCTAGATATGTGTATTTATGTATGTATCAGGTATATATATTTGCTTGTAGCT
CATTTTGTTTGGAACTATTCTAAACATTAGAATGTTTTACCTTACATTAAACCTAAACAT
ATCTCTTTATGTCTCACTAATTGTTCCTAATTTAGCTCTTGGGCAACCCAGAATATATGA
AAAGAATCCCCATCATAACACATCCAAGTGGTCATCTAGCAATCTACACCACTTTTCAAC
AGCTTTTTCTGCTTTTGGATGGCAATTCTAATCCTTTTCTTGAAGTACTTCAAGACAGCT
CTTACATCCCCTGGTAGTCTTCAGTTAAATATCCACAGTCCTTTCAACAGCTTTTGATAT
TGTATGATCACAAGGCCCTTTAACCATCCTTTTTGACTTCTTGATGTTCTCTAGCTTAAT
AATATACTTCCTAATGTGTGGTCTGACCACAGACCAAAGGATGGTGAGACTTGGCTCTCC
TTAATTTTGTACATTATGCTTCTGTTCATGTAGACTAAGTTAGTATTGAGTTTTTTGACT
TGATTTCAATAATTGATTCATTTTGAGCTTGTAGGTGATTAAAATCCTTAGTTTTCAGAT
GAGCTGATGTCTACCATTTCCATTTTGTTGAGAAATCTATTTTTTGTTTTGAACCCAAGT
TCAGACTTTGTTTTTTTGCTATTAGATTTTATTCGGTCCAATATTCTAATTCCAACATGA
GTTTCCTGGGTTCTGTCATTGAACATGTGAGTCCTTACAGTTTCGGGAATAGAATACTAG
ATTTAAAGTCAAGATCTGAGTTCAAATTCTGATTTTTGTCACTTACAAATTGATGTGATC
ATGAACAAGTTATTTAATCTCAGATCATAAATTTTCCATTCGTGAAAGAGGTTAATATTT
GATATATTTCTCTGTTAATATTTGATATATTTCTTGTGTCCCATAATTGTGAGGTAAGTG
CTTTTGCAAGTCATAGTATTATAGATATCTCTCTTAGTGTCCTTTAATTTTGAGAAACAT
ACTATCCATGCCTTTATCCAAGTTGATATTGAACTTAATTGATTGTTTAATAGTAATAAA
CTATTATTTTAATAATATTTATAATTTATTAGTAATAAGCTGCTATTGTTATCTACTCTT
TGGGTCTGGTTATTCAATGAGTTCCAAGTCTACCTGGTTCTATTAGTCCTGAAGAATTGT
ATGAAAGGCTTTGTCAAATGCTTTGCTAGAATCTAGGCATTTCAGCATGCTGTTGAAAAG
GATGACTGGAACTATAGGGTTTAGGTACTAGTTTTCTTGATTTTTAGCTGTGATGTTGAG
CAAGTCTCCACTTTTCTGAATCTCTTGGACTAGATGACCTCTAAGGGTTCCTTCTAGTTC
TAAACCTTAGAGTCCTTTATAGGATTTCTCTGATTACCAGTCAGGTACCTTATCAAAAAA
AAAAACAAGGTTAATCTGGCATTACCTTTTCCTGACTCTTTGTGATCTTTCCTTTTGTAG
ATATTCACTAACCATCGATTTTATACACATTAGGATTTTGTCAGGAATTCAAGTCGTGTT
TATTGGTCTAGGTCACAGACCTCTATATTGCACATTTCCCTAGTTCTGTAGCAACTCTCT
AGTCTCCCAGGGTCTTTCAGAGGTCATTGGCCCAGCACTCATGCTCAGTCCCCTGGGATA
CTGTAATCAGGGCTTCATGACATGACTTTATTAAGGACAGCTGGATGCCTTCTCATGTGT
ATGTAGTGAAATGGTCTTGGAGGTCATCTGCAGACAAGCTGTTTTGGGGTGTTCTTCCTA
GGCCAGAGTGAAGGGTGAGAACTTTACTGCCTTTACTCTCATCTCTTAATTATCCCATCT
GCTCTGAGAAAGAGAACTGTTTTGTTGTTGTTTTTTAAACCCTTAATTTTTGTCTTAGAA
TGGATACTAAGTATTGATTGCAAGGCAAAAGAGCAATAAGGACTAGGCAGTGGAGATTAA
GTAACTTGCCCATGGTCACATAGCTAGGAAGTGTCAGAGGACAGATTTGAACTCGGGTCT
ATCCTCCTTACTCTTGGCCAGGTTAACTATTGACTGTGCCACCTAGCTGTTCCACAAGAT
AAGCTTTTGAAACTTCCTTTGGTTCATTTTGAACTTTTGTAATTTTGACTTTCCTAGGCT
TTACTAATTTCTCTTGTAGCTTTTCTGTTTTGTCTTACTCTCAGTTCTTAATGTTCTCAT
GTGTTTTATCTTACAACCTTTTTGGAGCTGGGAAGAGTTGCTGAAGCTCTCTATCTTAGA
AAGTATGATGGAGGCAGGAAGATAGATGGTGAAAGTTGAAGTATATGGTGTTTGTTTACA
GTTAATTCAACTTTTTGTCTGTTAGTGTTAGAGCAACTTTTCCCAAGCCAATACTTACAT
CCCTGAGGCTAGTCATCAGCCAGTTACATAGGAAGTAAATGATATAGTTCATGCTATCAG
TCTTTTGTTTAGGAACACACTCATTTTTATCTCTCCTGCCTTATTTTGTTTATTTGTAAA
ATATGTCAATACAACTCAACCTGACAGAGTTGTTTTGAAGAAATGTTTTGTTAACTTTAA
AGTGCTATATAAAGAGGGTACTATTTCGAAAGGAAGGGGGGGAGGGGGAGAGAGAGAGCA
CTAGAAGTTGAACTGGAAGGACACAATTCCTTTGACTTTCTTGTTCAAAATTGAGCTCTT
TATCGGTTCCTTCTCTCTTCCTAACTTCCCTATACTCTTGAGTATCACCATCTTTCCAAT
CATCCAGGCTCACAACCTAAATATTGATCTTGACTCTTCACTCTCCCCTCCCTCTGTTAA
GAACTGTTGATTTTTATCTTCCAAACATCTCTCATATATGTGCCTTTTCTCTGATGCTGC
CTCCACTTTGGTGCAAGCCACCATCACCTCACACCTAGACTATTGCAATAGCTTACTGGT
GGATCTGTCTGCCTTGTCTCTTCTCCACTCCAATCCATCTTGCACTCAGTTGTCCGTGAT
AGTCCTAAAGGGCAAATCTTGATCATATCAATCAACTCCTAATCCCACCCCCCACCAATG
AACTCCAGTGGCTGGCTCTCCATCACTCGCAAGATCAGATATGAAATTATCATCTGGCAT
TTAAAGCCCTTCAGAACTTGCCCTATTCCCTACCTTTCCAATTTTTTTACATCTCTTCCT
CTCACCTCCCCATCATTACCTACATATTTTGCAATCCAGTGACACTGGTCTCCTTTTTAT
TTGAACAACACACTCCCATCTTCCAACTACTGGACATTTATTGTCTACCTTCTGTGCCAG
AATTATTCTTCTTCCTTATCTCTGTCTTCTCATCTTCTATCATTTGCCAGGAACCTTTTC
CCAGTCTCCCTTAATGCTTTCCATTCTTGATCATCTCTAGTTTATTCTGTTATAGTTTGT
TTGCATGTAGTTGTTTGAATGTTGTCTCTCCCATTAAGACTGTGCACTTTGTGCCTTTCT
TTGTATTTTCTAACACCTCACAAGAAGTCTGACACATAGTAGGTGATTAATGATTATTGA
CTGATTAACAAAATACCACCTCCTGGTTACCACTTCCTCCTGTGTGTTAACTTCCCCCTT
TAAAATTGAAGTTACCTGGGGCAAGTTATCTATAGAGCTTGGCACATAATATACATTTGA
TAAATAATTTTTCTTCATTCAAAGCAGAACATATCTTATCAATTTGACTTTTCTCACCTT
TAGATTTTTTTGTGGAATTGGTCACAGTGATCCCAAGATAACATTTTCTATTCAGATGGG
AGTGGAGGCAAAAAAGAGATAACTGCTAAGCTTTTTTGTCAGATAATTGTCTAGTAAAGA
TGAGTAGATTATATTTGGCAGTCATTTAGACACTGAATCTGAAAGAACTCTTAATGGTCT
TAGACTGTTTGCTAACTTCACCAATAAACTCAAAGCATATGCTTGACATCCTCTGTTGCT
CCATGAGGATGGTAAGAAGAGAACTGGTTAAAGGATAAATGGGGGGAGAGGGGCAGCTAA
GTGGCTCAGTGGATTGAGAGCCAGGTCTAGATATGAGAAGTCCCAGGTTCAAATTTGGGC
CTCAAGACACTTGTAGTTATGTGGCCCCAGGTGAGTCACTTGGACCCATTGCCTAGGAAC
CACTCTTCTGCCCCTGGAACCAATACAGATTATTGATTCTAAGACCAAAAGTAAGAGTTA
AAAAAAAAAAGATAAACGAGAGTGCAGTTTTTCTACTAACAGAAGGGGCTTAAATGATTA
AGAGAACAAAGGATTGCTATTCTTTCTAAGCTCTTTGAAAAACTAAACTATCCAAAATAA
ATAGGAAATCTCCCTCTTCCCCCAACAGTTTTGAACTGGGTTCCATTTTCCATGAATAAT
TTTATAAGTATGTTTCTGGGCTGCCATCTCTTTTAAATCTTCATGTAAGATGCCAAGCTT
CATCAAATTGCTTTAACTTGCTACATCAATTTTTTTAGGGTGAATGGAAGACTTTTGGGA
GGTATATATCATGTTTAATGGTTTGTACTTGTAGTGGTAAAATCAAATTCTGCCAACTTA
TTGGTAAGTGGAAGCTGGTAAGGAGTGTTCTTTATTAATGTGAATGAGAGTGAGTGTCTA
ATGGTAGAACAATGTGTCCATATTCTAATGTTGCCTGTATTACTTGCTTGTGACCAAGAA
TATCTAGTAAAATGTGAACAACACTTTAGTGCATCTTATTAGGAATAATACATGGATTCA
CTGTATGACTTCAGTGAAATACTCATCCCCTAGTGATTTGGAAGTTACCATAAGTTTGCA
GGGTAAGTGTAGGTCCTGAAAAACTGTAGGATACTAGAACTGCAACTAGAAGGGAGCATC
TATTTCGATTTCATTTTAGAGATATGAAAACTGAGGCCTAGAGAGGTTAGGGACTTTCCA
AGGCTGCATAAGTAATGAGTGGCAGAGTCAGGAATATAACTTGGGTCCTTTGACTCTAAA
CTAGGCTCCGTGCTGGAAACAGTAGACCTGGGTTCGAATCCCATCTCTGACATTCATTAC
TTAAGTGTCTTTGGGTAAGGAGCCTCCAGGGGTCAGTTTCCTTATCTGAGAAATGAGGGA
ATTGGACTGGATGACATGATTTATTTAAAACTGGGAAGGACTCCAGTATCTTATTTAGCT
TCCCTTACATATAGATGAGGAATTAGGCTCTGAAAAAAGTTAAGTGACTCAAACGAAGTC
ACAGGTAATAAATGTGAGAGAACAACCAAGATCCTTTGAATCCCCAAATTGGCAATTTGT
ATTTGGCATTGAATTGAGCAATTGAAATTTTTTACTTGAATTGAATTAGATTTTTGATAC
ATTCTTTAGTTTTTTGTCATGAAACCATCCTAGGCATATTTGAAGTTAAGCATACTTTGA
CTAGTTCACTTTTCCCCAAGTCTAACTTTGATTATGTAGCCCATAAGGTTTTGATTGATA
TTTAAACAAGTTGAGTTTTCATGGCCATTGAAGCATGCTTTGACTTCATTTCTTATTTTA
ACTTTCTTAACTATTTGGGACCTGTGACCAGGTCATATTGCAGTATTTCCTCACCATTTG
GGAACTTCTATAATTCTGCAACAAGTCAGCTTTATAATATATTGCTATATTTATCAGAAT
TTTATCATTTCCCTCAGGGGGGGACAAGATTCCAGTCCACTGAAAGTTTAAAAAAATAAA
ATCCCAAACATTTTTTAATAATCTGGTGATATCTAGATCTCAATACACCACTAGACTTCT
GACAATGCCTTGAATGAAAAACAGGGTTTCATTAGTAAAAATCATTTTCTTTCCAACCTT
CAGTATTCTAGTTTGGTTCTTCTAACTACAAGAAGCCTTTGCTTGTGTTGTAAAGGCATC
AGCATTAATGACTTAAGAGGCCAGATAACCTCCAAGGGGCTTTGCTTGTTTTCTGAGGAT
TAATTAGCTGTTTGCAACAATAATTTGAGTTCTTGGGGTGTTTTTTTTAATATATTCAGA
TGCACTTGACTTTGTACTTTGCTGTGACTGATTGTGCTTCATTAAGGGATTTGAATGATC
ATTGAGCCACTTAACTTCTCCCTACCAATGGCCAATGTAATCTCTCTCAAGTCATTGAAG
TGTGTTCTGTAAGAACACACTTCACACTGTCACAATTTTTACAGTAAAAATGCAAAAATC
TGGAGTAAAACTGAGAATTAAAATACATCCCAAAAGAGAACAGTGAAACATTGCATGGTA
TTCAGCATTTTAACCAACAAAATTGACTAATAATGGGGAAACCAACTCATTCTAGTTTTG
TCATCAAGTTCAATCCATTCTGTGTCAGAAATACAGACACCATGATCATCACTTAAGACA
GTGAAACCATAGCAAAATTATGACTTGGCCCAAGTAACTTGCACACCTTATGTGAGATAT
GGTACAGATAGACAACACAGGGCTGTAGGAGAGTGGTGAATTTGGGGAAATTGCAAGGCT
GCTTTACTGACAGCAAGCTTCTCATGAAGTGAAGACCCATTTTTATTTTGTTTTTTAAAA
ATTACTGATAGTTAACCACTTGCTCTATGGCAATAAGACATTGATATTCCTGTTAATTCT
TCTGAAGCAATGTCTTATTGCCATAGAAGCATATAGTAGGTAGTGAAGTGAGCGTTAAAA
GGCTAGATTGTAAACAGTGAGGAAAAACAGCTGTAAAAGATATCAAGGATTATTTGAGAG
GAAAAGTGGACTGATTACATGGGCAAGAATAAGGTGCAGGTGGTCAGCCAGAGACTTTCA
TTGGTAACTTCTCAATATTGGGAGAAAAGGATAAAGGCTTTTAGCATACTGGGGTAACCC
CCTTTATTGGGAAGAAAAGTCTTTTGGGATAGGTTGTGCAGTCTTTTTTTATGGATTAAG
TTGTAAATAAGCTCTAGGAAAATAATGAATTTAAAATAACAGAATCCTCACATTTCTCAA
AGCCAGACTTTTCAGAGAGCTAATTTTAAACTTAAAAAAGAAAAAAAACCTCACTAACCA
TGAGTATTTTCTATAAATGAGTGATTTATTCTAACATTTCTCTCTAGGTTTTATGGGTAT
GGCAGAAAATAATTTAAAAACCCTTATTTAAAAAAAAAAAATTGAAACACATGTCAGTGG
GAAATGAATCATCTCCAAGTTAGCAGCTTACTTCTGAATGTTTGGGTGCTATATTTTCTA
CACTTAAGACAACCGTCAAAATAAAATCTCCATAAATAATATCAATAGGACTGATATACC
AGTCTCTCCCTTTGGTGAGGAGTCCTTAGACTCTAGGCTTCCTTTAATATCCTCCAAATG
TACTCCAAAAGAGTAAGGATGTTGTATTGGACAGAAGGCTGGCCCTGGAGTCAAGAAGAT
GTAAGGGCAAAGTCCTACCTCAAATAACCTAGAAGTGTGTCTAAATAGGTGTTCTGCACA
ACTATTATTTCAAGCAGCAATTCCCACTAGTGTGCATCATTATATTGGTTAAGTTAAAAT
GTCAGCCTAAATACTTCTCCCTGAACACACATATTCAGACTTAAAAAACTAAACATTAAG
AGTGTGTGTGTGTCTGTACCAACTAGTTAAAATCTGTATTTGGTATAAAATGTTCAGGAT
ACATACTGCTAATTTCTTTTAATTGCATACTTATTTGTATTTAATGGTGCCTACACTTTG
CAAATGATTTCTAGTTTTATAATGAATCAGGTAATTTCCTTTATTATTTATTATTTTATT
TTTTTTTTAATTACTTGTAAAACAGTTTTTAAATTCTTTTTTTTTTTAATTTTTATTTTG
AAATTCTCTACCTCTCTATCTTGAGATGGCAAGCAATTTGATATATATTATGTATTTGTA
GTCATGCAAAACATGTTCATATTAGCCATGTTACAAAAGAATAGAACAACTACCTAAAAG
CCCAAGAAAAATAAAGTTTAAAAAGTATGCATTGAAAGGGCAGCTGGGTAGCTCAGTGAA
TTGAGAGCCAGGCCTAAAGATGGGAGGTCCTAGGTTCAAATTTGGCCTCAGACTCTTCCC
AGCTGTGTGACCCTGGGCAAGCCACTTGACCCCCATTGCCTAGCCCTTACCATTCTTCTG
CCTTGGAACCAATACATTATATTAATTCCAAGATGGAAGGTAAGGGTTAAAAAAAAAAGA
TATGCTTTGATCTGTATTTAGACTCCCTTCAGACCTTTCTCTGGAGGTTGATAGTATTTT
TCATCAGTCTTTTGGAATTGTCTTGGATCGTTGTATTGCTGAGAATAGCTAAGTCATTCA
CAGTTGATCATAGTACAATATTGCTATTGCTGTGTACAATGCTCTCTTGGTTCCACTCAC
TTGACTTTGCATCAGTTAATGTAAGACTACCCAGCTTTTTCTAAAAGCATCCTGCTGATT
TCTTTCTTATAGTACAGTAGTGTGCTATCATAGTCATATGTCACAACTTGTTCAACCTTT
CTCCTATTAAGAATATGTCCTCAGTTTCTAGTTCTTTGCCACCACAAGAAGACCTGCTAT
AAATATTTTTGTTCATATAAGTTCCCCTTTTCTTTGATCTCTCTGGGACAGAGCTAGCAC
TGGTATTTCTGGGTCAAAAGGTATGCCCAATTTTATAGCCCTTTGGGCATAGTTCCAAAT
TGCCCTCCAGAATGGTTGAACCAGTTCATTTATATAGATACTTTCAATAAAATCGAGTTA
TCAGTTCCATAATCCAGATGAATAGAAGAAATTAAGGGACTTTGACCAGTTCGTTGCTTT
GATTTTCAAAATTTTTTGATAAACATTTATGGAATAGTAACTTTTGGGTCAGGGCAGAAT
TACTAATTGTATTTAGGGTTGGAGATTTGGACCCTGTTTTTTCTCCCCCATGAATATAAA
GTACTCTTCAGGTAAGACAATTCCCTTTAACAATTCAAATTGATGCCTTCTCTACAAAAG
CTGGAACTGATTAAAATGTAATTGGGGGGAAATATTTGAGAAAATCAATTAAAATGTTGT
AAAACAGAGAATGTTAATATATGGTTTTCTAAGTCAATATGTGGCCCACAAGCATCTTAA
CATTGGATTTAGTGAGCTTCTATTTGAGTTTGATACTACTAGCCCAGAGCATAAGCAGTA
TATGTGTTATTGAGGAGGGGACTTGAATGTGGTTCTTTCTGGTGGTGAGACTAGTTCTCT
CTCTAGTATGAAACAAATGTCCAAACATTTCAGCAATTAAGAATTAACATTGGAACTGCC
AAGTTGTTGAGGGAATTAGCAAGAAATAATATATATGTTGTAACCTAGTTGTAAGAGTTT
TCCAAAGTTTACTTAACATATTGTCACATGCAGTAACATTAAAAATTAAAATTTCTATTT
CATGATGATATATATGTTGGTTTTTTAAAAGTATAATTATTTTTAGATTTTTATCCATCC
TGGCATATAGTAGTACTCAGTAATTTTAAAGAAATTATCACATTAAGAAATTGGTAGAAA
TATGAACGTGTCTTGGAATCAGTTCTAATCTCTGGCTTTTAATTGACCTTTTTGTAGCTT
TGTTGTATAAATTACTTAAATTCATTCACATGTTAGAGTAGCTGTAAATGGAACTTGTTT
TTATAGTATTGTATTTTTGTATAGTGGATGAAACATTTCATAAGCATTGATTCTGCTGCA
GCCTCTATGCTGGCATGAAGGCAGAAAAGGTCCTTCCCTCAAGGGAGGGTGGGCAGGGAG
CAAAGGGGAAGGCTAAGAAACTGAAGTGGTGAGAAGGGAGAATCTTGTAGACCTGAGGGC
CAGGCAGTGCAAAGGCAAATGAAGTGTGGCATAGGAAGAACTGAAAGCTAGATCATAGAG
TCTATTGAAGGTCTGGTCCTATAAGTGTAAGAAGCCTGGAAAAGGGCTGGGTTGGGAAGA
GCTGCAAAAGCCAAACAAAATTTGATATTTGATATGAGAGCCACTGGGGCTTATTGGGCA
TACCTGTGGTTTAGGAAAGTTTCTTTCACAGCTGGATGCATATAGATTGGAATAAGGAGA
GACTTGTGAAAGGGGAACTAAATTAGAAGATTCTGACAATGGTGTAGATAAAGAGTGGTG
AGGGCCACAACTTAGGATGATGGTTATATGAGTGGAGAGAAGGGTAGATACATATGTGTA
AAAGATACATGCTTATAATATATACAAGTATAATGCATGTGTCTCTACATGTATATACTA
TATATAGTATTATAAAGGTAAAAATCACAGGATTTGGCAATGGATTGAATTTGTGGAGTC
AAGTATGATACTGAGGCTGATGGCCTAGGTGACTGAGAAAATGGTGGCACTCAAGTAGTA
GGAAAGAAATTGGGAGGGTTTGTACATGTTACATTTGCAAGGTCTAGCAGGATACTCAGT
TTGATATGTCAAGAGGTAGTTTGAAGGTTGTAATTTAGGAGGGAGGGAGACTAAGGCTGG
GTATATAGATAATAGGAATCATTTGCCTAGAGAAGGAGTGGATGAGATCATCAAATGACA
TCATATATAAACTGAAAAGAGAAGGGGCCCAGAATAGGGCATTGGGATACACAAAAAGTC
AACCAGCAAAGGACATTGAAATTTTTATTTATTTGTTTGTTTGTTTGTTTGTTTATTTAT
TCATTCATTTATTTATTTATTTATTCATTTATTTATTTATTTATTTATTCATTCATTTAT
TTATTTATTTAAGTGATTTGTCATATACTGATTCAGGATTAAACTTGAGTCTTCCTGATT
GCAAGTCAAGCATTAACCAATTTATCACCTAGCTGACTCTTTTACAGCTTGTTGTTGTCC
CTGTTTTATAGTACTTCTTAAAGCTATGAATGACTGAAATACTAGTGGTGTCTTTTTGTA
GTTCAAACTACTATGCACTTGTCAATTGCTAATATATGAACAGTTAAGATTGACGTTTTT
CTCTCCTTATAATCTCTTCAATTTTTTACATTTCCTTTGAAGATTGCTTTATTGTGCTGT
ATGATTAGATGTTCCCTTTCTCCTATTCCAAAATAATGTAATGATAAATAAACTCATGGT
TATATTTTTTGGTTTTTAGGTTTTTAAAAACTCTTTGCTCATTATAACAGTGAGATTGAT
ATCAATGTTCAATTATTTTCCCTTTTTAGAAATGCAGTGTGACCCAGTGAGGTAAAAATT
TGTCTTAAGATACAACTAATAAGTATTAGTTCATAAGATTGTAGAGTTAGAGGTAGGAGG
AACTTTGTGGTTGTTCAGTCATTTCAGACTCTTCATGATCCCATTTGGAGTTTTCTTGAC
AAAGATACTAGAATGATTTGCCATTTCCTTCTGTTTGTTTTACAGATGAGGAAACTGAAA
CAAACATGGTTAAGTGACCCACTCAGGGTCATATAGCTAGTAAGTGGTTGAGGCTGATTT
TGAAGTTGGGTTTTTCAGCCCTCTCATTTTACCAATGAGGAGACTGAGAGGCTCACAGTC
AAGTAGTTAGTTGCAGAACTCAGGTAATTTGACTCAAAATACATTGTTTTTCCCATGAAT
CAGAGATTGACTCATCTTTCTGAGGAAACTGAAGGAATCAAGAAATAGTTGTTATGGATC
TTTTCAACTAACTTGAATAGTATAAACTAGCTGAACTTGAATTTTCAGTCCCCATGTTTT
ATAGAGCCATCACTATCTAACTTTGTCACAATTTCCATAGTAAAGAGTAGGAGATTTGGA
GGCTAGGAGTAATAAAAGTGAATTGATTGCTAGAAGGCAAAAATAGCCAACTCTTTTGTT
TTACTAAGTTGATGGAAGAGACAAGAAGTGTCCAGCCTTGTTTTGGTGACTTGTTGACCT
TGGAAACTAGAATTGGTTTAAATTTTAAAATTTCCTGTGTTATTTTCCTTTTTTGTTGTT
TTGTTTTGTTTTTTTTTTTTTTGGATATTTTTGTATTGTAATTTAGACCTGACTGTCAGA
AGAAACTTCTGTAATATGAAATATTTCTTGTGTGTTGAGAATGGTCTAGATTGCTACTCA
CTTCTCATTAAATTATTATTAGGCTAGATTGCTTTGAAGGGAAGTAGAAAATGAGACATT
CATTTAATGGGTAGAGTGAGTTTTGCATAGAGGTTGCAGGAGTCAAAAACCATTTCAGGT
GTGGCATGGGGAAATGACAACTAATTTGTATGCATGCAGCTTGTCCTGTTTTGCCAGTTG
ACAGTCAGTACTATCCTCTTGACTTTGGACTCCTTCCAGTCCAAATTCTTTGAATAAATA
GATGTGTCTTGGTCCCTCCAAACCTGCTTCTTGATAAAAGTTGACTTGGGAGATTTTTGA
ACATTAAAATTTAATGTAAGATTCTCTTGACCTTGGGTTAAAACAGCTGAAAATTTGAAG
GAAAAACTTTTTAAGTTGCCCAGGTTCTAGTAGCTTTAGAGGTACTCCTCCTTTACTTTT
TTTTCCTTTCTCTTCTCTGGCCTTCCAGCTTCTCAGCACCTTTTAGGGCTGCTTGGCTGC
TCAGATGGCTGAGATGAGATGAAATTCAACAACTCTTTTCTCTCTCCCTTCCTCTCTCCC
TCCCTCCCCCAGACCTTCACAGCTAATAAGAGTCATCCAGTTAGTAAATGTCTGAGGTCA
AATTTGAACTCAGAAAGATGAGTCTTCTGCCTTTCAGACTCAGCACTCTATCCTAGCTCT
TCCGAATCAATGATTGTTTTCCGTAGAATGGATGAAATATCTGAGGTTATTTTGGCTTTA
ACATCTTTCATATCTCTCCCCTCTTCTGACCCTGGACACTACCATCTGATTCACAAATGC
AAACTGAATATATCTTAACTTTGACTTTTGCCTCAGGACTGCACCCTTTGGACCCCACAG
CCAAACTTCCTTTTATGTGTGGTCTCTTCCAGTTAGAGTATGAGATTTTAGTCTCTTGAG
AGAAGACTTTCACTTTTTCTCTGTGTATCCCCTAAATTTTGGCTAGTGCTTGACACATAG
TAAATGCTTTTAGATTCCTTTTTAAACTACTACATTTGGACCAACAGCTTTTAAAAAATA
ATTTATTGTTCAGTTTCAGACCTGTTTGACTCTTAGTGAGTCCATTTGGACTTTTCTTGG
CAGATACTTGAGTGATTTACTATTTCCTTCTTAAATTCATTTTACAAGAGGAATCTGAGA
CAGATAGTTAAGTGACTTGCCCAGAAAGGGTCACATAGCTAATAAGTGTCTGAGGCTACT
TTTGAACTCAGGTCTTAGTAATTCCAGGCTTGACTGTCTATCCCCTGAGGGATCCCCCTT
CCATATAACCTCCTACCCCCTGCCCTTTTTGAGGTAGACAAGTAAAAATGTTAGAACAGG
GGACAGAGTTGGGAAGATGTAAGTAATTTAGCCAAATTTAGAAGAATTTTGATATTATTT
AAACATGGTCTGTGTGAAATATTGCTGGTTTTAAAGTTTTCTGTACTTTCAAGATTAGAG
TAATTGTGTTATACCTGCCGATTAAAATATTAAAATTGCATGCTTATTATTAAAATCACT
AGCTTATCTTTCCTTTTGTGAGCAATCATAATATAGATTTCATTATTTATAAAGTTAATA
GAGCCCAAATCTCAGCTTCTTCTGTAAGTGGGCATCTTATTGTAGATTCAGAATTGTTGA
TGACTTGGGTTTTCCTTTTCTCAATGAAGATATATATTCATTGGTTTCTTCAGATTGTGA
ATCGACACGGCCCGGAGGCAGATAGGCATTTATTACGCTGCCTATTTTCTCATGTGGATT
TCAGTGGCGATGGTAAAAGTAGCGGCAAAGATTTTCATCAGGTACTTTTTGCATATAATT
GAATTGTGTATATATATTTTTAACCACATGATTTTCTTTTTGGGCATAAATTATTTAGTG
ACAGTGACACATCAATTAAATCCTCTGAAGATAATCTTTAATATCTGGGAAGGGATTGAT
GGAGTTCATATAGCTCCAAGACAATGGTGTTAGTGACTAAAGTGATGCTATCTCAGGTAT
AAAGGTTTCAAAGATCCTGGACCTAGTTCAGGGGAAGTATGGGGCTTTTTTCTCCTGAAA
GTGGAGTAGGTGCTACTGGGATCATGCTAAAGGAGATAGGACATTTCTTCCATCCCCTTT
CTCCCATCAGAAATTAGGAAGCAGTAGCCCCTCTTGTGAAGGACAAAGGGAATGCCCTGC
TAAAGGGAGGAAAGGAGAGAATTTAGAAGGGTTATTGGGAATATCTTTTTGCTTAATGTG
GACATAGTGGCAGTTCTATTGGTTGTAAACATTATACTTACATAATTAAAGACTTGCATT
TTTAGAAGTTTCACTGATGCCTTTTCAGTCCATTCGAAATAGAAGCTTCCCTTTTAACAA
AGAATATCTGTTGGGACAAAGTGACTTATGTAGGACATATGCAAAATTAAGCTCAAAGTC
CTTCATATTGTATTAAGAGAAAAAAAGAGTTTAGGGGTCAGCTAGGTGGCTCATTGGATT
GAGAGCCAAGCTTAGAGATTGGAGGTCCTGGTTTCAAATTTGACCTTAGATACTTCCTAG
CTGGGTGACACTGGACAAGTCACTTCACCCTCATTGCCTACCCTTTACTGCTCTTCTGCC
TTGGAACCAGTACACAGTATTGATTCTAAGATGAAAGGTAAGGGTAAGGGTTTTGGTTTG
TTTTTTTAAAGAAAGAAAAGGTGTTTGCTCATTTGCTTAGAACCAGTATTGTTTTTTTTA
AAGTTGCTTTAAGTAATGAGGGAAAAGTATTTCAATAGATTTATGTATTTACATACCCTT
TATTTTAAAAAACTGATGCTCAGATTATACATTTGAATAATGATTTAAATAGTTACCAAT
TGTTCTTTTTTTAGACTCAGTTTCTGATTCAGGAGTGTGCATCACTGATTACAAAGCCAA
ATTTTATCTCGACGCTGTCCTATGCCATTGATAATCCATTGCACTATCAGAAGGTTTGTA
TTCCTTAAAATTTTTATCCCTTGAACTGGATATTAAATTTTTCAGAAGAGCCATTGTGTC
TTCCTCAGATATTCTAGTTTATTTTGTAAAGATCTCAGTAAATATTATAATGCTAATATT
AGCATTGTACTGTTTTTAAAACGAAGTGATACAGGATCTTAGGGGTCATCTGCTCAACTT
TCAATCTTCATAGCTTTTGGGGGAAGAAAATACTTTGAAAATTAAGGATGATTGATGCTA
GCTCATAATTATGGGTTCTAGTATATGTTGTTGTGAGCAGGCCCTCTATAGAATTGTTTT
GCTTATCTTCATTGATATCCAGATTAAGGAATAGGTAGAAGTTTTAGAAAACTTAATAAA
ATCATTCATGTATTATAATTTCATTGGTTTCAGAGTCTAAAGCCTTCACCCCACTTATTT
GCCCAGCTGAGTAAAGTTCTCAAGTTAAGCAAGGTTCAAGAGGTAGGTAATTTGGTAATG
TGGAGGTAAATTAAATTGGAATTAGCATATCAAGATTTTTTACTGTAATCTCATCTTCTT
GTTTTAGGTAATTTTTGGTCTTGCTCTCTTGAATTCTTCCAGCTCAGATCTGCGAGGTTT
TGGTAAGTTGAGTAAGGTTTTTAGAATGCTTTAGTGAAGTTAGAATTGCAACCCTTTAAA
AGTAAAATAGAGTTTACATGGACCCTGGGGACCAGATGTTTTATTTTCTGTCTCATTTTG
GTTGCCTATTGGATGTTGAAATAATAAATATTTACCCAATTGCCACTAACTGCCTTGTGA
TAACCCTGGTTATTTCCATACTTTGAAAGAAAGTCAGGCTATAGAAAATCTGGAATGATG
ATTTAGTAAATCCATGAGTACATGGCCTTGCTGATTCCTTGGAGCCATGTTTCTTTGATA
ATTTTCTTTAAACTTGTTCGATAGCTTCTTACATTTAGTGCTTGTAGATTTTGAAAATCC
CGACCATGACTTTTAACAAGTTAGAACACTGTTTAATTGATTTCCTTTTTTTGTTTTTAC
ATCAGTCATTCCCAGGTATTACCTACCCCAACCCTTCAGGAAACTGTCCCTTTTCATAGT
GAACATCTTTCTAGTGCTTACTGCATATCAGGCACTGTGCTAAGCAATTTACAATTATTG
CCTCATTAGATCTGTCTGCACAACAACCCTGGGAGGGAGGTGGGGTTGTTATCCACTTTT
TACAGACGAGTAAACTGACAGGAAGTAAATCTCTACCTCAGTCTTCCTGATTCCAAGCCC
AGCCCTCTATCCACTCTGCCAACTATTTTCTTAAAGAAAAAGAATTTAACTCAACCAGCC
AACTAGTGATATATCTCATAGTAACCTTCCTTTTCCTTTCCATGTTTTAGCTTACAGTGT
TTATGTGTGGAGGGGATTGGGACCTTTAAAGAAAGTATTGGTGACCAAGTCCTGAGTGTC
CACAGACATTTTAATGTAACTTCATTTTAGAGTGGGGTGGGCGTCTGGTCTAGTTCTGTG
CTAGTGTCAGGCTTGATCTGGCCTGAAGTGATGTTGGAGTTGGGCAAAAAGAAAATAAAG
AAAGTGTGGGTTCATGAGAGGGAGGGGAAAAGCAATGGGTTATGAAGGGGTCTAGTTTGT
TTTTTTATGGCACAGAAATGACAACTTATTTTTGTTTTTTCCTTTTAGCTGCCCAATTTG
TCAAACAGAAGCTCCCAGATCTTCTGCGCTCTTACATTGACGCAGACGTCAGTGGGAATC
AAGAAGGTGGCTTCCAAGACATCGCCATAGAGGTCCTGCACCTCCTCCTCTCCCATCTCC
TTTTTGGGCAGAAGGGAGCTTTTGGGGTTGGACAGGAACAGATAGACGCTTTTCTTAAGA
CACTGCGTAGAGGTAAGAACTTTTACCTGTCTGGTAGACAACTTTATTTTAGCTCATTAA
AAATAGCTTGTATTTTTATTTAGGAGGTGGATTCTACAGAGGGGAGACATTCATTAACCG
TTCTGCTCTTGTTAAACTTCCTGCTAAAAGCATTGCAGAGCATTTTGTGCTGGAAAATCT
TGATCGTGTTTTATCTTCTTTCAACTATTTTGTGATTCCCATTCTGGGATCTTTTACTTG
GAAAGGAGACAAGGTTAAATAATCTAATAAATTCTGTGTTAGAACTGTAATTCATACTCC
CTTAACTCTTTTAGGATAAGAGTGAATAAGGAAACCGCTACAAAGGATTTTAAATAGATT
TAAGAAAAGTGCTTAGTGTGAACTTTGGAAGCAGCTCTAGTGAAGACCCAACAAATCTGT
TCTAAAAGCCGAATGGGAGAACAGTTGAGAGTGTTGCATCAGTGCTACCGCTCCCCTCAT
GTTTTGCTTTTGTCCTAGGTGTAGAATATTTGAAACTTGAAAGTAATAGTTGTAAGTCTC
AGAATGCTTCTCTTTGGAAAAGGGGCCTCTTGGTAATGGGCATAGCTATTGATAACAGCC
TTTGTGTCTTCCTGGGCTTGTGGGCTCAGCTTTGAGTTGCATTATCTCATTTCAGTTAAA
GAAAGTGAATAGGAGCATTCAAGCCAGCTCTTGAATTGGAAATTGGTTGATGTGTCTTAT
GAGGAAAACCAAATTATATCTTATTCTGATTGTTAACAAACTGACACTGATTAGTCATTT
TTAATCAAATGAATATGAAAGTTCTTTTAAAAAATGCTGTTGGCTACAGTACTACAAACA
AAAGTTATCTTTCTTTCCCAACTGGGTCCTTTCTGAACTTTCATAGTAATTTCAAGGATA
TTACCATTGTCCCATTAACATAGATAGACTTGCATTGCAATCTTATGGTCATCCTCAGTT
CCTCACTCTCATCTCCACACATGCAATCTATTGTCAGATTTTTTCATTGCTAGTTTGACA
ATATCATGTCTTCTCTTTGCTCAGAGCCACCTCATCTAGGATATTGGAATAGTAATTGGT
CTCCCAGCCTTAAGTCTTTTCTTTATTCCAATCCACCTATCCAACTACCAAAGTGGTTTT
CTTATGGCAGAGGCCTGACCATATCACTTCCCTATTATATATATCCCAGTACTCCCTATT
ACCTTCAGGTTCAAATAGAAGCTTTTTTATTTGGCATTTAAAGTTCTCTTTATGACCCAG
CTCCTTCTTTTTTCCACTCTTCGTAGACTCTATTCTGTGTATCCAACAATCCAATCCAGT
TATGTAACCTACTTGTTCCTCATATGCTGATCCATTTCCCATTTTATGTCACTTGTCTCC
CATTTCTGGAATACTCTCCCTCCTCAGCTTTACCTATTATCCCTTCAATACTCATTTCAA
ATCCTGCCTTTGCAGGAAACCTTTTCTAGGTCTGCTAGTTGCTAGTACCTTCTTTTCTGA
TATTAATCTCCATATACTACTTTATTTTGTATTTATCTGTTCTCTTCCCCCATTAGAACA
TATACTCTTTGAAAGCAGCCCCCCCCCCCTTTCTTTATACTTTTGATTCCAATGGCTATG
TTCTATTACCGAGAGTCATCTTTTCCAAAGTAGAAACATGAGGATTATGTATATGTGCTT
AATAAGAGTCTTTGGTGTATAGTAAGGGGTGGCTGAGTGGTGCAGTAGATATGGTGCTGG
GCCTCTAGACAGGAAGACTCATTTTCCTGGGTTCAAATCTGGCCTCCGGACACTTTCTAG
CTTTGTGATCTTGGGCAAGTCACTTCAGCCTGTTTGCCTCAGTTTCATCTGTCAAATGAG
TTGGAGGAGGAAATGGCAAACTACTCTGGTATCTTTGTCAAGAAAACCCCAAATGGGGAT
ATGGCTTAAATGGCTGAATAAAAACATGGTCCATAACATAAGTGGTTTTTAAGAGTTTCA
TGAGTGACATGAAGCATGGAGAACAGGAAATTGGATATTAAAATGAGCTCAATAATTTCA
TCCTAGGATTTATCAGGACAGCTTGCTTTGACTGTGAATGATAAGAGCCAAGTCTTTGGT
AAAGTAGAAAGTAGCATAATTTAAAAAACAAACAAAAAACAATCCTCTTACCTTCTTGTC
TTAGAATCATAACTATGTATTTGTTTCAAGGCAGAAGAGTAGTATGGGCTAGGCAATGGG
GGTTAAGCTCAGGGTCACATAGCTGGGAAGTAGCTGAGGCCAGGTTTGAACCCAGGACCT
CCCATCTCTAGGTCTAGTTCCCAATCTACTGAGCCACTTAGCTGCCCCCTTGCTTAATAT
ATGACTACCAGAGTGGTTGTCTAAGATATCTAGTGAAGAGAATGTTGGGCTTCGAATCTG
AAAAACCTGGGTTCAACTCTAGCTTCAGGCACTTTACTCTGTGATCCTGTGCAAATCACT
TAACTCCTGTGTGCTTCAAGTTTCCTCAACTATGCAAATGGGGATCAAATAATACCACAC
AGGATTGTTGTGAGGATCAAATGACAGCATTTGTAAAGTACCTAGGACAGTGCTGGTAGA
TATTATATTTATTATATAGACAGCTGGTATATGTGTACTAACTACTATTTTTTACTATTA
TTACTATTAATTGTTAACCATTCCTCTTCTTGAACAGATTTTCCCCAGGAACGTTGTCCT
GTGGTGCTTGCACCACTACTTTACTCTGAAAAACGGGACATTCTAATGGACAGGATCCTG
CCTGATTCTGGAGGGATAGCTAAAACCATGATGGAGAGCTCTCTGGCAGACTTCATGCAA
GAAGTAGGCTATGGCTTCTGTGCAAGGTTTGTAATAATAGCATTTTTTAAAATTACCTAC
AAATTCCAGTATAAATTTCTGAAATGTATTCCTGGTATTATATATTTCACCACCTCTGTC
TTTACTTAGATTGTATTAAAAACCAAACCACTGATATCTTTTATATTTCTGGGTATATCC
CTTTCTAGTCTAGAGAGACAAAATAAAAGAGGGGGAATTTTTTCAGCAAAACCAACTATT
GAAAAAAATCTAACATTTGTGTTATTCCATATCCAGAGTCTTAACTCCATCTCTGCAAAG
AAAGGGAGGGAGGAGGAGTCTTCTCTTTCTTTTTTGGTGCCAAACTTGGTTATCAATTGC
CAACATCCAGTTGTAAATGTTACACGGTAGTTTCTCTTTGCATAGTTTTATTCAGCATGC
TATTTTTTTCGTTCTCTGTTTATTCACTTTGTGTTGGTTTATATAGGATTTCCCTTGCTT
CTTTGTATTCTTATAATAATAATAACTAATATTTATGTAGGGTCTACTATGTGTCAGGCA
CTTGCTAAGTGCTTTATAGTCATTATCTCATTAGATCCTCACAGCAGCCAAGGGAGGTAT
TATCCCCATTTGGCAAGTGATGAAACTGAGGTTAAGTTAAGAGGTCACACAATGTTGAGG
CTGGATTTGGATTTAGGTCTTCCAGACTCTACCCCTTGGTGTTCTTTCCCCTACCCTGAC
AGCTGCCCCCCAGCATAATAATGTTATAGGACATTCGTGGACCTACCCTAAGTTATTTAG
CATTCCTGAATCTATGGACATTTGCCTTTTTTTTCTTTTTAATATTTATGACCACCTTCA
TTCAGGCATAGACTTAGCAATGAAACCTTTAGGTTAGAAGTTATGAGCATGTTAAGCAGT
TTCCATGATTTCAAATTGCCTTTTTTTTAGGCTGCCAACAGCAGTTCATCAGCATGCCTT
TCTGCCCACAATGACTTAAATGTTAGTGGTTAGTTAAGAAGATTTTGTACTCCAGGTCAA
ACAATTCTAAAATAATTCAGAGCAGGCTACATTACCTAAGCTGTGTACACAGACACCCCA
ATATTGTCATACTTTTACATTAATTTGACTATTACAAAGTTAACTGGAAAGCTTTGTGGT
TAGAATGAGTACATTGAGCCTGTTGAGTATAGGGATTGTCCTTTACCTTTCTTTGTATCC
CCAGTGCTTAGTCTTGAGCCTTACAAAAAGTAGGTGATTAAATGTTTATTGGTTGGTTCA
TTTCTTTAGTATAGTATCTTGTTTTAAAGTTAATGTTTTTCTTTTTAGTGTTGAAGAATG
TCGCAATATAATCATGCAGTTTGGTGTTCGAGAAGTCACAGCTGCTCAGGTTGCCAGGGT
TTTGGGAATGATGGCTCGGACTCATTCAGGGTTAACAGATGGCATTCCATTACAAGTGAG
TGTCAGAGGCCAACTATTTTACCAAATGACTCATAATACTCCTGTTTCTTGATTGTAACT
CAGTTGTATTATTATTGATTATTCTTGCTAACCATTTCTTCTGTATCAGTTTGCTAATGA
CAAATTATCCTTTTTTAGGCTATCTCAGCTCCTGGAAGTGGAATATGGAGTGATGGAAAA
GATAAAAGTGATGGCACTCAGGCCCATACCTGGAATGTCGAAGTCTTGATTGATGTTCTC
AAAGAGTTGGTGAGTTTGTAGCCATTGTGCTTTTAAGTGTTGCTTTAAGTAGATTCCCAA
GGGAAGAAATGTCAGGGGGTAAGCTGCTTGGTTGGAGTACTCCAGCAGTATTCATTCTCA
AGGAAAACTTGCCTTTTCACATCTTTACTACATTCCTCTAGCAAATAAATATAGAAAAAA
AGTTGGTGATAGAATAAATAGCACTATAAATAATGGAATAAGTTTGTGGAAATATGCTGT
CAAAGGCAATTTTTATATCAGTGATCTCTTCAGTATTATGGACCTTTGCAGACTTATTGA
GCACTAGAAGATAATGCTAGGAAAGAGGAATAGGAAGAAATAGAAGTCACCTAGGAAAGT
CTTCAAAGGAATCCTCTGAAGAAAAGATTGAATTTTCAAGGGTAAAGATATTGAAATTGA
AAATAATTGCCAATTTAATAAATGACCTTTTGTGGATAATTGAGGATATTGGTGGAGTTT
CTCAAGGATAATAACTAAAGTTAATAAAAATCTGTACTTCAACTTCTCCTAACATTAGGT
TAGCCACAGACTTATCCTACTTAGGACCCAAACTTAATGATATCTCAAGTATAGTTGAAA
GGAAATATTGAAATATAGAAAGGCGTTCATTTATTCATTTATTTATTTATTTATTTATTT
TGGGTTCTTGGTGTGAAAAAAGCCCATGATGATAGTCTTAGGTTATGTCTTAATTTAGAT
TTACATTTAAAGTAGTTTCTTATCTCTGTTCCTTTGTCTTCATTATGGTATGTATCTGTT
GGCCAGCTTTTAAGCTTATTTCTTAAAATCATCAAACAAGTCTTTCATTTTTATCTTGGT
AGCAGTTAGTAGCTTGTAATTTCTTATAAATTGAGATGAAGAAAAATGTTATTGAGTCTT
TTTTAAATATGTTTGACTTCATGACCCCATTTAGGATTTTCTTGGCAGATATATTAGCAT
GGATTGCCATTCCTTTTTCAGCTCATTTACAGATGAGTAAAATGAAGTAAATGTCTGAGA
CGAGGCCTGGCATTCCATCTATTGTGCTACCTAGTAGAGAAAAATAGTGATGTGGAAAAG
CCCAGTTTCCCATAGAGAATTTGTACTTGATTTTTTGTTTTTAAAAAAAAAGATTAATTA
CTCCTCAGATCCTTCTATTTGTTAATGTAAACATTTAATTCCACTTGATAACATACATTT
ACTTTAGTGTCAGTCTTTGGTTAGACAAATTAGGTAATATAGCTTGTATGGAATATTCCT
TCAACACTATCATTTTCACCATTGGTCTGTTTTTGAACTTTGTGATATGGTTAGTTGTGA
CAGATGTTGAATTTTTTCATTCTCATATTTTTTCTGCTTAGATTTAAAGTAAAATTTTGA
TAAAGAGAATGGAGGATGGGTAAAGCACATAAGTAGGAACTGTGAATTGGAGAGTCACAA
CTTTTCTATAGCTTGTGCCAGTAATTTTGAAAATATCTTCTGCTAAAGATAAGGGTTCCC
TGCTTTAGTCTCTCTTTAGATTAAATTCTCTTTTCTGTTTTAATGTTACTATTTTAAAGA
AAGAACCCACAGATTTTCCCTAACTTTAATTTTATATGGTAGTAAGTTATTCAGTAGGCT
TATTTATTTATATTTTTCCCTCCTGGTTTTAGAACCCAAGTTTGAATTTCAAGGAAGTAA
CTTATGAATTAGACCACCCTGGATTTCAAATTCGTGACAGCAAAGGACTTCAGCACGTGG
TGTATGGCATTCAGAGAGGTCTAGGACTGGAAGTCTTCCCAGTGGACCTTATTTATAGGC
CTTGGAAACATGCAGAGGGCCAGGTAAGCCTACTACATAATTAGATTTTACAAGGGGAGG
CAACAATCACATATAACTGATGCATAGAACTACCATATGCCTATATTACCCGATTTCTTG
TAGTAAATTAGAAATAAATTTGATTTACTTAAAAACAAAACAAAATTTAAAAAATGATAA
CACTTACATATCACTTCAGTTTAAATGCATGCATACTCAGTATGGATACAGCTGTCTAGC
TATTTGCCTAAGAATCCTAATGGCAAATAACTGCAATGCTTCTTTTTGGGTTTTGAAGCT
TTGGGATTTGTGTGAATATGAAGAGGGTCTGGAGAGACCCACATTTCTCTAGTTTCTTAT
ACTTTTGAATGCTTTTTTTATGTAAAAGGTATCTTAAATTTGGAGCAGTAGTACAATCAG
GAAGTCTTAAAATATAATAAAGTTTGTATTTTTTCTTTTTCTAGCTCTCCTTCATTCAGC
ATTCACTGATAAATCCAGAGATCTTCTGTTTTGCTGACTATCCCTGTCATACAGTTGCCA
CTGATATCCTCAAAGCACCACCAGAGGATGACAATCGAGAAATAGCCACATGGTAAATCT
TAACTTACTTTCCTGTAATGGGAATTGGATCTCTCTCTTTTGAAATGATTAACTTTTACT
AGCCAACAAATTCAATACATTATGAGCCAGCAATAATGGCCCTAACTTTGTAGTTTGTCT
ACTGTTATAGAGTGTTCCTCTACCTGTTCCCTTGTGGGTTTTCATTTCATATAAGAGACA
AGTTATTTGATAATATTTTCTCCAAATTTCCCTGTGTGAGCATTGTATCTTAAATCTTTG
TTCTTGAGCTGTCTGACATTAGGCTTGCTCCAAAATCAGGAATTTGAGAATGTAATAAGT
GGTTATTGGATTTGAGGCCAGAGTTTCATACTTCCTGAAAAAGTGCTAAGTATTTCTTTT
TCTCTTTTTTCCTCCCCTTTCCTCTTCAATTCTCTTTCTTTTTTGAGGTAAAGTTAAAAT
AGCATAATAATCATTCAATTACTGATAGCATGTAAAGAGAGTTATTTCCACTAAGATGCT
GGTTTTTCTATGGGGGATTGAAATGTATTTTCTTCTGGTAAAACAGGGATTGTTTTCTGT
CCTGGTACTTAATTATTTTTGAACTTGCAAAAATAGCAAAATGTTCTAGCTTCCTTTTGT
TTAGGTAGGTAACTTTTGTCCATTCTCTTCCCTTTTGGGGCCTTTATGGATAAATATTTC
AGCTTTTGTCATAAATTACTAATTGTAAATTTGAGGGCACAATTTCTTGAAATCCTCTCT
TCCATTTTCTATAGAGATGCTTTGCAGAGTTGGAACTGTTAAGTCATTTTACTGAGAGAA
AAAAGTTTCATAGAATTATGTTTCCATCTTATTTAGGATTCTGACCCTAAAGGCTTATTA
AGCTGTCATGAGCTTAAACAGAAGGCACTCCTATTGGCAATCAAATCTGTGAGATAATGA
AGTTAAACCAAAGAATTGGCAACCTTTGCTTTTAAGTTTGCATTAGTCTGTTTCTTTGAT
TTTTACCTACTACCCTGGTTGATTTTAAATCTGAGAATGCCATGTAGATTTTAGTAGATA
CTCCCTGAATAAATTTATCATAAGTCACTGAGGCTGATTAAATATATGTTTGTGGTTTTT
TTTTCCTTGTGTAATGCTTCATTTTTTCCCCCCAATTATATGTAAAAACAATTTTTGGTA
TTTGTCTTCTAACACTTCAAATTCTAAATTCTCTCTCTTCCTTTAATCCCCTCTTTCTGA
GACAGTAAACAATTTGATATTAATTTTATAAAACATTGTCATATTCATTATGTTATGGAA
GAAGACACTTTAAAAAATGAAGAAAATAAAGTGGAAAGTGGTATGTTTTGATCTGTATTC
AGACTTGTCAGTTCTTTTTCTGGTTATGGATAATATTTTTCATCAGGAGTCCCTTGGTTT
GTTTTGGATCATTGTGTTGCTAAGAATAGTTAAATCATTCAGTTGTTCATTGTACAGTAT
TACCATTACTGAGTATAGTGTTCTGGTTGTGCTCAGTTTTACTCTGCATCAGTTCATGTA
AGTCTTCCCAGGTTTTTCTGAAATCTTGTTATTCACCATTTTCTTAGAGCACTATAGTAT
TCCATTACAATCATATACCACAACTTGTTCAGCCATTCACCAGTGGGATGATCATCCCCC
TCAATTTCCAGCTCTTTGGTATCATGAAAAGTGCTGCTACAAATATTTTTCTACAGATAA
GGCCTTTTCCCTTGGGGGAAAAAAAACTCAACAATCACTTCGAATAGAAATCTAGTGGTA
GACTGGATTCAAGTATATGCAGTTTTATAACCCTTTGGTCATAGCTCCAAATTGCTCTCT
AGAATGGTTAGATCAATGCACAATTCCCACAACAGTGCCTTAGTGTCCCTACCCAACATA
TTAGCACTTCCCATTCCCATTACTATTGTGTTTTGAGCTTTTGTTGTAGTTTCTTTAAAG
TATTTCTTTAGACTGTGTAGACATAGAGTAGTTTCTTTAGACTGATTAAGCAGTGTGTTG
CCAAAATGTTTATAGTCAGAAGCATAAGTTTATTGAAATTCAGAAAGGCTAACTTTTTAT
GTTACTTCAATATTTTTTGAAACGGGGAAAAATGCTATCTTTCATGGAAAACTAGAAAGA
ATCTGGGATAAAGTGTGTGTATGGGGTTTGTTCTTAAACTCAGGCCTGCCTCTAGACTTG
CTAGTGATGTGCTGTACATGTTATCCTAGACTTAAAGAAAAGAAGACCTAGATTCAAATC
TGGTCTCTGCTGTGTGAACTGGGCAACTGTGTAAACTTAAACTCTCTAAACCCTTAGTTT
CTTCTTCTGTATAATGTGGAAGGAAGGGATTAAATTAGTGAAATCTAAAGTTCCATCCAC
CTCTTGGTCTAGAGTTTCTTGATTCTTGATTGACGATAACTTTGCCCCTTTTAAAAAAAT
TTCAAATCTGCACTAAAGTCAACACAAGTTTTCATGAAGTGCCTCATGAAGTGCCAGATG
CTATGCTGGGTGGGAGGGAAGCATTCCCTCTTCATCTGTATGTTACATTCCAGTGAGGCA
GCAACATATACATATATGTCTATACAGAATAAATACTAAGAGAAAGCTACAAATAAGCTG
AAAGTAGTTTAAACACAAGGTAGTTGGAAGGCTGGGCATTAAGAGTGGCTTCATGCAGAA
GGTGATGTATGAGCATTAAGGAAGAGAGTGACTCTGAGGCAGAGGTGAGGAGATGGGCAG
CTGGTACAGATGAACCAAGGTAGTAAAGTGGAATATTGTGTGTGAAATCCCACTTTGACT
AAGTAGGAGAATTTGAGAGTGGAAATGATGTTTAATGAGGCTAGAAAGAGAACTATGGGT
TAGGTTGTATTGGGTTTTAATATATGAATAGATGACTTGATAGGCCATAAGCAGCCATTC
AAGTTGGTTGACCAGGGTTTACAGTCAGGTTTGCACTTAAAAGCCATACTGGTAGCAATG
TGTAGGATGAATTTAAGTGGAAAAAGACTAGAGGCACTAAGACTAATTGGGAAGCTATTA
TTATAAGAATGCAGGTGAGCAGTGATGACTGCCTGAACCAAGAGGATGGCTTTTGGAGTG
GATATTAAGGGGTTAAAGAGATATCTTGGAGGTAGAAATGGCAAAATGTATTAACCAATT
AAATATGCAAAGCAACAGAGACAGAGGTGTTGAATGCCAGAGTTAGAAACTTGGAAGATG
GGAAGAATGTTTGGTACCTTTGACTAAAATAGGAAAGTGTAGAAGCAAGAAGAGATCAGG
GAAAAGATGTTGAATTTGGGATGTCCATTTTGAAATGCCTAATAGGCAGTTTGTGATTAG
ATGTTGAAGCTTAGGAAAAATACTTGGCTCATATAACTCAGAGGGTCATTACTGTACTAA
TCATTATACCTTCTTCAGCATAAGTTTAACCAAAAAATATTGCTCAAGAAATAATATTGT
ACAACATGTAAACTTTAAGGTAATTAATAATTTTTTACCACAGCATCTTGGTCTGAGTAT
CTGGTAAATTATAGTTGTAATTCAACAAACTTAATTTCTGTATGTGAATTCTCATATGCC
ATCTAACTTCTATTTTGGTTAGGAAGAGCCTGGACTTGATTGAATCTCTCTTGCGACTGG
CAGAGGTGGGGCAGTATGAGCAGGTCAAACAGCTCTTCAGCTTTCCCATCAAGCACTGTC
CAGATATGTTGGTATTGGCCTTACTACAGATCAACACTTCTTGGCACACATTGCGCCATG
AACTCATCTCCACCCTGATGCCAATTTTCCTTGGAAATCATCCCAACTCTGCCATTATTT
TGCACTATGCCTGGCATGGGCAGGTAAGAATTCACTACTTTGCTAATTAATTTTATTTAA
TTGCTTTTTTCCTCAGGAAAAAATTGTCCTTTTAAGTGGATTCTCCATTTATGTCATGAA
GCTTTATGGTGCTAAATGTCTTGGGAGGCCTAGGTTCAAGGTACAGACTTCTAGCTCTGT
GACTCTGGGTGTATGAATTTCCTTTTGCTTCAGTTTCATCAGCTGAAGTTCCTAGCAGCT
CTAGGTCTAATGTCATTTCTGTGACAATGGGGTACTTTTCATGATTTTTCATAGGTAGAG
TATTTTCCCGAATATTTCCTTCTGACATCCTATTCCATGTCTCAGTTATTTGTACTTGCT
TCCAAAAAGCCTGTATCTCTTTCTTAAACAATTCTTGTGTTCACTAGTTTCCAAATAGGA
CCTATCCATAGTACTCAGACATGTGTCTACCTGATAGTTGATTGTACACACATTGTTCTT
TGTTGTACCTTTCTCAAGAGGATTGTGTAAAGTATGGAAATCATGCCAACTTTATCATTT
TTCCCCCTATAGAATTTAGGAATGTACCTCAAAGTGGTTAGAAAATCTTGCCACTATTAG
TCCAAGTCTCACAGCTCTTTTTTGTATGACTTTTCTACTTTGAGATACTGAAGACTGCCA
TAAAATTTTTTATTTTCCAGATGTACAACTTAATTTCATTAAGTTAAATAAATGAGTGCT
GTTTTAAGGCACTACAAATAATTATATAGGCTTTAGTTTGCTTACTGTTTTTATAGTCCA
CGGTATTTTATTATTAATGTCACAGACTCCCCTTAGTGTTTCTTTCCTACCATCAAAAAA
GCCGGGCCGTGAATATTTTTATACATGTTGTTTTCCTTTGATCTCTGGGGTATAGACTTA
GCAGTAGGGTAGCTGGGTCAAAGGGTAATACACAGTTGATAACTTTATGGGCCCAATTCC
AAGTTGCTTTCCAGAATGGCTAGACCAGTTGTCAGCTCTACTCAGCATATCTGTTTTCCC
AGAGCCACTCAGAATCTCTTGTTTTCCTTTTTTTTTTTGTCAACTTTGTTTACTCTAGAA
TTGTTTTAACTTGTATTTCTCTAAGGAACATAGACAATTTTTTTCCAGTAGCTTTTGATA
GTTTGAATTTCTTCCTCTTGAGAACTGCTTGTTTATAACTTCACCATTTAACTCTTGACA
AATGGCTCTTATTCTTGAACATCTGAGTCACAAATGTATATCAGCCCTATATATCTTAGA
GTTGAGAAAAATTTCATATGTATAAATGGAATAGTGTCTTCTAGGTCAGTTTAGACAGGT
TAACAAAGTTTCGATATAGATAATCAAGGGGTTTTTATAATTTAAGAGCAAACTCTTTAA
AACAGCATTAAGAAATAATATGGATGATATTTAAAAATATATGGTTGGGTGTTTCAGCTT
TGATCAACCTTTAATTTAAGACTGAAAATTTTTTAGAATTTTTTTGGTGATTGAGAATTG
GAAGTTAATTACCCTTAGATTTAAATTTAAAACATAGCAGTATCTTGTTAATTTTAAGTG
TGGTCCTTGAGTGAATTTACCACAGGTCCAAGAGGGTTCCGTGCCTTAAAATTGTTTCCA
TTTTACTATTGTAGTAAACTTCTTTTTTAGTTGATTTGAAACTTTTAAGCAGAGACTCAT
TAACATGATAAAATTTGTCTTAACTAGTTATAAACTAGTTTCTCGTGATTCTACTAAACT
TTGTTGTTGTTGTTTGTTTTACCAAAATGTTACAATATTCTGAATCTATCTTTTTTGGAC
TGTATAACCATGTGCTGCTCATGCTTTTGATCTGTAGATGGTCTCTGGTAAAAGTTAAGA
TGGAGCTGTGAAATGCTTGTTGCTAGAGAGCAGTTAAATGGCCTTGCTCCTCTGCCTCTT
CCCTTTTTTTAGGGACAGTCTCCCTCGATTCGCCAGCTCATCATGCACGCCATGGCCGAG
TGGTATATGCGGGGGGAACAGTACGACCAAGCCAAGTTGTCCCGAATTCTTGATGTGGCC
CAGGACTTGAAGGTGAGTTGGGAGTGATGCTTTGTCATTGCCTTTTTTGGTTCATTGTAG
TACTCACATCACTATTCAATTACAAATGGCACCTCTAGGAAGAATCGACAGTGTAGTGAG
CTTTGACCGTATCAGGACTTAGATTTTTTTCCCACCTTGTTAGGTCAGCTAGTTGTTACT
TTTGCTCAGCAGGTGCTGCACACTTTGTTTTTGCAAAACTTTCCTTGTTATCAGAAGGTG
ATGGTAGTAGTGTGCCTCTGGAAAGTCTAAAGTTTTTTAGCTATTCATTGTATTTTAGCT
TCTGTGGTCTTTAAGCCATCTGAAGGCTTTCCATTTTGGGCTATTTTCCCATGGGATATT
TTTGTTATGTTTCTTGGAGGTGTCTTATCGCCTTTCTATGGACTTTTGACTTATTTGGGG
TGCAGCTTTTGGTAGCACAGCAGGTGTATAGGGCCGACGGGGCCTTTTGAAGGTAGTTCA
TCTGTCGCCTCGTTATTGCACGCTCGGGTGTGCTTTGTACTCCTGACGTTCTAGTTGAGC
TTTTGCTAGAGGAAGCTTGTGCAGAGACGTCTCAGATACAGGTTATGGACAGCTCCGATC
CACCATTTGAGCGAAGTCGTTGTCTTCCTCTGTGCGGTCACTGAGCTCCAGGTCTCCAGG
CTGAGTGGGCAGGTGGCGCCGTGCTCCCACATGCAGAGCACTGGCTCTCACTGCGAGCAC
GACGGCATGCTCCCAATAGTGCTGGGCTCTGTGTTGTCACCCAGAGACCTGCCTGTGACG
GAGAGGGGTTGGAGAGAGCGCGGCAGAGAGGGGCAGTCACTGATCTTTTGACTAGCAGTC
TCTAATCTCTTTCCTTTAGGCCTTGTCAATGCTGCTAAATGGTACTCCATTTGCCTTTGT
TATTGACCTTGCTGCACTTGCCTCTCGCCGGGAATACCTCAAACTTGACAAATGGCTCAC
AGATAAAATTCGGGAGCATGGGGTAAAGCAGGATTTTTCCTTTCATTTCTGAATTTAACT
CTGGTGATGAAAAATTGCTAAAGAAGTGATCTAGCTATGTAGCATTGAAGATGTGGAAAA
TGTTTGTGGTCTCATAGCTCAGCTCCCTATCCCTGTCCCCCTAAAACCCTATTGAACTTA
GTAGCTTAGTACGTTGTCTTTTGTCTGATAATGATTGAGATGAAATTCAAACAGATTGAG
ACTTTCTCTTTCTCAGGAGCCCTTCATCCAGGCCTGTATGACTTTCTTAAAGAGACGGTG
CCCTTCCATCTTGGGCGGCCTTGCCCCAGAGAAAGATCAGCCTAAAAGTGCTCAACTTCC
TCCAGAAACACTGGCAACGATGTTGGCTTGTCTACAAGCTTGTGCAGGGTAAGAGTGTCT
GGAAATTATTTCAAATGTTGGGGTTAGGAACAAATGGTGGTTGTTTTTACACCTCACTAA
GTTTTGAATATATTTCTTCACTCTCTCCCACATCTGTTAAACTACTCCCTTGTAATGTAT
ACTAAAAAAGAATGAGGAGGGAGCAATTCTGCAAACTTAATGAACACACTGACTATATCT
GAGCATAGCAGGTTGCATTCCACATACCACTCTTCTGTGCCTATATCATGGTTATAATAA
GTACTTAGCATTCTTTTCTACAGTGTGGTAATATATATTGAGTTCACACATAACACTTGT
GTATAGACATTTCCCAATTTGTTTCACCTTGTTTTTAGTTCTTTAATATCACTAAATGGC
TTGCTATGAATTTTTTGGTATATGAGAATTTTTAGTCTTTGGCTTCTAACCTCTGGTTTG
GAATTTCTTTTGAGTTAGAGGGTCATTGTGGTATATTGTGCCGAATCATTATACCACCTT
ATAGCTCTACCAGCAATGTGATGGTGTGCCCAGGGTACCTCAGTCTAGCCAACGTAAATA
ATAGCTTTTTTGGAAAAAATTTTGTGTAAGCAGTTTTATTATACTTAAATTTGCTTTTCA
CTTAATAGAACTTTCATAGTTTGAAGGCAAAGACTGTTCTCATAAAACCTGAGAAATGAA
TTGCTGGGTTTACCCAGGTTGTATTAAAAATTCAATAGTATTTTGGCTTTTTCAGGGGTG
AACTTTGCATTATCTCTGGGACTATTTTCAAGACAAATAGTATAAGTTAAAATTTCACAG
CGAATATTTAAACTGTTTTTGAAGACTTTAGCCAAACTTTTAAAAAAAGATTACCAGTTA
GTCCTACATTCTCATTATAAATAAGGCTTTACTTAGAAATCTGTTAATTCTGTTCATTCA
GTTTATATTCAGAAAAAAATAAGATTTTTTTTTAAAAAGCTATAGCTTATTCCTTTCATC
AGCCTCTGAATATTTGTCTGCCAGGTACTCTGACCTTGTGAGGATCTTGCTTGTTATCCT
TCTCTCCACTCACCAGTATCACCTTAGTTAATCTCTCATCACCTCTCACCTAGATTTTTG
TACTGTCTTCCTCCTTTGATCTCTGTCTATCCCTACTTATTCCAGCCTCATTGAATATTA
GTGTCTTTCTCACACTCTGGAAGTTAGCCGAACTGGCTTTTTTTTCTGTTCTTGACCCCC
TCCTCCCCCCATACTCCATTTGCTGTCTTTGTCTGCATTTGCACTGGCTATAGCCAATGA
TTGGAATGTAGGCCCTTCTCCTCTCTGCCTCACAAGTCACTCTCTTTACAACATACTTAA
TGGACCACCCTGTCCATGAAGCCTAGGAGGGGCTTTATTAAATCTTGCTAGCTTTCTGTT
TTGACATGCTGCCTCCTAATAGAACTATTGCTTCTCATTTTGACACATTGTGATTAGGTT
AAAAATATTTTTGCTGTGGTATTTGGCTAGCCATTAGACTTAATTTTTGCCCTGTACAAA
ATCACTGAGGGGCCCATGTTCTAGTACATTTATTCAGCAGTTTGAACTGAACTGGAAAAG
GATTCAGGATTTACCAACATTAGCTAGAAATGCTTCAGGTTAGAGATCGGTTAGGAACTT
TACATCTTTACTTAAAAAGGTTTGTTTTTGCTCTGTTATTTTATTCATATCAGACATAAT
AATTTGGATTAAAGAACTTGAGTTTAGTCCCTGAAATTCAGACAGTAATATGTTAAGTGG
GGCAATGGATCTGGCCAAGACCAATCCCTAAATTTTTAATGAATACCTAGCATGAAAGCA
TCCCATAATATTGTTTCCTTCCCTTTACTATGGTCTTGTGCAGCAGTGCCACCTCTTGGG
CAGTGTAGGAAATTTCCTCATCTATTAAAAGTCATTTCTAAAACTCTTAAGATAATGGAC
TAATCCTGTTTTTATTTTAAGGCCCACAACTTCTTCCACTCTCGGTAATCTTCCTCAGGA
AAGTTGGTGCAATAGGAGAGTTGGAAAGTACCTCAGTGACCATCTAGTCCAACCCATACG
TGAAAAAAAAATCTCTACTCTAACACATCTGACAAGTGGTCATTGTTTGAAGACCTCCAA
GGAGGGGGAACCTACCACCCCTCTAGGCAGCCAATTCCACTCCTGGACAGCTCTAATTGT
TAGTAAGTTTCTCCTAGCATCAAGCTTAAACTTGTCTTTTTACAATGTCCAATCATTGTT
GCTGCTTGTGCCCTCTGAGGGCCAAACAAAAGAAGTCTAATCCAACCACCTAAAAAAAAA
AAAGGCTCTTTAAATCCTTGGAGACAGCTGTCACCCCCACCCCACCTACCCCACCCCGCC
ACCACCAACCACCCTGAATCTTTTCTAGGTTGAACATGCCCCAGTTCCTTCAACTCATTC
TCATAAGACATGGAATGAGGACCTTCATCAATTTGTTGGGTGCTATGATTCCTGGCTCCT
TCCTCCCTATATTTTAATTTTTAAGAGTTGAAAAGATTAAGCAAGGCTAAAGATGGGCCT
ATATGATTGCAATAAGGAGTAATTTTTGAAGTGAAGTTAGATTTTAGGAATGAGTACTAT
ATATCTCAAAAGCCCTTTAAAGTGCATAACCTTATAACACCAAACTTGGTTTTCTTTAAG
CACAAGCATTCAAGAGAGAGAAACTTGAATTCTATCATTGAAGAAGTATTCTGCATTTTT
GGCATTAATATGCAATATTTTTTTACTTACATTATGGGTTAAATAGGTCTTTATGGATTA
GCCTAGAAACCTAACTACCATTTCATAATGTTTCTGCCTAGAAATTTTCTGTTTATTTGT
ATGTTGTCTACCTCATTGAAAGGTAAGGTCTTTGAGGGTAGAGTTTCTACTATTCTAGGG
TACCTGAGTTCATATTCAGCCTGACAGTAGCTGTGGGCAAATCATTTAACCTCTTGTGTG
ATTCAGATTTTTCAATTTTAATGTGGGGGTAATAATAGCATCTTTCTTCTGGGTGAGAAT
CAAATTGAGCTAATGTTTGTAAAATGCTTAGAACAGTGCCTGGCACACAGTAGATGCTCT
ATAAATGTTAACTTTTACTGCATCCCCTGTGATTAGCACAGTGTCTGATATACAGTAAAT
ACTTAGTGTAGGTGCTTTTAGATTTGACTTGAAACAGCTAAACTATAAGAAAGTCTAAAA
GTTGGACACAGTCAGTGTCTAGTAGATCAGATTCTCTTCCACTCCCATTATTTTGGTCTC
TGATATATGATACTAGGACAGTGAGCGCATTGAGGTTAGATGCCAGCATTCTTCTCCATA
AGGCTTTAATGTGTTGTTGCACCATTAAACTTTAGGACAAAAAAATGCCAAATGTTCAAT
TTATTGGTCAGAGGGCTCCCTTATTGAAGAAATACATTGAGATTCTTGATGTATGAAAGA
AATTAAGAATGCATTTTCCCCTAACTTATATCCTCTTCATTTTTTTTTTCTATAGAGAGC
CAGACTAGTAACTCACATTTGACACACAGTCTATATTTATGACTTAAAAGCCCCAAACAT
AAGTTCAGGTGAGTTCTAGCTAGCCTCCTAAACTTCATTCACTTCAAGCATTTATAAGAG
CTAATGTTTTAAATCTTAACTCCTTGTATAAGGATAGAAAGGATAGTTTATAAAGAGTTC
CTAGAAGAATTTTCAGTAGATTTTGGATAAAGATCTAACAGGGGATTGTGTACATTCCAG
AAACCAGAACAGTTTTAGTTTGGGGGTTCAACATTTAAGTGAAAGTGCCTTTAAGGACTT
TTTCCTTTCCATATCTGCCAATGATGATGTTTCATCTTGGATTTTTGTCACCTTTACTGT
CATGGTGATTCACATTTTATATACTTATACAATGAAGAAAGCATTATTATCATTATTTGG
CATCATTAGCTGCTACTCTAGAATAACAACAATAATTGCTTGCATTTAGATAACAATTTC
AGGTTGGCAAACTTCTATATGTTTGAGAATTGGTCCCCACAGCAACCCCATGAGGTAGGT
CTGTATTGCTATTAGCCCTATTTTATCCCTCTTTTCCAGATGAGAAAACAGGAAGAGAGA
AAAGTTAAGTGTCTTGTTCCCTGAGATGGGACCTGAACTACGGTCTTTACTCTTTTATGT
CTGTATTCCATAGTAGAGAAAATGCCAAGCATAAGACATAGAACCATACCTGCTATATTG
ATTAATTTAGGTGCCACAGTCTCCAGAAAATAAAAAAATGTTAATTTCATTTTAATTGAT
GTAGGTTTTTTTTTTCATTTTCTACATTTTCTAAAACTTTATAAGCTCTGTTCCTGGCTA
GTTTTGAATCTTTTTCATCTAATGGTTATATATTTTGGTTAATGTTTAAATAGTATTGTA
ACCTTTGGTTAGAACATTTCATAGACTGAGCTTTGCTTTATACTAGTTTATTTTAATTTT
CCCAGTATAATTTTTAAAACTTTAAAAAATTTTAATTTGCAGAAATATTTATCCCATGTC
AAAAGAAAAATTCAACCCTTGTTACAAATAGAATTAAAACAAATTTCCAAATGGCTATGC
TATTTTTTTTTAAAGGTTTCATTTTGTACTCGTGTCTTTTACCTTTCTATAAGGAAAAGG
GTAGCATATTTTATCACCAATTCTCTGGAATTGTAATAGTTGGTCATTAAGCTAATTAGA
ATTCCAAAAGTATTTCAAAGTTGTTTGACTTTACGAAATTACTGTCAGTTTGTGAATTAT
TCTTGTGAGTTTGGTCCCTCTACACTGTATTAGTTTATATAAGTCTTCCTCTAGGTTTCT
CAGAAATAATCATTTTTATAATTTTTTATAGCATAATAGTTATTCCACCACATTTATTGT
GCTTTCACTTCTTCAACATTTCAGTTGATGGGGATTGACCATCAGTTTCTAATTTTTTTG
CTACCAGAAAAAAAAAATGTGTGTATGTATATATTTTTAAACATGTACAAAGTTTGTTTT
GCTTAGGAGTGGTTCCTCTTTTAATCTATACTCTCTCTAACTCCTGTCTGTCCCTTTCCC
CCCATCTATTTCCACATTGAGTAAAATTATTTTTGTATCTTAACTATATTTTTGTGTTCT
CTCTTTTGGCCAGATCAGATAAGAGAATGGTTAAAATGTCAAGACCCCCCCCCCCCCCCC
CCTTGTATTCTCCTTTCTCTCCTTTTCTGTTCTTTTAATATCAAGAACATAACAACCATT
CTTAGGCCTCCTGTCTAATTCTGTTGTCACCGAGACCCCTAATGATAAGGAATTTCATAG
AGGACATATCTACTCATATTAGACTATAAGCACTTTATCCTTGTTTAGCTCCTCATGACT
TTGTTTTCTTGACCTCTCCATTTGCCCTTCAGAGTTTCTACTTGGCACTGATTTTTTTCA
CCAGGAATGCTTGGGAGTCCTTTTTTACTCTCCTTCTCCCCTCCCCCCCCCAATATCAAT
GTGTTTCTTGGTGAGTTAATTATGGCTGTGACCTTAAATCCTTTGCCTTCTGAAATATCT
TCACTCCTTTCTTGTGATGATGGCTAAATTATGTGTAATCCTGACAGTGGTGCTTGACAA
TTCTGGCTGCCTGCAGTATTTTTTCTTTGACCTGGAAACTCTGGACTTTGGCTATGATGT
TCTCGGGAGTTTTGATTTTCGGGGTTTTAGAAGGTAACAGATGAATTCATTCTGTTTCTA
GCTTGCCCTCTAATTCTAAGAGAACTGTCCAGTTTTCTTTTACAATTTATTTAGGCCCTT
TTTGGGTCAAAAATTTTCAGGTAGTCCTATAATTTTAATGCTTTCTCCTTGATCTATTTT
CTTGGCTAATTGTTTTTGTTGTGAGATACTTTACATTTTCTTCCAAATTTTTTTGTCTTT
GGATTTCATTATTTCTTATTGTCATTGAAGTCATTCGCTTGTATTTGGTTCATCCTAATT
TTCAAGAAGTTTATTGGTTGGACCAGACTTTGTAACTTTGTACCTTACTAGTTCTAATTT
TTACTTCAGTGCCTTTCATTTCCAGTTTTTTTCCTTCTAGCACTTCGATTTCACTTATAA
AAGCATTTAAAAATTCTTTTTTAATTCTTGCTTTGTCTCTTCCAGGAATTCTAGTTGAAT
TTATGTCCAAGCTTTGTTCTTCTTTGAGACTTGCTTGTGGGTGTTTTTGAAGCTTTCTTT
TGGGTTTGTATCTTGATTTCACAGTAATAGCTTTTTATGGTGAAATTCTCTTTGTTTATT
TGCTCTTTTTCCAGAGTCAGGTTCTGCACACTTCTACAGGAATATCTGAGCTGGTCTTGC
TACTGTACAGGTAGTAGGACCAGGCTCCCTTTGGGTTTGGGATTCCCAACATGTTATTCC
ACTTCAGGCTTAAGGTCAGGCTGGAAGCTGGAGCCAAGACCCTTTCTCCCTCCTATTGAA
TGACCCCAATGGGACTGTGGGTGACTTCTGAACTCCTTTCTTGCTCAGTACAAGCAGCTG
AAAACCTGGATTGCTCTTTCTCCAGGAGTGTCTTTTTTGGGCTCAATCCCTCCCCTTAGC
CTGCCAGCATCTGTGACCTATAATGAGTAGTGAGACTGCCAGGTGGCTCCCATTCCCAGC
ACTTGCACTTGTGGCATGAGGGGAATCCTGTCCCCACCCCGACTTGTTCTTGAATTTCTC
CATCAAGATGTAGCTTGGTGCATTTCGAGCTTTGTGGAGTGATCCTTGCTCCACTTTTCC
TTGCTACTTGGGCATCTTGATTCAACCCCCCTCTTAAAAAAGTTCAGGAGTTCTCTTTAT
TTTGTTGGGATATTTGTTTTCACCATTACTGTATTTGGAAGTGAAAGTGCCCCAAAAGTC
TTTATAGTTTTAAGTTTCAATAACTATTAAAGCTATTTTATTTAATAGCTATTTAAGTAA
AACTTAAAACTGCAATAAAACTTTTGGGACCCAGCTATATCTCGTCCATAATCTTTCCTC
CTCAGGCAGCCACCATTTTTTGTAACTAAGAATTGAGATTAAAAAACAAAATTGGGCAGA
CTCCCTAGCACACTAACCATAGCTGACCAGAGAAGGGGGAGGTTATTGCATTTTTCTTAA
TTATTATAATATAGAATTCATTTGATGTTTATATTTATTAAACTATATTGATTTGATTTT
ATTTATATTGTTGCCTGAAATACTTTTTGTCTTGACTGAATTAACTTTTGGAAATTCAGA
TGGCAAATACCAGTCAGACTGGATCACAGGTATTTGAATTTCATTATAGTCATAAAACAG
TTGTCATGCTTTTGCTTTATTATAAACATTACTTTCCTTAGCCCTAATAGAAAGTCAAGC
TTAAATTTGCAATATTTATAGTTACCTGAGTGATATCCTTTTTCTTCACATGTGTTGCCC
AAGACCTTTTTAGAATTAGATATAGTGGTTGAAAATGTGAGAAACTGAATTTAGAGGTTA
TTAAGTGTGGGTGTAGGGAGTGGTTTCTAGCAAGTAAGAGGTTTTTGAGATCAGGGGTAG
CCTACAAAATAAATAGGTATGCATGGAACTCAAAGACAAATTATAAAAATTGGGATGTAG
GGCATTTAATATGCCAAAAGTAATTCAGATAAGGATGAAAGGACAAGAGAAAACAGTAAG
TTACTAGTTTGTATAGGAGTCAAGGAGTCAGAGCAACAATTTTCTCTTTTTTTGATTTTG
CAATATTTTAATTGAAATCTATTCCATTGCTTATGTTCTTAAGGTAGAGAAGAAACCAGG
TGCACAGAGTATATAATGAGGGTTTGTATTTGTTTGAGGAAAGAAGTAATGACTTGTTAT
AACTTAAGAGGATTTAACTGCCTGTTTTCTGTGGTCCACTTTATAATCAGCAAAAAGTAA
GTTTTGTAATGGGAAGTTTCTTAATCTTGTATATTAATTAGTTCTATAAGTTGAATGATG
AGATTAACTTCTGAAGTAGACAGGCTTCTGCTTCTTTCAAAGTTGGTAGAAATTATTGTC
TTCTATGTTCTTTTCAATGTCATTATTATGTACATATGATTCTCTTCTAATGTGGTGTAA
ATTGGTTCTAAAACAGTTGAAGTCTTGGACTTAGGTTTATATTGAAAAACCTTATGGAGA
TAGCTTGTTGACTCTTACACATTCATCAGTTTATAGTTTCCCTTCCATTTGCTATTCTGT
TTATTATTCTGTTATACCACTTGACTCAGAAAGTTAATTAATTATTCCAACCCTATTTTA
TAGGAAAAGACTGCGTAAAATCCCTTAAATAATTTCCAACTACTTTAATAGATCCTAGTT
TTTTTCCTTTTAAAATTTAGAAATTCAACTTTTTCATTATCATAATAGAAAACAACTACT
TACATAAAACCAATAATTAACCTCATTTTTACTATAACAAAAATTTGCTGTTTCTTCCCA
AATACTGGTTATATTTTCCACTAACCAATGTTTTGAGCAAATCTCTTTAGGAAGCATGGG
CTATATAAATATAATTGATGACCTAACTTTTTTTTAAATATGTGGTTAAATCACTTTTTA
AAAATGCAAATTAGGCTACTAATTAATGTTCTTTCCTTTGAAACTCCTACCTCTTGAGGT
ATCAGTAGGTTACCAACCTTTACCAACTTTATAACTTATAACATTTGTATTATGTTTAGT
TTAAAGGGATATTAAAACAGGTCTTAAATTTTTAAACTGTAATTCATTAGGTAATGCTGT
AAAGAACAAAATTTCATAGACTGTCAGTCATATTTGTCTTTGAAATTGAGAGCTAGTTAA
AGTTTAAAGAGGTTAAAGTATTTAAGTCAGTTTTAGGATAACTTCTGCCTTTCTATGCCA
GTAGTTTCTTGGTGTAAATGTTTAATGAACAAAGTGAGTGGAAAAGGGAGACAAAAGGCT
TTGACAAGGTAGTAATGGCCTTTTGTTTGGGAGCAGCAGCTTTAAATGTAGGTAGCTTTC
ATCTTCATATGTTCACCTGGTGGAGAGAGTCTGCCTGCTTGTTAATATGGCACTGAGAGA
ACTTTAATAGAATTTAGCATAAACTTAACAGTTAATATTTTAAAGACCTTTGCTGTAGTA
TGAAGCAAGATAAATATAGATTATGCTTGTATATTCCTGCAGAGATTATACGTTTTGATA
AAATGGTAGAGATAGGGCTACCTCTATAGGATTTCTTTACATTTTTCCAATCCATCATCT
TTATACTTAAGTTATAAAGTTTAGTAACTTATTGACACCTCAAGAGAAAGTATTAGCTAT
GACTTTTTTTTCCCAATCCCATCATACTGTGTCACAAGGCAAAGACCCACACCAGAAACT
CATAACTTGATGTACTTATGTTTGTTTTCATGTTTCAGGGAACCAGAGTGGAATAGGGAT
ATGTTGGGGATGTTATATGATTTGTTTAACTCTTCTCTTTCTTTTTCAGGAGTGTTTCTC
AAGAGTTGTCAGAGACTATCCTGACAATGGTTGCCAATTGCAGTAATGTTATGAATAAGG
CACGACAACCACCACCAGGAGTTATGCCAAAAGGACGTCCCCCTAGTGCAAGCAGCTTAG
ATGCCATTTCTCCTGTACAGGTAGATAAGTCTTGATAACATGTTACCATAAGTTAAAGTA
CTCTTTGCCATCCATATTGATTAAATAAAGTGAATTTTTATAGCAACAAGTAATAAAGTG
AGAGAAATTTTAAATTCTATTAAATTTAATGATTGCATGTTGAACATTTAAAAGTAGATC
TGTATGGAACATAGTTGACCATTGTTTTTAGTCTTTATAACATGATTGCAAAACAGTATG
AGTTTATTTTTTAGATGATTTGGTAAGGATTTTTAAAATTGCTTGTACTCTTGAGGAAAT
AAAGCACTGCCTTTGAACCTGATATGTCTTGTTTGTAGCTTCTCAGGCCAAGCAACAGTG
CTAGACCATATTTGGACTTGTTATAACTGGGGCTCTTCAGGTTCAAACTGAATTGTTCCT
TTAAAAACAAGGTACATTGAAGTTACTCCTTGTCACTAATTGCCCTTCTCCACTGAGAGC
AACATACTCCAATGTTTCTACTCTCTGCTATTCTGGGAAGACTGGAATTTAAGAAATTTT
TTTGAATGAATAACTCTTTAACTATAGTTTCAGAAGGAAGTTGCAGATTATTATCCAACT
TGGAAAATTTTCTTAATCTAAAGTGCCTCTTAGATAATAGTACACACAAAGTCTCCAAAT
TTTTATTTTTTTGGTTGAGATTATTGAGTGACCTTTGTTCAGTTTTTTATAGTTCATTGA
CTACTGCACAATTTACCTTCTGGTTTTTGCTTCAAGGAGCTAATTGAGGGCTAAGAGTTA
AAGTTGTTTTTAAAAATCCCTTGGCATTAAATAAAATGGATAGTTTCATTAAAATAATGA
GTAAAATAGTCTTGACAGTCAGGTTGGTACTCTGAATGCTTTATCTTCTGGTTCTGGAGT
TTTGGCAAATCTCTATAATAAAATGCTACTTTTGAATATTTAGACTTTAATACTTCTAAA
ATGTGTGATTGCTTATTGTATTTCAGGAGATGTTTACAAACAATTTTTTTTTTTAAGAAT
TCCGAACAAGATTGCTTTAATTTGTGCTAATGCCAATTTGTTACCTCTCTTTTTTGATGC
ATCTGGTGATAGTCTTCTGTCTTTTTCAGATTGACCCCCTTGCCGGGATGGCATCTCTTA
GTATAGGAGGTTCAGCTGCCCCCCACACCCAGAGTATGCAGGGTTTTCCTCCAAATTTGG
GTTCTGCTTTCAGTACTCCACAGTCACCAGCTAAAGCCTTTCCACCCCTTTCCACTCCAA
ATCAGACTACAGCTTTCAGTGGTATTGGAGGACTCTCTTCGCAGCTTCCAGGTAAGGAAA
TAATTCTAGAAACCACACGTTTCTTATTGGTGCGCGGTGAGGGGACTAGTCACCTGGAGT
TAATATTGTATGTAGAACTACTAAGTAAACTTGATAGCTCGAAAATACAAGAGGTTCCCT
AACTTGGTAAGCTACAGAAACCTCTGAAAGTCACTTAGTTCAAATTAATCTAATTGGGAG
TTTGTAAAAGTCATGTTATTTGAATAATTTCTCCCTGAATGTTGATTGAAACAAAAATTT
CATGTCAATTTGGAAGGGGATATAATTAGTGTACTACAGAGGATAATCTTTTTATGAATC
CATCGGTTCTGTCAGCTTGTCTATAAGTCTCTTTCCAGTATATACTTTAATGTTGAGTTG
TGTGTGTAGGTGTGTATGCACTTGTATTTTTTGTTTAAGTAGTCTGAGAAGGTAATGAGA
TGAAAAGGATTAAAAAAAAAATACAGTATTTTGAAGTGGGGGTTGGTTATCATATTATTT
TAAGTAGAATAATAAGGATCTTTGAAATGCTTACATATAAATTGACATTGCAAAGGGAAA
TTCCAGGAACATGGGTAGTAAGAACTTGATATAACTTTAAATTTGAGAAAGGTGAATACA
ATTAAGAACACACACACACAAGTTTACTCCTACCATTTACCTTTTCTTTAGTAGGTGGTC
TTGGCACAGGCAGCCTGACTGGTATAGGAACTGCGGCTCTGGGACTCCCTGCAGTGAATA
ATGATCCGTTTGTGCAGAGAAAGCTGGGCACCTCCGGACTGAACCAACCTACATTCCAGC
AGAGTAAGATGAAACCTCGTAAGTGGTAGTGTTGTCTGTGACTGTGAATGTGACTGAACC
GTAGTAAATGTGCACTGGGGAGGTTGGGTCAGTTTTATTGGACCTAGACAGTTGGTAACA
AAAAAAATGTTTAATTGATAGTGCTTCATAGGGAGGACAGGAGTGGTCCTGAGTTCAGTA
GGAATATATCAAGGGCCTAAGTTGCTGAAGTAGACATTTGTTGTATTCTTCTTTTCTAAA
AGTCAACTTTGTAGCCTATGGTCAGTAAATTCAAACACAAGAAGTAAAATGAAATTTTAG
GAATATATGAGAAAAGACTGTTGGATTGTTAGAATTATTTTATCTTTTGTTTTTTTTTTT
TAAGTTTGAGCTCAACTCTCCTGAGCAGCTTAGTGGAGAGTCAGGAAGATCTGAGTTCAG
ATCCTGCCTTAGACAAGGCCTTAACTAGCAGGGTGACCCTGGATAAGTCTTCAAAACCTC
CCCCAGCTTCAGTTTCTTCCATTGGTAAAGTGGTTATCCCCACCCATCTCCAAGGAATGT
GGTGAGGAGAGAAGTGACCTAAGCCATTTAAAGCACATTGCTAATGTTAGCTCTTAGATT
GACTTGCTTGTGGATTTGGCTACAACTTTAGATGAAGAAAGTTTTTAAGATTTAAAAAAA
AAAGGGATACCTAGGTAGTTCAGAGGTGCAGATGGGAGATCCTGAATTCAAATTTGACCT
CAGATGCTTCCTCACTGTATGACCTTGTGCAAGTCACTTAACCCCTCTGTCTTGGAACTG
GTACTTATTTATCCACTCTTCAGAGAGAAAATAAGTTTTTTTTTTTTTTAAAAGCTTATC
ACTTGGTAGTTTGATTTGATAATATGTAATTTTAGTTGAATTTGAGGTGTCCTGCTACAT
TCAGCAGAATACTTTTTCACAACTAACTTTGGTCCTTTCATAAAATTAAATATTAAGTAA
TTAATTAGAATTAAGTAATTCCTTAACACTTGCCTAAAAGGAGATGTGAAATGGTTAGGA
TGATCACCAGCAGTGATTTCATTTGGGAAGTCTGTTTTATGAGCTGGCCACCCTGAGAGG
CTGGTGTGAAAGATGTCTGCATGTCCGTGTTGTGTGGTGTGCCAACTTTTTATCCTGCTC
TGTCTTGCCTTGAAAATAGATGGTTTTAATAGACTGATCTCTGCTTTAAGACATCAAAGG
GAAACTTTCCCATAAATTTGTAGCTTTGGCTTAAGGGTAAGTATCTTATGAGTGTGGACT
TAGTGCCCCAATAAGAGTGTAAAATGTGTTCCTGAAAAAAGTTGGCAGTTTAGGAACTGT
AGCATTTGGAACAGGTATTTTCAGGAGCAATCCTTTTCAGCCCCTCTTGAATAGCCTGTG
GTTTTCTATGGCAGTCCATTTGTTTACAGTAACATCACCATGAAATTCTTCAATTTAATT
ACTCTTTGGTCCATTCTTTCCCCTAAGTTTTAAACTCTGATGTTTCAGGGATGGGCATGG
AGGGTGGAAGGGAGGGAGGGGAAGGAAGAATTAGAAGAACCACATGCCCAGGAGTTGCTT
TTCATTTCCCAACAGCGGACGTATCTCAGGTGTGGCCAGAGGCGAACCAGCACTTTAGTA
AAGAGATCGATGATGAAGCAAACAGCTATTTTCAGCGCATCTATAATCATCCACCACATC
CTACCATGTCTGTTGATGAGGTGAGCACAGACAAACCTGGGAGCCCCTCACTTTTGGTGA
AATGCCACCATTTTACTAGTTCCAGCAATTCCCATTTCATCTTTTTGTTGTCTACTTTAG
GCATTTGGGTTTCTTTTTCTCTGACTGTGTAGCATCTCCTGGCCAGCAAGGGCTACGAGA
AGGGGTTTTCCCTTTGTGGGTTGGACCAAAGAGGAGCAGGGAGTCTGAGAACCCGGGTGA
AGAATGAGAGACACAGACAAGTCAGTATTTAGATAGGGCAGGCATGAACCCCTATGATAT
TCTCCTTGGAAGGAAAATATGAGAGCCAATGGAACACGTGGAAGTGAAAGGAAATAAGCT
AGAGAATGCAAAGCCAAGAGAGGTTAGAGGTCCAAGAGGGGGAAAGGTTCCAAGAGAGAA
AATCACCAGGTTGCCTTCTGTTTTTATTACAGCCTGGCTTGGGAGGTACTCCCAAGCACA
TAAATACATAGAAAAGCATAGGCAATTCAGATTGGATGGCAAGGTAATGGTGACACCTTT
TGGGCGGGTTAGGTGTGTCGACTTCAACCCGAGCTTTTACAAATGAATTCAACTCTGAAC
CAAATGTTAATGAGTCTGCCTTGAGCAAGGGCAGCATGACTAGGTCAAGAGTGTCCGCCA
ACAGATATCAGAGTTCAAACCTTGTGTCTGAAAACACAGTAACTATACAATCATTTATAT
TTCTTAGATGTGAATATGCTTGGGATGCTACAGACTGGCTCAGATTGCATTTAGAAATTC
TGAGAAATTTTTATTGCTACAACACATTGTCCTCCAGTTTTGTTTCTTGGCCCCACTATT
TAATCCTCTTGCAAAAATGGTGTTGAGTGAAGCTCTTAGTAACTATTTTTGTTTTGTTTT
TGCAGGTATTAGAAATGTTACAGAGGTTTAAGGACTCCAATATTAAAAGGGAACGAGAAG
TGTTTAATTGCATGCTGAGGAACTTGTTTGAAGAATATCGGTTTTTCCCCCAGTACCCTG
ATAAAGAGCTGCACATAACAGCCTGCCTATTTGGTGGGATCATAGAAAAAGGACTGGTTA
CCTACATGGCACTTGGCCTGGCCCTGCGCTATGTTCTTGAAGCCTTACGCAAGCCTTATG
AATCCAAAATGTATTTTTTTGGGATCGCTGCACTAGATAGATTTAAAAATAGGTAAGTGT
TCTTGTTTTTTTTTTTTTTGGTTTTGTTTTTGAATATTGTTTTAGATTGTTTTAGAGAAT
CCATAGAACTAATGATTTCCTCCTCAGATGGAAGCATACATCTAGATCAGAAAAGCCAAA
TTTTTCTTGCATGGTGCCATCTGAATATGTACATTTTAGTGCCTGTTGTGACCCAGATTA
GTGTGATGTAAAGATTATAGATGGGCACTAGTTAATTGAGGTTAAATCTTATAAATTTTA
ATAACATTCTAGGCAGTTGGGTTACTGTATTATGATGATGGTGGTGTTGGTAAGAATAAC
ATTGCTGTTGTTTAGCTTGTGTTTTGGGGTAGAACTGAGGGAGTGGACCAGATCATTGTA
TATACTGAAGTCTTCTTTTCCTGTTCCTTGAGTCTTTAGTGAACTGACTTTTTTTTCTCT
TGACAGGTTGAAGGACTATCCCCAGTACTGTCAGCACTTGGCCTCCATTAGTCACTTTAT
GCGGTTTCCTCATCACCTACAGGAGGTAAGTGTGTTTGATGGTCACAAACTGAACACAAC
ATAGGAATGCTTCCATCTGAAGAGTCCTTTTTATCTTGAGTTAGAGTATAAACAGTTTTT
AACCAATGATAATTGATAAATTACTAATAACTTCTTCCTCAGTTTCTATATTTCTGAAAG
ATCAGGCCAATAGTTCAGTTGACATGCACTATTGATCTCTTTAATAGAATTGATCTGTTA
ATAATTTTGTAATCTTTTTTCCAGTTGTGTAAATGTCTTATAATATCTCTTTCCAGGGCT
ATGATATTTATATGTTTTTTAAATAATGCAATTTTATGGTTTGCTAATTAAAAGCATAAA
TTATAAGTGCTTACAGAATTCAGTGATATGTGATCAAATTTGCAAATGGATTGTTCCATG
TTAATATAATACTGCAGTGGAATAGTGAAAGTTTTAGAATGCTAGCAATCTTTAAAATTT
ATTGTCTTTTGTCATTCAGATACACTTATTACTGGTAGTGATCTTACCTATACCTACAAC
TTCAGTTATTGCCTCTATGCACTTGAATTCTTAAGCATATATCATAGGTCTTGATCTCTC
CCAAGCATTAGACAACATTTCTAACTACTTCCTGTCCAAAATTTGTTAACTTGTCTAAAT
TAGTTAATCCTCTTGGACCACTCTCCTACCTGCTTAGGACAATCCCAAACTTGTCCTTTC
TGTTTTCCCCATCAGAATAATAGAATTTGAAAGTAGAAAGAAATCTGTCTCATCCGGTCC
AGCTAGCACAGGATCACTTGATAAAGGTCCATCCAGCTTCTGCTAAAAGTCTTCAGTGAA
GGGGAGCCCTATGGCTCTTGAAGCAACCCATTCATTCCTTGTGGGCAGGTTTTCCCTATC
ATTACACCAAAATTCATCTCTGCAACTTCACATTCTTCCTGTTTTTTGTCCTTTGGAGAT
AGCCCTACAACTACTTGAAACTAGCCATCCACTTTCACACACACTAGCTTGGCTCCTCAT
CCCATTCCCATCTTTTCCCACTGGACTCCTTTTCTCTAGGCTAAACATCCCCCAGCACCT
GAGTGATATAGATTCAGGGACTTTTGACTATTCAAGTCACCCTTCTGGCCATTTTTTTTT
TATACAAACCCTTAGATTCTCTTTATTCACTGGTCCATTTTTCTACAACAAATACATCTG
AAATCATCTATAATAAAATTATTTACAACAGTGCCTTTTAGACAGATAAGATGTGCCACA
TTATACAGGACCAAGCTTGGAAGTCAGGAAGACCTGGGTTCAGATGCAGCCTCATATACT
TACTAGCTTCCTCAGTTTCCTCAAGTGTAAAGTGAGGATAATAAGGACACCTACCTCCTA
AGGCTGTTGTGAGGATTTGATGACATAACATTTGTAAAGCACTTAGCTTTCCCATTGTTT
TGGCACTTTATAGATAGTATTATACACCCCCCACCCCCACCCCCTACCCCCAATTATAAT
ACACAGAACTGAAAACCGATACTTCAGATCTGACCTGGGTCGAGTACAAAGGGAACCATC
ACCTTCTTCTCAATCCAGCCCAAGCTTCCATTATATTTTTTAACTGCCAGATCACACTGT
TGTCTCCTTGAAGTCTATTAAAGTCACTCAATTTTTTGTTTTGAAAAATTTTTTTAACAT
GTACTGTAAATTAACCCCTAACCCTGAATTTGTGCTTTCTCTCCATTGTTTTCCCTGAAA
TAATATGAGATCTCTTCATGAGATGTTTTACTACCTACAGAATTTTCCTTAATTAACTGG
TTTAGTGAAATGTCCAAAAAAGAACTAAGGAGCTAATGATGTTGTGATTTACTCTCCAGA
AAGCCCACTCCTCCTCCTTTGCAATTCTTAGTAACTTTTCCATATGTTCACTAAGCATCT
CTTTAATGATTTATTATAGAATTCTCCTAGGACTCGCCAGCCTATCTGTGCAGATTTTGT
CATTGTCTCCTATCTGTGGCCCTTGTCTGTCATAATACTGACAAAACAATCACATACAGA
TCTTTTACTACTACTCAAGGATGTAGTTTTATCTGGACCAGGTGACTTGAATTTACCAAG
GGCTGCTAAGTGATATTTTAACACCTTCTTTTAACCTATTTTGGTTACCAACCTCTTTTT
TTAGTTATTTTTGTTCTGAAATGTCCATTGTAATGGTAATTCTCCTTGGCAGAGAAAACA
AAAACAAAATAAAGATTGAGCAAATCTGCCCTTTTTTTCCTCTTGTTTGTATGACTAATA
CACCTTAAGCATTTGTCCTTCAGCTTCTAATATAGATTTTAAAAATCCAAAAAATTTTTT
AAAAATGTTATTTTTGGCTTTTTTCTCCAGTTTTGGCTCATTCTTAGCTTCAGCTCTCCT
AATAGTTTTTTATGGTCATGCCAAACTTTTATTCATTCTCTCCTACCTGCCTTAACTTAT
CTTGTCTACTTATCTCTTTAAAAAATTGAAGTTACTTAGATAGTTCCCTTTGTATTTCAA
TAATTCTCTTGGGAAAACACTTTTCTTGAATTCTGTTGTATTTCTTTTTCTCCTTTTAAA
TTCAGCAAGATAGTGAAATAATTCCCAGGTTCTTATTTATTTTCTCCTTATGATTCTTGA
TTATATTAGAGGGTTTTTTTTAAACCCTTACCTTAGCCTTAGAATCAATACTATGTATTG
GTTCCAGGGCAGAAGAGTGTGAGGGCTAGGCAATGGGGGTTAAGTGACTTGCCCAGGGTC
ACACAGCTAGTAAGTGTCTGAGGCCAGATTTGAACCCTAAGACCTCCCATCTCTAGGCCT
GGTTCTCATTCAATGGAGCCACCCAGCTGCCTCAATATTAGAGTTTTGAGGGAACACTTG
TGGCCTTGCCTTCAATAGGCTTTAAACACTTCATCCTTTGTTTATTTTATAATTGCTTAT
TTATATTTGCCTTTTTATGCTATTCTTGAATATAGTGTTTGCATTTTAGTTTTTGTTCAA
CTCTGGTCTTTATGAGAAATTCATTGAAGTTGTCCCTTTCATTAAAGGTCTGATATATTC
CGTCCCACTCTCCTCTCCCTAAATCATATTCAGTTTTGCTGAGTAAGTTAGTTTTGGTTG
TGATCTTATAACTTTTGCCTCTGGAATGTCATTTTCCAAATTCTCTCTGTTCCTTTTTAT
GCTTGTTACTTTGTTTTAGTTAGGTAATCTCAACTCTGATTCCTTGGTATTTGAATTTTT
CTTTCTGGTTGTTTGCAATATTTTTTCTTTGTCCTAGAAGCTCTCGATTTTGGCTGTTTT
TCCTGAAGGTTTTCATTTTGGGGTTTCAGGTGATGCCCAGTGAATTTTTTCTTCTTTTCC
CTTTCGTTCTGTGAGAGTTTGTTGACTAATCAGACAGTATGGAAAATATTCTCTACCTAT
AATCTTCCCACTTCCAGCCCAGTTGCTTTGGGCTGTGTGTGGTGGGATTATTGGTGATTC
ATTTTTTTCTTTTTTTGATCTCTATTATCATGGTTGCTCATTATAATTAATCTTGTTTTG
TTTGGGCATCAGTTTTTGATGATGATCAATTTTTGAGAATTTTACAGAGATTTTAATGAG
TAAGCATTTTGATCAAGTTGCCACTTGACTAAATGTTCTAATACTGACCTCGTTTTCATT
AGTAAAAAAAGAGTCAGAGAGTGATTCCATACATGTTTTTACTGTATTAGTATCAGGATT
TAAGGTGGTAAGAAAAGCACCACAGAGAAAACCCTTTCAGTCCTCTTACCTAGCTCCATT
GCAGTTAATCTCTAGAAAGAGTAATTATGATGCCAAGGTAGAATCATTATCTGAAGGAGT
ACAGATGACGACCCAAGAAGTAAAAGAAGTCAGTTCAACAAATATTTATTTAGTGCTGAC
TGTGCCTAGCTGCTAAGTGCTAGTGATTCAAAGAAAAACAAAGACAATACCTACCTTCAA
GGAGCTCGTGGTCTAATCAGGGGAGATAACAGGAAAAAACAGCTATGTACAAGCAGTGTA
TATATAGGGCAAACTGGAAATCATCTCAGAGAGAAGGAACTAGCATTGAGACGTACTGAC
AAAAGCTGGAGTTAGTGGGATTTTAGCTTAGACTTGAAGGAAAATGGGGAAGTCAGCAGG
CAGAGGGAAAGGATTCTAGGAGTGGAGGATGGCCAGTGAGTCAGGAGTTGGACTGTCTTG
TGTGAGGAACAGCTTGGGAAGACCAGTGTCACTAGATCCCTGAGAACATGGAGGAGTGTG
AAAATTAATATTAATGTACAATAATTTAAAATACTATATTTTAAGAGATGTATTAATGAT
CATTAAAAATAAAGGAATAAAAAGGTGACAAAATAAAAAACCACATGTCCATGGCTACTC
GTACCTGTTCAAAAACCCTGTTTGCCACCTCAGTTGCAACCCAGGAAGCAAAAAGAGACT
GAGACCAGGAACTCCACCCAATATATCCCCTTGTCTACATCAGTATATAATGACAGGAAG
TCAGTGGGCTCCTGGGAAATGCAATTTTTGGGTAACAGATTTCCAGTTACACAGGAGTAA
GGTGTATAGAGGCTGGAAAGACAGAGTCACACCATATTATCAAGGGCTTTAAATTCCAGA
GAGCATTTTGTTTTTCATTCTGTTGGTGATAGTGTCACTGGACATGTGGTAGGGAAGGGG
TGACAAGATCAGATGGAGGATGGATTGGAATAGGGAGAAATGAGGTAGGCAGAACCTTCC
CAGCAGGTTAGGAGAAGAGTCTTCACTAGCGTGGTGGCAGTGCCAGATGACAGAAGGAGG
GAGTGTATTGGGAAGATATTGAAAAATGAAACTTAATAAGTCTTTATCCTTTTCCTTTCT
CATGTCCTCCAACCTAATGAATTTGTCTTGGCTTTTTTTTTCCTTTTTAAAGTACATTGA
ATATGGACAGCAATCTAGAGACCCTCCTGTGAAAATGCAGGGTTCCATCACCACCCCTGG
AAGTATTGCACTTGCCCAGGCCCAGGCCCAGGCCCAGGTTCCAGCAAAAGCTCCTCTTGC
TGGTCAAGTCAGCACTATCGTGACCACTTCAACAACTACCACTGTGGCCAAAACCATCAC
AATCACCAGGCCCACCGGTGTTAGCTTCAAGAAGGATGTGCCAGTAAGTGAATGCTTCCT
TTTTTTAAGCTCTGAAATAGTTAAGAAAAGGAATTGTAACGTGAACATTTGGCGGTAACT
TTTGTGTATTTTGCTTCATTTCACTTGTAGCCGTCTATTAATACTACAAATATTGATACA
TTGCTGGTGGCCACGGACCAAACTGAGAGAATTGTGGAGCCTCCAGAAAATGTCCAGGAA
AAAATTGCTTTCATCTTCAACAACCTTTCTCAGTCAAACATGACCCAGAAGGTGAGTATG
CCCTAATTCTTTGTCCATAGTGAATGTGAATTTTCCCTTAATAACTTTAATGAACTCTTG
GGGGCAGATTGTGTTATTGCTTTCAGTTTCTGGTTCTGATGTCCTATATTATGAATTTGT
TTTTCCAGGCCATTTAGTTAATTGTCTAAGAGATATGTATCTAAATTTTGAATAATAGAA
TCATTTTCAGAGGACCTCTAGTCTTATTTTATATGGGATGAATTTCAGGCACACAGGAGA
AGTTTTACATAAGGTCACAGAAATAGGAAGAAGCAGAACCATGTTTTGAATCATATCCTG
ATTCCTTTGTTTTCTGTCCTGTCATTGTAAGGTTTTGCTGACTTATATTTTCACAAAATA
TCTGTCATGGTCTACTGAAATGTTTTTACTTTTTATAAAATCCACTTTTCACCCAAAGAT
GTCAAATTGTACTTTATCTTAATGAGATACAGTTATTGAATAACAACACATTCTCATTTC
AAGTAAAATACATAAATATTTTCCACTTGGTTTATATTTTATAATTGACATTACTGGTAT
GTACTTTAAAAGCAGAGAGATCGTTTCATGTTTAGGACATAATATTACTATGTCAGTGTA
CAAATAGGTATTTCAGTGGGGGGGGGATTCTAGACAGTGGATCTTAAGTTTTGATTTCAG
GTATAGAGAGTTCTCTGAACATCCCTAGTTACTATCACATTTTTCTCAGTGATTACTTGC
TTTCCACTCTTTATATATAGGATGACCCGGAAGTCTTAGTGTAGTTTTAAGCTGCTAAAG
CTTGTGGGTTTTTTAAATATAACCAATTATTTGTGTTTCATTAGAATATGAGCCCCTTCA
GTACATCATCAGTAAATTTAGTGTCTGCTCTGGTCTAGGCCCAGTGCCAAACACTCAAGG
GGAATAAATGCAACTAATAAGCAAAGACAGTCCTTACCCTCAAGGAGCTTACAATCTAAT
GGAAAAAGATGAAATGGAGAGGGGAAAAGCATCTAAGGGATGAGGTTGGAGTTCACAGAG
AAATCCCAAAATGGTTTAGCTGGGTGGGAAAAGGAGAACAGGAAGTAGTTTAGTCTATAA
CTGGATCACCTGCTCTCACAGCAGTCCCTGGCACACACACAGTGAGTCTTGTTGACTTCT
TACCCCCAGTTTCTGATGCATTTAGCTTTACAGTTGAATTCTTTTTTGTATCGTGTGTTT
TTTGTAAACACAGTAATAGCATTTAATATGAAACAGTGGCGGCATTTTTCTTTCAGAAAA
TGGCTTCACAATTACTTGAAAGTGACCATTGAGTTTTTTTCTTATCAATTCCTTTGGCCC
AGGTTGAGGAGCTGAAGGAAACGGTGAAAGAGGAGTTTATGCCTTGGGTTTCACAATATC
TTGTCATGAAGAGAGTCAGTATTGAGCCGAACTTTCACAGCCTGTATTCAAATTTCCTTG
ATACTCTGAAGAATCCTGAATTTAATAAGATGGTTCTGAATGAGACCTACAGAAATATCA
AAGTGAGTGGTCAGTCTTTCATAGTGTTTCTGTTTGTTTTATTTATGCCTCTTCTTATAA
GCCTGTTTTAAATCAGAAAATATACTTTTTAATATAGTTTGTGCCCTAAGAGAGTAAATT
ATTCCCTCTTCCTAGTTAAAATAGATTAAAAATAATAATTATTATTTAATTTCTTAGAAG
CCTTCTTGTATTTTTCCCTACTAGGCCAGTGATCTTGCAACACATAGCATATCATATCAT
ATGAATATTTCTTTAGCATATTTTAACTATTCTGGGTTATTCAATAATATTCTTGGGTAC
TTTTTATATCACAAAATGTACCATTTGCTCTTTTGAGTTAGGTGTGAGATTTTAAAATTG
GTCACCTTTGGTTAATTACTTAGAGTGAGATCCATTTTTGATGAATCTGTCTATACTTTC
ACTCTTAAAATTGAAGTTTTAGAAAATTAACCAGTGGTTTTCTTTTCCCTTCTCTGAAAA
CCAATCCTGCTTCTTAAAAAAAAATCTTTTTAATTTGTTTTTAAAGATTAGTTTATTTAG
TTATGATTTTAATATGTCAATCATAACAGTGGCTAGATTGAGGTAACCCATTCTTTAGTT
TACCTACCTTTGAACCTTTCTTGATTTAACTCTTTGTTTAAAATGAATTCCATCCCTTTT
GACCTAGTGCTTGCTTATTATGCTATTTAGTAATTGATTTTAAGTAGATACAATATAGTT
CTATAGGTTAAATATCCTAATATAAACTCTTACTACTTTTAGCTAAAGTTCAAGTAATTA
TTATGTACATGCCTATCTTCTAAATACATGTAATTAGGGTATTTTCCTATAGAGTATACC
TTGTATCTTAGGCATATTGAATAACTGAGTCAGGGGAAATGATTACAAATTTTCTAGATG
CAGTGAGTCCTGTATTAGCCTTTTTTAAGGTAATAAGTACTTCACTGATTGTTAGTCAGG
TTTTTTAGTACAGGGTTAGAGTCACAAACTGTAAGTAGCTTCTTCCCAGTCTTACCTATC
TTCTTGTCAAATCTTTCTCATTTATGTATAGCCACTTCATTTTATATGGTGCTGTCATAG
ATTCTGAGTTCTTTTATTTTCAAGAAGTTGTCAGTGTCACAGTTGAAACTACTGCACAGG
TGTATTTCCATCAAGGAGATCCTAAGTTCTTCACTTGTCACCTTGTCTAAAATCAGTCAC
ATGCGAAGTTCTTGTTTAAAAAAACAACATGGGAGTGTGGGAAAGGTATTAGCTTGTCTC
AGCATTGCTCATTAAACAGGTCTCTTTATTTTCTTCATTTCTTCTATGAGATACTAGGGA
GCACTTTTTGGAAAGCACCAAATAAACTGCCCATATTAAGGCACTATTTTTTAAACCTAT
TGATGGAAATTTTTACCACATTAGGTTACGCTGTAGTGCCAAAGAATCCCTTAGCTCCTG
TCCTTGCATAGCTGACGGTCCATTCGGCTCGTGCTTTGGTGGTTGTGTTAAGGTACATAA
CTGTTGTGGGCAGCTTTTAGAGCAGTTGTGATTGGTTCCAGTGAATACCCAGATGAAGAA
CAATCTAGAGAAGTCTGAAACCAGAAACTTTGGTATCACAACAGCAAATGAAACACAAAC
TGAAAGGGTGGGGAAAGGATAGTCGCAGGGTAAACAGTTATACTTTGTTTTGTACACTTC
TCATTTTTGAAGGAGGTGGTTCTCTTTGGAATAGTTGAATGTCCTGTATAACTTCAGTGA
CATTCTACTTACATTTTTCTTCATTCTCAGGCCCCCCACTCCTGGATGTTTTGTTGGCAC
TGCTCTTAAGTTTAGGAGAGTTGGCTTTGGGTTTTCAAGATGGGTATATGATTTATATAT
AAAGGGTGATACTATAAGTAACATTTGGAGAACATAGAATAGTTACTTGGCAGATCTATG
GAGCAAGGAAGAATTTATGACTAAACAGATAAAGAACATTATAAAGTGTGAAATGGATAA
TTTTGACTATATTTAGTTAAAAGTTGTAGTTTTTTTTTAAACCAACAGTCAGTATAAACA
AGATTAGAAGGGAAACAACAAATTGCTATTGTGCTATAAAAAATGTTGAGTAGGATTTCA
GAAAAAGCTAGAAAGATTCACATGAACTGTGATTGCACAGTGAAATGTGCAAAACCAGGT
GAATATTGTACAATGGTCAACTGTGAAAGGCTTAGCTATTCTTAGCAATACAGTGAACCA
GGAGAATTCTGAGGGATTTATGATAAAGAATGCTATATCTACCTTTAGAGGAAGAATTGT
TGGAGTCAGTATGCAGAAGCATATTTTTCACTTTGGCTTATGTTTTGGGGCTTTGGTTTT
ATATGAGTAATCTCTTACAACAATGAACAATATGGAAGTTTTAAAAAAGAAAGAAAAAGA
AGGGCCTATGTTAGTGATGCTATATAAAAATACTGGGTAGTAGAAAACTTGATTTGGGAA
GTATGTTGTCTACTCTAGTTATTTCATTTATAACCTAAAAAAACTGAGGATAAAGAAGTA
GTTATTTTCCTTATTCCTTGTCCATGTCTCATCTTCAAGCCTGTTTCCATTCTAAAAACA
CGTTTTTTAGGTACTTCTGACATCAGATAAAGCTGCAGCCAACTTCTCAGACCGCTCCTT
GTTGAAGAACCTGGGCCACTGGCTGGGGATGATCACACTAGCCAAAAACAAACCCATCTT
GCACACAGTGAGTTTCCATTAAAAACAGTGTGTATATAGCATTTACTATTTTTCTACCTT
TTATGTAGAGGCTTCATACTAGGAATCTAGCCTCATCTGTGGCATTCTCTGAGTATGGAA
CTCTAGGAGAGTTTTTTTGCCTTCCTAACCTGAAGCCTGAGCTATCTCATTCCATGTGAA
GGTCGAATTGACCTTTATGATTTCTAAATATCCTTAAATATTATGTGACTTTAGTGAAGG
CTTGGCTGCTGTTAATGACTTTATTCTAAATTATAGTTTATTGGTGGATTTCTAGGACAA
TTAAACACTTGGAATCTCTGCTCCATTACTCCTTGATTGTCCACATTATTGTAGGCAAGA
CATGTGATGTAGTTTTATTCTATGGTATGTTGCTTCTGTAAAGAAACCTGGTAGGGTGAA
ATAAATGTGGAAAACAGTTCATCCCGTGTTCTTTTCTGTAGTTTCCTATTAATGTCTTTC
ACCCATGTGTGTTTTATGCATACTTAAGTGACCTAAGTAGAAATTATCAAATATAGAGAC
ACATATTGTATATTAATGTTTATCTTTTAATTAATATTTTGCACATATACTTAACATCTA
TCGTATAGACAAATATTTTCATGTTTGTTTCAGGACTTAGATGTAAAATCTTTGCTGTTG
GAAGCTTATGTTAAAGGACAGCAGGAATTGTTGTATGTGGTGCCCTTTGTTGCCAAAGTC
TTAGAATCCAGTGTTCGGAGTGTGGTAAGAAAAACTTCATATTTTTAAATGGGACACTGA
GGATCATAATCATTGTCCCTTGTAACTTTTAAGTACAACTGACATCGGAATTGATTTCCT
TTCTGTGCAGAGGCATAAAAATACTATTTTAAAGCCTTTTTATTATCTCAGTAAACCAGA
AATAACACTAGACCTAATAATCATGATTGATGGTATACATGTCCTATTCTATATCTGGCA
TAAGCTGTGTGACTTTAGACAAAAAACTTTTGATCTGGCTGTCAGTCTTTCCTCACCATG
TAATTGGGACTCAGACTTAAGCAATGGTAAAGTTTCCCTATCCTTTTTTATGCATGTAGA
TTTTGCACATAATTATGTCTTTAATGATGCCCATACTGTATATAACTGCATAGATATTGT
AAAATATTCAATTTTGTCAATTTATTGCTTTTTTCTTTAGGTTTTTAGGCCACCAAATCC
TTGGACAATGGCCATTATGAATGTACTAGCTGAACTTCACCAAGAACATGATTTAAAGGT
AAATGTATTTATTTTTATTGTTTTATTATAAATTATTGTTCTTTTGGTACAAAACACAAG
AAACTGATGCTTTTGTGTAATTTAAATGTAATGGAGAATAAAACCCAGTGTTTTGTGATA
TAGTAGCTCTCATATTTTGGTCATATCCCTGTCCTTTTCAAGGCAGTATGCAAGCTGAGT
GGGATGAGAGACAAATTAATGGGTAGAGTGAGTGAAGCTGGGATTTAGTCATTTGAAATC
TAATTAAATTGTAATGATGCAGTTAAACTTGAAGTTTGAGATTGAGGTGCTCTGCAAGAA
TCTTTCTCTGGACATCAATGAGTTAAAACCTGGAAGCCTCCTGAAAGACAAAGACAGACT
GAAAAACTTAGAAGAGCAGCTCTCTGCCCCCAAAAAGGACATCAAACAACCAGAGGCACT
TCCTCCCATCACAACCACCAGTGAGTACAATAAGGAAAAGCAGATTTTCCTTGCCTTTCA
CAACCCTTTGACTATATTATTTATGTGAAACGCAGTAATGCACGATATTCAGGATATTTT
ATAATCTTGAAGCACCTTCCAAATCTTCATGGAAGGATTCAATTTTGCAGATTTTGTAAA
TTTTATTTGTGTTTTTTTTTCATCAAAAGTTGAAAACATTTATGTGTTTATGCGTGTACC
TAAAATTCCTGACTAACTAGAAAGTCCAATACTATTCAATGTTGAACAAGAGTTGACCAT
AAAAGTTTAGAAATCATGAGTGGATATGTGTTATTCCTCAGATAGTCTTGGACTCCTACT
TTATTCTATAGTGAACAAAAGGGGTTTATTTCTGAATTAGGATGATCTTGGTGGCCAAAG
CAGCTTAAGTGTTACCTGGAAACTAATATTATTAATCCCCATGTAGCTTGAAGCTCTTTA
GCCCTATGTCCTTGTCAGGGCTTCACCATGTGGCATTGACATTGCCCAATATAACTTCAG
GGATTTGAACTTTTCTGGTGAACTTATTAGTGTAATTCCTTAGGGGTATCTAGATCTGGG
GACCTGTTCACGTGTAAGAGGCAAAATTCCTGAGAATGGGTCTGTGCTCTGGGCTTTTTT
CCAAATTAGTAATCCAGGTAATTACTATATTCTGAATAAAGTTAAAATTCAGAACTACTC
AATAACTTCTGTGAAACATTTATCTATTTTCTAAGCATTAATTTTAGTCTTTATCCCCCT
TTTTTTTATCAAGCTACTTCTACCACACCAGCTACCAGCACCACTTGTACAGCTACTGTT
CCTCCACAGCCTCAATACAGTTACCATGACATCAATGTCTATTCGTTGGGAGGTCTGGCA
CCACACATTACTTTGAACCCCACGGTAAGTTACCAGCATTACCCTTCTCTGCATTTTAAA
AGGTGTTTCTTCCCTTTCTCCTTTCCGCATGCATCTTTCCATCCTCTTGGTGGTTGTCTT
TTCTACCCCCCCCTCTCCCCCCCCCCCCAGACAGACAGACAGACAGACACAGACACACAC
ACAGTCTTTGGAAGCATACAGTGTTGGTTCTCTACTCTTCTCTATATCCTTCTCTTTTAT
CCTTTCCTCCCTGAACTCTTACTGTTGTTACTATTTTCTACTGATAGGGCTCCGAAACTA
TAATTATGTAGAGGGACGCCCTTAGGTTTTGATAATTCATTGTAGGAAGCTAGGGATTTA
TTTGTTTTTAAAATTATTTTTAGATAGGCAGATTGTTTTGTTTCCCTTGTATCCTACCTC
CTTTTTCCTTTTAGGGTCATAAGTACTGAGGACAATTTAATTTAGCTGCCCTTTTCAGGC
CTAACCTGGTCCCATACATTTTGGGGGAGTGAGGGAGAAAGATATAAAACTTATGGATGG
GAAAGGGAGATGGGGAAATAAAGGAAATGGAATGTAGGAGGAGACCAGCTCGGTGATTGT
CAGAATGCCAGATCATTGGCATTCATTCAGGAAAAGTGTGCTTCAACTCCACTAAAGAGG
AGACTAAGGGACAGCATTGAAGAGGCAAGCTGGTTTGGGCAGAAAACTGGTGGGGTGACT
CACCAGTGTGAATAGTTGGATGTTGTCTGACTCTTCAACTAAGGAGTTTGAGAGGAACCA
GCAGTTGTGTGACCTTCAGTGACTGGCAATTTCACATAATATAGCTTACCTTAGGGGAAT
TAAATTGAGAGCCATGATAATTTTTTTTTAATGGGACTTTTTTCAAGAGATATCTTAAAC
TTTATGTTAGCTTAAATGCTATTTTCTTTTCCTTTTTTCCCTTAACTTGTAATTGCTATA
ATATAGAATATTCAGAATATTTTAAAAAATAGCCATTATAATTAAAACATTATAAATTAA
GATAATTTAAGACAAAATCTGTTTTGTATATTTGGGTAACTAGCTTTTCAGAAAATCTGG
TTTCTATCTACTCTCCATTTCCTTTTCTGTATTCTCCCAGAAGTGTTTTAGCTCTTGTTG
TAGCCCATCAGCTTACTGCAGTCTCATCAGCTAAAAGAATTGGAAATCATTCTGTGCCCT
TGTCCTGCTTTTGAGGCACAGATTCTTTTACATTTCTATACTTAAAAATTTAACAATTAA
TTAACATGGATTGTGGCATTTTAAATGCTTTTTGCAAGGGTGAGCCCCAGGATGAATTAA
ATTATTACTTAATGTTGGTTCTCAGGTTCTCCTCTCCCACTTGGCTCGTCTTGGCAAGCC
AAATCAGAAGGTCTTCTGAGCCTGGTCTTAAGTCTCTACCTCTTCTGGCAGATACCTGGA
ACTGAGCTTATCTTTGTATATATTCACCTTAAAATTTTCATCCTCATTTTGAGGTAGGGG
TTAGTGATTTCAGCTTCTAGCTGGAATCCTAAATGTAAAGTTTGTTTGGTAGGCAATCTG
TAGACTAGGACAGTCACCCGAGCTTCCCCGTCATGTTCTATTCACCCCTCTCCCCGTGAG
CATGTACATGCGCACACATACACATACAACTGCTTTATAGATAGTGCCATGCTATGGTAT
AAAAAGCTCTTATTTTTCTGATTACAATATATAGAGTTTTCCTAATCATCATAGGGAAAG
AAAAAATGTTCCCAATGAAAGGAGCAATCTGGAAATTTTACTGGGGTGTACTTAGGGTTG
TGCATAGAACTTTAGAGCTGGAGGGTTCCTTTGAGATCAGCTAGTTTAAACTCATTTTAC
AGAGTTGGAAATAACTCAAGAAAGGTTAAGAACTTCTAACATCACAGAGCTAGGTAATAG
AGCAGGACAAGACAGAGCTCATGTCACCTGACTTTTAAAGCAGTGCTCTTGACTGTCTTA
GTAGGTTGAATTCTTCTACATCATTTCCAGAAGTGGGTGTTTGTGTTTGTTGCAATACCA
AATTGAAAATGGCTTTCATTAGCAAGCAAAAAATTAATAAGGGGGCCAAATTTCAATTTA
TCATGGTATGAGAATGAGCTTTCAGGTAATGATGCAAAAGGCCTAAAATAAGAAACTTTG
GTACATGTCCAGGGTTACACAGCTAGGAAGTATCCAAGGCCAGATTTGGTTCATGGTACA
TTTGCACTCTTAAAAGGATTATTGAAAGGTTAATGAAGTATTAAGGTCCCAAAGGGACAA
TTGTTTTTTAGAGAAAAAAGCATCCTACTTGACAAGACACAAATTACAATAAAATCAAAA
TGTAGAAACTTTTGCTTTATGTCAATTCAAATTTTCCTCATTAGAAATTGGAATTTAGTT
TTAACGAAGACTTTAACTATGGCAAACTAAGGGAGAACTGTGTGTTTGTTACTAACATCT
AGAGTATTTTCTAATGGCTAGTTTGAGGTAGAAATATACCAGTTATTTTAGTTACTAGTA
TTTTCAATTGCTATTTGTTAGTTTGAGAATTTTAACTTTGAAAACAATTCAAAAAGTATG
AGTCACAGTTACTTGTAATTATTTGGTTTTAATAGGTTACCTAGCATTTGATTTGGTGTT
TCTTCGTTCCAGATTCCATTGTTTCAGGCCCATCCACAATTGAAACAATGTGTACGTCAA
GCTATCGAACGTGCTGTCCAAGAACTTGTTCACCCAGTGGTGGATCGGTCAATTAAGATC
GCCATGACAACTTGTGAGCAGATTGTCAGAAAAGACTTTGCATTGGACTCAGAGGAGTCA
CGCATGCGGATAGCAGCTCATCACATGATGAGGAATCTTACGGCTGGCATGGCTATGATA
ACTTGCAGGGAGCCTTTACTCATGAGCATAGCTACCAACTTGAAAAATAGCTTCGCCACA
GCACTACGAGTAAGTGCAGAAATTATACCACATGCACTAATGATGAGTGGTCTTAATATT
TTGGAGAGAGAAGTAAGATTTTTCTCTACATTGAGATTCATTTTCTTTTTTCTTTTCTTT
AAGTTTTGTTTAACCTTTGGCTATGTACAGTGACAGTAATGAGAATCCATCTTTATTTTT
AAAAATTCCTATTACCTTCTGTCTTAGAATGAATACCATGTATTGGTTCTAAGGTAGAAG
TGGTAAGGGATAGGCAATGGTTAAGTGAATTTCTCAGGGTCACACAGCTAGGACCTATCC
ATGGCTTGATTTGAACCCTGAACCTTTGGTCTTTAGGCCTAGCTCTATTCAGTGAGCTAA
ACCTAGTTGCACCTCTTTCTTACATTTTGAGGACTGGTTTGGAGGGTAGGAGAAGTGGTC
TTTTTCTGTGCCTCAATGACTTATTTTTAATGATTATTTTTATTCAACTCATAACTTTAA
ATTATTGACAATTTTGACTTTGATGCTAGCTTGTTTCGTGGAAGTTTCTTTTTGTTGTTT
AAAAGATTGCTTAATTGACATTGAAGAATTTTTTGAGTTTTCAGTCATTTTCTTTCTATC
GTATGAAACATCTGTTTTTTATATAAATAATATAGATGCTTTGGCTCACTCAAGCAATTT
TCTTTCTCAGTGGGAAAATGCTGAGGAAGAAGCCGTGACATCTTGTTCTTTTTTTAATAG
GCTGCATCCCCCCAGCAGAGGGAAATGATGGAGCAGGCAGCAGCCCAGCTAGCCCAGGAC
AACTGTGAATTGGCCTGCTGCTTTATTCAGAAGACTGCGGTAGAAAAAGCAGGTCCAGAG
ATGGACAAGAGGCTAGCAACTGTAAGTGCTTTGACAGCTGCCTTTTTAAGAGCTTTCTGT
GAAGTAATACTTTCTAGCAGGAACCTTCTAACAAAACTTAACTAGTGAAATTTTTGTCTG
TAGGAATTTGAACTTCGAAAGCACGCAAGGCAGGAGGGGCGCAGGTACTGTGATCCCGTT
GTTTTGACGTACCAAGCGGAGCGGATGCCAGAGCAGATCAGACTGAAGGTCAGCATCCTA
GCCACATCTCTCTCCCTCTGCATGCTTTTCATATCCAAGTAGAATGGTAATGTGGAATGG
TTGAGGGAAGTTAAACTGTTCCTAAAATAGTTATTACTTTGAATCTTCTGCTATTCCCAG
ATTATTTGTAAAGGAGATTGGAAGAATATTGAAGTATTTAAGTCATACCTTTTTGGCATT
TATCTGCTTGTTTATTCCTATTTTTTCTTCCTCTAATCATGTCTTTTAGTATTCATATGT
TTTTAATGTTAATTTTAATGCTAGTCCTGATAGGAAGGTGAGAATTTAGTCATTTAAAAA
AAACCTGCTTTCACCACAGTATTCCCAATAAAGACTGTTTTCTTTGGGATAGTTTAGGTT
TATTCATTAAATTTGTAGATAGGTGACCCAGATTAATGTGTCTTAGGTATGGAATCTTTA
CTTTTTTAAGTGGTAACTTTTTGGGATTTTGCTTTTGTAATTTTCCTAGCTGAGAATACT
TTCTATCCTGTGAAGCTCTCATTCTCATTGTCATTATTTTTTTCTCCAAAGGTTGGTGGT
GTAGACCCAAAACAGCTGGCTGTTTATGAAGAGTTTGCACGCAATGTTCCTGGCTTCTTG
CCCACCAATGATTTAACTCAACCTACAGGATTTTTAGCTCAGCCTATGAAGGCAAGTTAT
TGACTTTACTTGAATCTTGAACCTTTAATCATTATGAATATGAATGTGTTCCATTAGCTA
GTTCATAAATTACTTGGGTTCTGGTACCTTAATTTTGATTGAGGGAAAAAAATGTTCTAT
CACTTTTTTTTTTAACCCTTTCTTTCTACCTTAAAATCAACACTGTGTATTGGTTCTAAG
GCAGAAGAATGGTAAGGGCTAGGCAATGGGAGTTAAGTGACTTGCCCAGGGTCACACAGC
TAGGAGAAGTGTCTGAGTCCACTTTTGAACCTAGGACTTCCCATCTCCAGGCCTGGCTCT
CAATCCACTGAGCTACCTCGCTGCCCCCAACTTTGTTGTTGATCAGCCATTTTTTAGTCC
TGTCCAAACTCTTTGTGACCCTATTTGGAATTTTCTTGCAAAGATAACTGGAGTGGTTTG
CCATTTTTTTTTCCTAGCTTGAAAAAAAAGAGGCAAACAGGGTTAAGTGACTTGTCCAAG
ATCACACAACTGAGGCTTCATTTGAACTTAAGCCTTTCTGACTCCAGCTCTATCCACTAA
ACTGCCTTTCTGCCTTTTCCATCGCTAGTCCAGTCATATGGATTTTCCTTGATTTGGATT
TAGATAAAGAAATTCATGTTTCTAATCTGAGGATGCATCATTGGACTTGAAGTCATAATT
CATGCTTTCAAGTTTTAGCTCTCAATTCTTGTCCAGCTCTGTGAACTTTGCCCTAATAAG
ATGATTTCTATGTTCTGTGGTCTTTTCTATCTGTAGAATGGGAACATTGGATGGTACTAA
TCCCATAATTGTCTCTTTTTTTGTGAGGAAAGTACTTTATAAATATGAACTGCTATTATT
TCTGACCATAAAACAATTCTATTTCTTTCTAATTAGTAATTATCATGTAAAGCCACCTTT
TACAAAAGATGGCAGGGCAACAGACTTGTGTTCTATGACAGTGGATTTCAAGCATTGTCA
TTCACAAAGGTTTCCTCTCTTGAAACAGCAAGCGTGGGCTACTGATGATGTAGCACAGAT
CTATGAAAAGTGTATCACAGAACTGGAGCAGCACCTGCATGCTATCCCTCCAGCCTTGGC
CATGAACCCCCAGTCTCAGGCTCTTCGGAGCCTTCTGGATGCTGTCGTCATGTCTCGCAA
CTCTCGTGATGCCATTGCTGCCCTGGGCTTGCTGCAGAAGGTCAGCTAATTCAGTGTAGT
TTAATAAGCCTTGTCCTAATGAAACCTTTCGTGGTTATTGATTTAATAATAGTGGTCACA
TATCTAAATAAGACACCCCCCCTATCCCCCCCCCCCCATATAAAGTTAAGCATTATTAAA
TATGTCATATAGATTTTTAAGTTAGAGGTCAGTGATAAAATGTATTGGTGCCTTCTACTT
TAGGGAAGTTTAACATGTTATAAGTTAATTAGAAAAAAGTTTGACCAGAGCCTTAGGCAT
CAGAGAATTTGTACTAGGATGGAGGACAGATGGTTTTCTGACTGGGATGAAATTAATCTA
CAAACTTTCATTGTACAACTACTATATACTAGGAGCTGAGGATACAGTTCAAAGAAATAA
CCTTTATCTTAAAGTGCTTATATTTTATTTTAAATTAAATTTTTTTTTCATGGTTACATT
ATTTGTGTTTTCCTTCTTTCCTCCTCCCAGAATTAACAAACAATTTCAGTGGGTTATACA
TATATTATCACTCAAATCCTATTTCCATATTATTTATTTTTTTAATAGAATACTCCAAAT
CAAATAGCTATATAAACAAGTGATTTTAAAAATCATTTTCCCCCCTGACTTTTTACTCCA
TCGTTCTGTCTCTAGATTTGGATAGCATTCTTTCTCATAAGTCCCTCAGTGTTGTCCTGG
ATCATTGCATTGCTTTTAGTATCAGAGTCAATTTTAACAAAGAAACAAATAGATAAAGAA
TATAAAGAGAATGGGGAAGGGAAGAGAGAGGGCACTAGTAGTTGGGGTGAGGAGAGACTT
CAAATAAGATCCCTTTTTTCCTTCAGGACCTGGCTTAAGCACAACTTTCTTGAGGGTAGA
GGTGAGAAGAAATGTATTTCAGAGAGGCAGCCAGTGCCAGAGACAGAGATAAGAGATGTG
TGGAGTATTGTATTTAAGGAACAGAGTCAAGTTTGCTGGTTCACAAGGTACAGGAGAGAG
AATAATGTCCAGTAAGGCTGGACAGATAAGTTGTGGTCAGGTGATGAAGGGATTTAAAAG
CCAAATAGAGGAGTTTGGATCTTATTGGGAAAGGGGTGAATGATTCATTGAGTAAGGGAG
ATTGACATAGTTAGATATACTCAAAAGAATAACTACTTCGGCAGCAATGTCTTAAGTATA
TTGGGTTAAAGAGAGACTTGAGACAGATAATACTTCAGAAGCTATTGCAGTAATTCTGGG
AAATGGTGAGGGAGAACTATATTCAGGGAGTAGCTGTGTGAAGAGAAAGATGATTTAGAG
AAAGAAACAAGATGTGGCAACTGATAGGATGTATGAGATGAGTGACAGTGAGGAATCAAG
AAAGATCATGAATGTGAAGGGCCAGAAAGGTTGATGCCTCTGGCAGGAAAAAGTGTGGAG
GGATGGGTTTGGACACAAAGTTCAAGGCACAAGACACGAGGAAGATACTGTTTAAATAGG
TTAGAGACAGTATTTAGAGGTAAAACAAGAGTGAATGCAGAACAAAGTTAGGGAAACCCT
TGTGAACCCTTGATCATAGACACCTTGGGAATGAGTTGTGCTTTGAATGTAGGTTTTATT
TCTGGCTTTAAATGTATGTGGCATGCTGATTTTTATTCCTGTCCTGTAGGCTGTAGAGGG
CTTGCTAGATGCCACAAGTGGTGCAGATGCTGACCTGCTGCTACGTTACCGGGAGTGTCA
CCTCCTCGTACTGAAAGCATTACAGGATGGCCGTGCATATGGGTCTCCATGGTGTAACAA
ACAGATCACAAGGTCAGTAGCCAGATACAAGAGAAGTTGAACTACATTTGCCCTTCAAGT
GTCCAAGGTTTTAAGTGTCCTCTAAAAAATCTTTTGGTGGGAGGTGAAATGGAATAGAGT
ATGGACAAATTATAGGCTTCTTTTTAAAAAATGCTGAAAATTATTGAATCCATGAACTTT
TTAAAGCTTTGTATGAAAGAGGGAAAAGATACACATTTTTGCACTGGGAGCAGATTATGG
CTCAATAATGAGCAATTGCTTTGACCACCACAGCATTCTTTACCTAAATATTTTTAAGTG
GAATCTATACTTATTCACTTGATATAAAGCCTTTCTTTGAAAAAAGATTCATTTTTATAC
TATAGAATTCTCTATTAGGTACCAGAGCTGGGAGGAAAGATACAAAGGTTACTTAAGGCA
TGGTCCTTGCCTTCATAGTGCTTATAATATATTGTAGAGGGAAAAGAAACAACTCTAATA
CATGACATAAATAAATTAGCTCATGGTTTTGTAAATATTTTGTGGTGTCTTAAGGGTTTG
CTATCAAGGTGGGATTGAAGAGTTCATTAAGGAGGTAGTGTATGAGGTGGGACTAGGATG
GAGAGGAGCCGAGTAGGAAAAAAATTTCCCAGAAGGACCATGAGCAGAGGTATGGTGGTA
GGTCAGAGTATGGGCTGAGTCTGTAGTGCATATACTAGGTGGCCTTAAAAATGTGAAAGG
CATTTGTTGGTACCCCAGATTTCTTGAATTTAGGACACATTTTTTTAGGCCTGAAAGAAC
ATATGTCTCCCACCCCACCCCCAATTTTTAAAAGAGAATATTCCTTTTCTAGGTGCCTGA
TTGAGTGTCGGGATGAGTATAAGTATAATGTGGAAGCTGTGGAGCTGTTGATTCGCAATC
ATCTAGTTAATATGCAACAGTATGATCTTCACCTGGCTCAGGTAAGGGGCCAATGGTCGT
CTTAATGGATGGGGGGTGGGGAGAGCAGCTTTCTGCCCAGACTTCTGCCTTGCTGATTTT
GTGGTTTCCTTATTACCAGTCAATGGAGAATGGTTTGAACTACATGGCTGTAGCCTTTGC
TATGCAGTTGGTGAAGATCCTTTTGGTGGATGAAAGGAGTGTGGCCCATGTGACTGAGGC
TGATCTTTTTCATACCATTGAGACACTAATGAGGATCAATGCTCACTCCCGAGGAAATGC
CCCAGAAGGGTGAGGACCAATGAGCTAGCCTTTAATTCTGTTGGGCTGCTTTATTTACAT
TTAGAAGGCCTCGGAGCAAGGGATCTTAAGGGGGAGAACCTTACTGTCAAATAGACTTTG
TGCCTTGTGTTGGTGTATCAGTGTCATAACTGACCCCGAATGGTGGGGATTGTGACCAAT
AGGTAACCACCGAGAGAATTTAGAGGCAGTGATGCGCAGAGGAACTGTACTAAGAAGCAA
TATATTAAAAGAGAGAGAACCACTGCCTTCGGGGAGCTCCTTGGGGATCTGTGCTTGTGT
GATCAGAAATCCCTTACTTGACCCTCACTCTGCATTTCTTGGTCCCAGGTTGCCCCAGCT
GATGGAAGTGGTGCGGTCGAATTATGAGGCCATGATTGACCGTGCACATGGGGGCCCCAA
CTTCATGATGCACTCGGGCATCTCACAGGCCTCTGAGTATGACGATCCCCCAGGCCTGCG
GGAGAAGGCGGAGTACTTGCTGCGGGAGTGGGTGAACCTATACCACTCAGCAGCGGCTGG
CCGCGACAGCACCAAAGCCTTCTCTGCGTTTGTTGGACAGGTAGAGCTTTTGGAGAGAAA
GGTGCTTTTTATTCGGCATAAGTGGGGTATGGCGCCTCCGATGTCATTGATGGCCAGGAA
ACTGCTAGTGTAGTCAAGGAATATAAGGATACTTTTAGCTATGTCCTAGTTTGTCAGGGG
TAGGCTATGATTATGGCTCATGAGACTGCTAAGTGAATCTAGCCACAGGTATGCTTTACT
GTGAGATCCTTAGCAGTCCTGAGCATGTGTAGAAACTAGGACACTTAATGGGGTTATAGG
CTACTTTTTCCTGAGTTGAAATTCTTCAAAGCAAAACCTTAACCTATACACTTACCAAAT
GAAACCAAAATACTTAAGATTGACAGGACATTTAATAGTATGCAAATTAACTAGCCTGTT
CCACATGAAATTTAAACAGATTGACTGTTAGGAAATGATTTTTATTTATGTAAGTCAGAT
TTGTTCTGAATTGAAACTGTTAAATGGATGTGCCAAGAATAGGGCACTGACTGAGGGGCT
GGGTTAGTAGAGGGAGAACTTGATGTGATTGATTGGCAGTGACCAATGAAAAGGAGAAAC
ACAATTCAATTTATTGCCACAGTGTAACATAAATTTCCATGTTGCTTATCCCTGTTGGAT
ATTTCTAATCATTTTTCCCCCCCAAGAGGCTTAACTGCCAAACATTGAAAGCCTTCATAT
TAACTATATTGCCCTGTTAGCACTTTAGCAAAGAAGGATCCTTTTCCTGAGAGAGCGAAA
CACAAAGTTTGTAGAATGGAGTGGTCAGTTTCCTTTCTTTGGTTTCTTGTTTTATTGCCC
AGGTTCCAAGCAAGGTCATACAAAACTACATGTTGATTACTGATAAGGCATGTATTTAAA
ATGCAATTTATTTTTGCAAGATTAAACACCAACCTTTAATTCGTGGTAAATTTTATTCCT
CAAAACCCTGGAAGGTTTGTGTATATAATATCACTCCCATAGACAACTTAAAATGAATCC
CATGAAAAGTTATCGTTGCCAAATTTATGGTTTCCCATGTGGACAGAAGTACCCACAATC
CATTTCCTTTATTTTATGAATACGGCACCTGTCAGATGTTTTTGCTGAGTGTCCTGGCCT
TTTCAAAAAGAATTAGACTTGTTCAATTTTAAATTCTTTTAAAGTTCCCTTGTTTCCTTT
GACTTTAGCAGTATTGCCTTTTTCCCAAGATACTCTATTTCCCTTATCCCCTCATCCCAT
CTCCACCCTCACCCCCAACATACAAAGCCAAATAGTATATTTTATATTATCTGGCTTCTT
ATGTGGTTAAGTTATATTGTAAAATTTGAACATCTGCCTTTATTTCATTTTCCTGTTTTT
CTGATGCCTATTTTAAATATGTTAAAAACAAAATCCAATCAGTGTGGTTTTTCTTTGTAG
CCTTATTGGTTGTGGCAAAATTTCCCCTTTATTGGTTGAATTAATTTAACCTCATCTGCT
GAAACAGGTGAATCTAGCCTGTGTGCAGTGTAATTTGCAAACTCCTTTTCCTGTTTGGGT
TGGATTTTTCTTTCTTCCCTTTTATTTTAGCTTTTATTACTTACTAATGATTGTTAATAT
GTTGTTATTGCCATCATACTCAAAGAGGACCAAAATGACATCATTGTGTTGGGATTTATG
TGTAGTGGGTCTGTGGCTAATCAGACAGTATGAGCTTGAAAGGTTCTACCACAGATCAGA
CACACAAATAGTCTATGTTCATATTTGAGATGGAATGATAATTTATATCTAGCTATGTTC
ATGTAATTTTTTTTTTTTAGCAAACCCTCTTTTTCATTGGTGCCTCCTAAAGTCATTTTG
AAATTGAACTTTTTGGTGGTTTGCTCCCTAAAGATTATTGCCACCTATGGCAATTTGATG
ATAAATCAATAATAATATGTAAGAAATTTATTCTGTTGACCTGAGATATACCCCCAGGTT
AAGAGGACTTGATATAATTTAATAGGCGATTAACAGTTGATTACATAGCCTATGGGACAG
GCAACTAAACTAAAGCTGCCATTTTTGCCTTCTTCATTCTCATATTCTCTGCTCTCCCAT
TAAGTTTGAACTCTGCTGTAAGAGCTGGTAGCCTGCTATTCCAGGTGAATAAAACCTTTC
TCCTGTGGTGTCTGATGCTAACTAAATTCTGGGGTTTTCATGTTATAAAGAAATGACTTT
TCTTGTTTTCAAACACTGTAAATCTGAAGTCATTTCAATGCCTGGAATTATGGTGTATAA
GTGACCTTGGATTCTCAGAGGCTGTGTCAGTGGGGTTTATTCACTGGCAAGTCCAATCAG
TCTGTGAAGGCTCCCAGTAATACTGACATTGAGCTTTGTTCGTCAGAGGAACAGCCTCTC
TAAACTCAGAGGGCTCGTCCTGGGGAAGCCAGCCTCCCAGTGATGAGCATTTAAATCACT
TTTAAAAACTATTCAAGAGTTTATGAAGGGGCGGGCAGAGAGCTTGTAATTAGTATTAAG
TCATGAAACCTTTTTATTTATTTATATATATATGTATATTGAACAGTTTAAAAACTACTT
TTTGGATTTTGTTGGCTCATATTTCTTGTCCCCAAAACAGATGCACCAGCAAGGAATCCT
GAAGACTGATGACCTCATAACAAGGTTTTTTCGCCTGTGCACTGAAATGTGTGTTGAAAT
CAGCTACCGGGCTCAGGCTGAGCAGCAGCACAATCCTGCTGCTAACCCAACAATGATCCG
GGCCAAGTGTTACCATAATCTGGATGCCTTTGTGCGGCTCATTGCACTGTTGGTCAAGCA
CTCAGGGGAAGCCACTAACACAGTCACCAAGATCAACCTGTTAAACAAGGTTGTCTGTCT
TTGTTGGCCAGTTACCTTATATATACTTGTGCTATGGAAAATGTTCTTTACCTTTGATTA
GGGAATGAATGGGGGGGGGGGGGGAGTCAATAATGTCTACTAGATTTCCTAACTCAGATC
ATTTCACTTATATAGCCCAGGAACAATCAAAACTTAAGTGATTAGATCCAGTAGGAACTG
ATTTTGAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAATTTTGGCCCCAGTATATTTAAGACTTTGGAGTCC
TTTTTTCAAAAAGCCCAGTTTAAAAATTCTGGGGGGGTTTTGGCCCTTTTGGGTTATAGT
AAAGAAAGGAGGTTTCAGGACCTCAGTTTAAAGTTTTTTACCCAGAAAAATTTTGTTTCC
AAAAGAAAACCTTGTTTTTTGGCTTTCGGTTTCATAGATTGTTCCTGGAAGAAAAACCCC
GGGGGTTCAATTTTCGGGGGGGCGGGGGGAGAGGGAACCCCCTTTTTTGGGACGTTTTGG
GCAAAATCCTTTTTTTAAAGATCCTCCCGGTTTTGGAAAAATACATAGCAACTTTTTTAT
TTAAAATTTCCCCAAGCTCTTTTTAAAAAAACCTGCGGGGGGGGGGGGGGGGGGCTGGCT
ATATTTAGGAGACTTATTCCATGTTAATGTCCTGATGTGTTTGTTATCTTTAGGTTCTTG
GTATAGTGGTAGGTGTCCTTCTGCAGGATCATGATGTTCGACAAAATGAGTTTCAGCAAC
TTCCCTACCACCGGATCTTCATCATGCTGCTCTTAGAATTAAATGCTCCTGAACATGTGT
TGGAAACCATTAATTTTCAGACACTGACAGCTTTCTGGTAGGTGCTTTTGATCATGTTTA
AAAGAGAACCTTTTGGTTATGTCACTCCTTGAGTGCCATTTTTGTGGCCTTTATCTTGGT
AGCTTGTTATATTTAACTTGTAGGGAGATGAAACAACTTTTCTATGTTAGCACATGTTCT
GAAGTTAACCTTTGTGGGTACCACTGCAATATTTATTTTGAACCTAACTGCTTTTAGTAG
AAGTGTACTAATCAGTGTTTCTTTCTTCTAGCAATACATTCCACATCTTGAGGCCCACTA
AAGCCCCAGGCTTTGTGTATGCCTGGCTTGAATTGATCTCACATCGGATATTTATTGCAA
GAATGCTGGCACATACACCACAGCAGAAGGTGTGGCTGTAGTCTGTCTCCTACAGATGAA
GACAGTAATCATATGGGGCTTGGGATGGCCTGCAGATTTCTCTTAGCTAGCTGGTTGGGT
GGAAGTGCTTATAGATTTTCTTTGAAAATGTGCAAGGAGTTTAGTGGTTAACTGGTTTTC
ATTTTATTTCATTTGGTTGAATTTAATGTATCTATGTAGGAGTCATTTGTATCTCATAGA
TAAGGAAATTGAGGCTCAAAGATGGTGACAACCTACATTTACTTGGCACCATTATCAGTT
TGAATCTCAATTCTTCTGTTTCCTTAGCTCTTTCCATTATATTTTTATTGGCTCTTAATT
CTATTTCAATAAAATTGTATGCCTACCATGTTCAAGAACTTCTTTGGTACATACAGACTA
GTAGGATAGGACAGGGCTCTACTCTGCCTCCAAAAAACTTGGCTAGTCAGGGAAACAGAA
AAATCAGTTAAGTTAAATAAAAGTACAAGGCAGAATGGGACTGAGTACTAAATCAGTTGT
GTAAAACCATACCACTCAGGAGGTATTGAAGTTTAAAGAAATTCAACTTCATCATGAAGA
GTGAGGGAGATTAAGGGTTCTCTTCAGGGTCCATAGGATTTTTAGTGTTAGCAGGGAATT
TAGAGATCCAGTGCCATCTTGTGTATGAGGAACCAAAGGCCTAGAGGAGAGTGCCTTATC
CAAGGTCACCTAGGTAGTTAAAGACTGATGCAGTTTGAAACAAATCAAATGCTTTTTCAC
TTGGCCAGGGCTTTCAAATGATAGACATTTCCTTCCGGATATAGGAGGAGGCAGCAATTC
AGGAAACTCCTTTATTGAATCTGCCTTTGTTCTGTAAGCACTAAGGATTTTAGAGTTGGT
GGGAATTGGTTGAATTGGGTATTGATCGTTTCAATAGGATGGGGAGAGGGAAAGGAGGGG
GCATTTTAGGAAGAAGTATAGAAACATTTTGGCTAAAATGAACTCTGCATGGCCATTCTA
TATAAAGTGGTATGAACTGAGCAAGTGATTAATGGCAGTCACTAATTAGGGTCACACTTG
GGGTGGGAGTTGGGAGAAGGAGTAGGACAGTGGGGGGGGTGGAAGGGGGGGCACAGATTG
AGAACCCTTTATAAGGTTTAGGCATGGATTAGAGCTGAGAGGAGTTATCTATGTGAAACA
CTATAAAGAGAAAACCCAGAGCAATTATCTGCATAGTGTGATGAAGTCAGATAGGATTGA
AAATTTAAATGGTCATCCAAGTGAAAATGTTTAGTCAGACTGACATAGGTACTTATGTTG
AGAGGTTAGGAGATGGGGATAGCTAGGTGGATAGTTGATAGAGAGCCAGGCTTGGGAGTC
AGGAGTACCTAGGTTCAAATCTGACTGTAGATACTTCTTAGCTGTATAACTCTGGGCAAG
TCTCATGCTTAACCTTGATTGCCTAATTCTTGCCATTATTCTGTCTTAGAATGGATAAAT
ACTAGAACAGAAGGTAAGGATTTTTTTAAAAAGTCAATAGGCTATGAAGAACCAAGGAAC
TTGATTTGAGGTCATTGGTTTGCTTTAGGCCATCATCCAATTTAGTTTTAATGTAGGGAG
TGGTAAAAATGAAAGATTAGACCAAAGAATTGCTGAAAACAGAGAAGAACTAGTTTGGTA
GCTTATTGTGGTTGGTAATTGGGTAAAGTCAGATTTACTGGTTTATTTGGTTTTTTAAAC
AAAATAGGCAGAGGCCTGCATTTGTCAATGAAGAGGGAAATGTTCATGGGTAGGACTTAA
GATCTTTCTTAAAACCACTTTTTTCCTTTCTAAGTAGGAGGATTTATGACCCTAGGTTAA
TAGTATAAGGTAGATTATAATAAATGAGTATTCCCTTTCTAGTCTGAGAATCCCTTTATA
ATGCTAACAAAATTATCTGGTTAAGTGCATGTTTTGGCCTTACATAGTTAATCACTCCTT
TTCTTTATCTTGTCTCCTAGGGCTGGCCTATGTATGCCCAGCTGTTGATTGATTTATTCA
AGTATTTAGCCCCCTTCCTTAGAAATGTGGAACTCAGCAAACCTATGCAAATCCTCTATA
AGGTAATTTACTTTGGTTTGTCAAAAAATCCTTTGGAATCTTCTAAAGCCTCAGTTTAAC
CAGTAGGACTCATGGAAATCAAAAATCTTTCACATTAAAGTGAATTACACTCATTAAAGT
AAATTCTTAACTCCTTTTTATGGATTTCTAAATGTGTTACAAACATGTCATCCGTTGGAG
AGTGAATATCCCTAGTGAATGAGAGTATAATATAGTTCTCCCCTTCATCTGAATCAAACT
TGGAATAGTAGGAATAAATGGGGGTGGGGGGGGGCTGCATACTTGTACAACACAGGCATG
TGAGTACCTCATGTCTGCCTGATGTTAAAGCTGCTCATCTTTTTCACTTTTTCTTCTCCC
AAACCCTTTTCTAAACACATTAGGGTACTTTACGAGTGCTGCTGGTCCTCCTGCACGATT
TTCCAGAATTTCTTTGTGATTACCACTATGGATTCTGCGATGTAATCCCGCCCAATTGCA
TCCAATTACGGAATCTGATCCTGAGTGCCTTTCCACGAAACATGAGGCTACCAGACCCAT
TCACTCCCAATCTGAAGGTAAAAGCTGTAATCATGGCAGCTCACAACCTCGTACATAATG
GATGAGAGCAGTCAGCAGTCCCTGGGTGCCGAGGAAGGTGTCCAGGGAGCCCTCTTGCTA
CAGGAGGTGCTCCTTATCCACAAGCACAGCAGGAATTTTAGGAGCTCAGTTGTTGAAATG
GGCACTTTTTGGAACTGCTTTGCTGCTTATAGTTTAGATATCAGCATTCAAGTCTTTGCC
TTTGTCCTTTACAGGTGGACATGTTGAGTGAAATCAACATCGCTCCTCGCATCCTCACTA
ACTTCACTGGAGTGATGCCTCCTCAGTTCAAAAAGGATTTGGATTCCTATCTTAAGACTC
GATCGCCAGTCACTTTCCTGTCTGATTTACGCAGTAACCTACAGGTTAGATTTGCAGTTC
TTCAGTACATTCAGTTCAATTCTCAGTTATATCATTTGATGATTGTGATTGATGTCTTTT
TAATTTCTTCATTCCTATATTGCCTAGCAAGTTAGTCCTGTTCTTCTCTCTCCTCCCTAC
CTACCAGAAGAAAAAAAAATCTTACATTTGAAGAGACGGGAATCCATCTATAGAAAAAAG
CAGCAAAAGGACTAGGCGAATTGGGAATAGGTGACTTGCCCAAAGGGACGGAGAAGAAGA
GGCTTCCGGCAAGATTAGAAACCAAGTCCTTCCACCTTCAAGCCTGGGAATCCAACGGGT
CACCTGCCGGCCCAGGGGAATTTGAGTTTAATGCACAGCTTTTCAAACTACTGTGTCAGT
ATTTTGAAGGGACCTAGGAAAGCAGCCAACCCTGAGTATACCTGTCTGCCAAGGCTCCCT
CCTGACAAATGAATCTCCCAAGATTTTGCACCCTATCGCGGGAGATCTGTGAAACTCCTT
AGGTACCAGAAGAAAATTTATGTCCTTACTGGGTCTTGCGTGTGAGACCTTTGGCCGTTA
TTACCCTTCAGAGGTGAGTAGATGAAATGATAATTGGGATTTATGGCTAATCAGGCTTCT
GGACACGTGGCGGCAGGATGGGATGTAGGATCTTCCATATATGTCGGATGCTAAAATTTG
GCCCCTTTGTGNAAAACAGCTTTTTATGCTGGAGCTGCATTTCCCGAAGAGTTGTTGCCA
CAACGCCGCATGTTAACTATGCCCTTTGTGTGCTCCATTCACTGGAGTCTGACCCAGTTT
CTACAAATTACTTTTAGTGCCTACCTTCCAGTTTTGTGAGGACGTTCACTTTAATTTACT
TAATGGGGTATCTCAACATTTGTCTCCCCTCCCTATCTTCTAGAACCCTTTCTCTGGGCC
CTCTTCCTCTTTTTTAGAGGTTGATGCCAGCGTTTGGATTTCTAACATCACCTCATTCTG
TTGTAGTTGGATTTTGAGAATGATGGATGTTAGTTAGGCATAAAGCTTTGATCAGAGGTC
CCGACCTATGCCTCAAAGAGGAAAGATTTGGAAATATCAGTAGTAAAGTAACCTACCGAC
AACATTTAATGAAGGCTTAACTTGGGCATTGTTCACTAGGTATCAAATGAACCTGGCAAT
CGCTACAACATCCAGCTGATAAATGCACTGGTGCTCTACGTCGGTACTCAGGCCATCGCC
CATATCCACAACAAAGGCAGCACGCCGTCCATGAGCACCATCACTCACTCGGCGCACATG
GACATCTTCCAGAACTTGGCTGTGGACCTAGACACAGAAGGTAAAGAGATGGTGGGTGAT
GGAGTAACTCCAGGTCACTGACCTTGTAGGCAGGCAGGCAAATTATGGTTGGGGTAAGAA
ATGTATTTCTGTATCATTGAGGAGAATTGTAATGTGGGAATGTGTAGGTTTGCTAAGGCA
AGTTTCTTCTTTTCGCTGGGCATTTTTTATTGACTGTAGAGAGAACCTGGGAGGTTAGTC
AGACCTTTAAAAGGAAGGTATGAATTGTCTGAGGCTCCCTCTCTCCCCAGTATATACAAG
AGAAAGTTACTTGTTCAATTATTGTGAATAATTATGTTCATTTAGCATCTTCATTTATCA
GGCACTTGTACTAAAGTTTATAAGACTTCCCTCACAACAACTCTCAGTACAAAGTCATCC
ATCTTATTCTTAGCCCCTCTGTTAGCACATGGAGCCTTAAGAACTGTCATTGATTCCAGG
TCGGTACCTCTTCTTGAATGCAATTGCCAATCAGCTGCGGTATCCAAACAGCCACACTCA
CTACTTCAGTTGTACCATGCTGTACCTTTTTGCAGAGGCCAACACTGAAGCTATCCAGGA
ACAGATCACCAGGTGAAACTTAGGGGTCCTATAGGCTGGGTACTTGACCTGGGGGCCGTG
GATAAATTTCAGGGGATCCATAAACTCAGGGGAGAAAAATGACATCTCTATTTTCACTAA
CCTCTTAGCTGACATTTAGCATTTCTTTCTGTTATTTAAATTTTTTATTTTAATTTTGAG
AAGTCTGTAGGCTTTACTGGCCTGCCAGGCTCTTCTGTAAACACAAAGTCCAGAATCTGT
TCTAGACTATCATCTTTAACCCTCGGCTCTAGTCCATTACTGTGTGAAAGTGCAGGTTAT
ATCTTAAATGACCCATGATCAGGAAAAAAATACACACTTGGTGCTGAAACTATTCTCTAT
ATTCCCCCACCCCCAACTTCTATTACAGGGTTCTCTTGGAACGGTTGATTGTAAATAGGC
CACATCCTTGGGGTCTTCTTATTACCTTCATTGAGCTGATTAAAAATCCGGCGTTTAAGT
TCTGGAACCACGAGTTTGTTCACTGTGCCCCAGAAATCGAAAAGTGAGTTGCATGTGTGG
TGTGGTTTTTTGAACTGGAAAGGGAAAACTATGGAATGGAGCAGGATAGTACACATTCTT
TGGTGTATTTGACTAGGTTGGAGGTTGTCAGTTAAGAAATAGATTCCTTGGATGTTGGAG
AGAGATTGTGCCACTGGCAGAAAGTTCTCAACGTTATTAAGTCTGTTTTCAAGCCTCAGA
TGTAAATAAACCATGATTGAATTCTCAGATAACATGCTTTATTGGACAAAGTGACAATCT
AGGCCATAAGATTTTCACATTGATGCTGAGGGGACAGGGGTAACAATATTCTACTGGGTA
CTTTGGACAAGAACCTAACTCATCTTTGACTCTTCCTTTAGGTTGTTCCAGTCAGTTGCA
CAATGCTGCATGGGACAGAAGCAGGCTCAGCAAGTGATGGAAGGAACTGGTGCCAGTTAG
ACGGGCTGCCTCTTGTGTTGTAAGCGTGCCAGCCTGGAGGGCCCCATGCCACCGAATTTC
ACAAACTGACTGAAGAATCCTTTTGGCTCTTCCTGACCTTTCCAGCCCCCTTGGTTCTTG
GGTATTTGCCCTCACCCTTGGGGAAGAGTCTCCCATCTTTGTGGGCACGTTCCAAAGTTT
AAACACATTTTTTTTGACTCTTGGCCAAAATTTAGAAGATGCTGTGAATATCATTTTGAA
CTAGTGTAAATACATGGAACCGAAACCTTTGTCTGGACTTTTTGGGTTTGTGCAAATTGT
GTTAAAGGCAGGTGGATAAACTGGCGCCTGTTCAGCTTGTAATAAAGGGGCAGCTGCTGA
TGCCAAGCACTTGTCTAGGGCAGATCTCCTTGTCCTGACATTCTCGGACTCTCAAAGAAT
ATTGAAAGCCAGTTAATATATGTAACTATTTTTCTTATGTGACAGGGACTTTATATCCTA
GCTGTAAAAATGTGGATGTGTTGGAATATGGGGTGCTATGGATTGGTGGGGGAGGGAGGG
TTTGGGATTAAGGTCCATTTTTTTCCACCCCTCCCTTCCTCCCTCCCCCCTCCTTTCTAC
CTAAATCTGACAGCAGGGAACACACCAGTTGGAATAGCTTCTCATTTCTGCTGGAGAAGA
GATACTTTGGGCCCTGTGGGATAGGGTCAGCTTTCGTTATCAAGGGAAACCAGACCAAGT
CTATAGCATTCCCCCTCCTTCCTGACACTTGTAAATTGTGGGGGATGGGAAGGGAAGGAA
ACAAATCTATGAACTGCCCCCCACCCCCACCCCATCCCCATCCCCATTGACCACACAGTC
TAAGTTTGTAAAAAGAACAAAGGACCAATACAGCCCATTTTGTAAGGATTTTGAATGTTT
TGTAAATGTATTGGTCCGCGTGTTGTATTTTGTAGCCTTTCTAGTTCCTGGGCTTTAGTT
CTCCCACTTCTTGTATGTATCTGCATACTGTAGTTATACATTAAAGTCATGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 17267..17541, 32453..32560, 33614..33712, 34113..34181, 34267..34321, 35388..35591, 38257..38425, 39708..39834, 39978..40088, 41732..41902, 42344..42471, 46042..46282, 48192..48311, 49159..49281, 49516..49667, 59089..59239, 60329..60530, 61191..61337, 62895..63019, 63905..64191, 64626..64704, 69592..69822, 69930..70070, 71402..71581, 74170..74286, 74913..75023, 75460..75537, 75802..75979, 76753..76883, 79512..79808, 80520..80660, 80763..80867, 81411..81534, 82532..82719, 84349..84491, 85312..85420, 85519..85688, 86028..86259, 88840..89091, 89813..89976, 90211..90328, 92300..92401, 92783..92956, 93194..93343, 94479..94659, 95099..95231, 95608..95742, 96101..96192
38367..38425, 39708..39834, 39978..40088, 41732..41902, 42344..42471, 46042..46282, 48192..48311, 49159..49281, 49516..49667, 59089..59239, 60329..60530, 61191..61337, 62895..63019, 63905..64191, 64626..64704, 69592..69822, 69930..70070, 71402..71581, 74170..74286, 74913..75023, 75460..75537, 75802..75979, 76753..76883, 79512..79808, 80520..80660, 80763..80867, 81411..81534, 82532..82719, 84349..84491, 85312..85420, 85519..85688, 86028..86259, 88840..89091, 89813..89976, 90211..90328, 92300..92401, 92783..92956, 93194..93343, 94479..94659, 95099..95231, 95608..95742, 96101..96176
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved