Monodelphis_domestica Locus SF3B3
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SF3B3
Monodelphis_domestica
SF3B3
1
SNORD111, SNORD111
2601..2680, 6488..6576
39519
GGGGGAGGATGGGCCTAGGCCTCGGGGCCTGGGCCTCGGGTTGGGGCGGTGAGGAAGCG
GGCGGCATGTGTAGTGGTAGGTTCCCCCCTGCATTCTTCGGGGCCTTCCTGCTGAGTCAA
GCGGTTTCTGGGCTGCTCCCTGGAGGGGAAGGCCCAAACAAGGGGGTGTGAAGGCCCCCT
CAAAAGCGCCAGTGGGAACACCGCGGGGTGAGACATCTCCATTTTCTCGATTATCTATGT
GCGGCTTGCCCGCCCTTAGGGGCCAGGACTGTTGGGGGCGGAGGTCCAATCTAGGCGGCC
CTCTCCACCACCCCGATCCCAGAGGCCTGAGTTCAAATCCTGGCCCAGACCCTAACTGGT
GACTGTAGACGGTAAAGCTTTAAGAAAAAAAACTTGTTTCCTTTTTTCCTTGATCCTCAA
AATCCTGGAAGATAGGTGCTGTTATTCCTAATTTACAAATGGGCAAATAGTGACTCACCC
AGGATCACCGAGCTAAAGAATGTGTGAGCCTGCATCTTTCTCAATCCAGGTCCAATGCTC
CGTTCATTGTGCCACCTGGCTGTCTTTTTTTTTTTTTTTAACTTTTTAAACCCTTCCAAG
TCTGAAAAGCTGTAAGGACTAAAGCAAGGGGGGAGGGGGGTAAGTGACTTGGCCAGGGTC
ACACAGCTAGAAGTTTTTGAGGCTACATCTGAACCCAGATCTCCAGGCTACATCCATCTT
AAGACAGACTCCTTACACTGTGACCCAGCTCAAGAGCCCTTTTAAATTGGAGCTAATTTG
CTAACTTTCTCTAGGTGGAAATGCTTTTTATTGTGGACACCCTAGGCTGCATTCTAGCTT
TAATATTTTTAAGAGGAAATACTGAGAACCTACAAAGTCTTTTCTTTGTTCACTCCCACT
TACCATCTAAACCAAGCTATAAAACTAACGATTTATGTTTAACTTACATTTTTGTGTATT
TAGTGCATCTTGGAGCAGGTCTATACCAAAACTTGAATTCAGAGGTCCTGGGTGACCCTG
CTACCTTGCCACCATGTTCCTGTACAACTTGACCTTGCAGCGAGCCACTGGTATCAGCTT
TGCCATTCATGGCAACTTCTCAGGTAAGTTCTCTGGTCATGGTATTGACATTTTGAAAAC
AAAGTAGCATTTGTCATTTTTGTTTAGCTAATTAACAAATGCAATTCTCAGGTTATCTCA
TAGGGTTGGGTAGAGCCAGCAGTTTGCAAATCTGAATTAGTTTAATCCTTCTCATAATCC
CTAAGGTTGGTATAGTAACTGGTCACCTCAAGGTTGTTTTCTTATTTCCCTAGATTTTTC
AAGTCATCAGCAATTCAGCAAACATTAATTGAACCCCAAGGTTCTGGGTGAGAAAGATCC
AATGCCTTTGCTCAAGGCATCCAGTCTATCTGGAGAAATAGGATATACAAGTCAGTCAGT
CAATAAGAATTCAGTGCTTACTGTGTGCTAAATTCAGGGTAGAGTGGGAAGAGGTTACAA
AGAACACAGGTTACCTGTCCTCAGGTAAGAAAGAGGTACATGTATGTGAAATAGCATAGA
ATATAACCAACATGAAAAGGAAGTCTTTTGAGGAAAGAGGACACCTGTAGCACTGAGGAC
CCATGTAGAAGATAGAGCTGAATCTAGAATAAAGCTAGAGCTTTTCGGATAGTGAAAAGA
ATATTGCAGGGATTGGGGGAGACACTCAGTGAAATGGCATAGAGACTTATTAAATAGAAT
AGGTTATAAAATTCTTTTTTATGCAGTTTGTTGCTCGATGCATTTTTAATAGAGATAATT
TACCTTGATTTGTCAGCACTTTTGTATTGCTTTTCAGATAAATTGAGATGATAATTCATG
ATATCTCTTTCTTTGGTGATCTAGGAACCAAACAACAGGAGATTGTTGTGTCTCGAGAGA
AGATCTTGGAGCTGCTTCGCCCAGATCCTAACACTGGGAAGGTGCACACCCTATTGACTG
TAGAAGTGTTTGGTGTTATCAGATCTCTCATGGCCTTCAGGTTGACAGGTGGTACAAAAG
ATTATATTGTGGTTGGCAGTGACTCAGGCCGAATTGTCATCCTGGAGTACCAGCCATCCA
AGAACATGTTTGAGAAGATCCATCAAGAAACTTTTGGCAAAAGTGGTTGTCGCCGAATTG
TACCTGGACAATTCTTAGCTGTTGATCCCAAAGGCCGAGCTGTCATGATTAGTAAGTGAT
GCTTGCAACTGGATACTCTATGGCTATGGTTGTACTGTGATGCCTGAGTTAAAGATGATG
TTGCTTTGTGCTGGGAATTCTAGTTTCTAAGATTAAATGGGTTAAGCTGTTTAGAAAATG
CAAGGTTTCTTTCAGCAAGATGTCATTGCAACTCTACAATTACTTATTGGTAAAATGTGT
CATTGGTGTAGGTCTAAAGTGACTTGTGGTTTTTGTTTGTTTTTTTAAACTGTTGGGTTC
AATCTCAGAAACTCCTTGATAGCCAATATCCTTCTTTCAAAAAAAAAATTTTAGCTATGG
TTGGGAGTGGAGATTGACTGTTTTGGGGGGTATGGGAGTAGGAGGTTGGTTCATTTGGCT
TTGGGTTATGGTTGTTTTCATCAGCCTGAAATGATGATTCACATTCATGTCTCTTCTCTG
AGATTTCTTCTGGAGAAAATATGGTGTAACTGATCAGGCTTTAAGAGGGAAATTCTTAGT
CTTCCTAAAATATCAAGAACATTTGCTCTCTGAAAATAATTTTTTGCTAGGCCCCAAATT
ATCTTAAGTAGGAATACACAAGTCAATTTTTATTTTTTAATTTATTTTTTTAACAAGCCA
ATTTTTAAAGGAAGTTTGTAGGCGCAAAGAGAAAATACAGTGTTGTGGATAGATTATGGG
AGATATGAAGCATGAGTTACATATTTATTGGCTACTGAACTTGAGAGACCACATGGTATG
GCACATTATAGCACATTTAGACAGGAAGGCTTGGCTTCAGATCCTCACTAACACTAGTTA
CTGTATGAAAAAGAAAGGGTTTAAACTAGATGGTTTTGGGGAGCCCTTCCAGCTCTTTAT
GATATACGAGTTGTTAATTTATTTTCTCGTGCTAGGGAACTCATTTGTGATTTGTCTCCA
CCTTCAGGTGCCATCGAGAAGCAAAAATTGGTTTATATTCTGAACAGAGACGCTGCTGCC
CGCCTTACCATTTCTTCACCTTTGGAAGCCCACAAGGCGAATACTTTGGTCTATCATGTG
GTAGGAGTAGATGTTGGATTTGAAAATCCCATGTTCGCCTGTCTGGAGATGGATTATGAG
GTAAAGTAGGTAGATTAGGTTCTTTCTCTTTGCTTCAGTTTGGATCAGTACTTTTTAAGG
AGTGCCTCTGTTTTCATGCCCTCTCCACTTCTGCCTTTTACCTTAAAAATGTTTAGGAAT
TGATTTGCATGAATGTTCTACTTTGAGTTATCTATCAAAATCAATAAACCATTGATTAAG
CACATTGGGGACACAAAAAAAGCAAAAGGGGATGGGGGTGGTGGGAGGGCTAGCTTAGAG
TCTAATGGGAGAGGTTTGAGATCATTTGCTAAAGGAAAAAAGGGATTTTGTCATGTCTTG
GTTTTAACATAGTTTTGCTCTCTGCTTTTGTTTTCTATAGGAGCAGATATGATCCACGGG
AGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTGACTGGTGGGACCATAAGGTTGATGATTTCACTAAAGTTGGGAG
TGTAAAGAAGAGAAAGCAGAGGAGTAAAGATAGTTTTAGGATGGAGGGGAATCAGGGTAA
AAGATGCCTACAGAGAAGAATCAGGAACTTCATTCATTGTCACAGAAACCCAGCATGGGA
ATCATGGAAAGAAGGAATTTGTTAATAGGGAGATAGAACAGGAAATAGCAGAAAACAAAG
GTTGAAATAAGTCCCTTAGATTTAATGAAATCCATTTGAGGAGCATAGGATCATGAGTGA
CAACTAGAGATTGAAATCCAAAGGCATCATATATAAAGATGAGGAAACTGTCCCAGAGAT
TAAGTATAATTTCAGCAAAAGCTGAAGCTAGATTACAGTAAGGTCTGCAAGGATATGATA
CAAATAGATAGGAAGCAGATACCAACCTTGCATTCTGTGGATTTTTTTTTCTGAGTGAAA
GGGGGAAAATTGGGGACTATTTGGTAGGGTCAAGTAGAAAGATTCTGTGTGTAACGGTTA
TGAAAAGTTGAAAGACGTTGAATCTGAGTATTTGAATGCAGGAGGGAAGATTTTCGAAAA
TGTTAGGGAAGATTCGATTCCATATTAACATGTCAGGAGATAAGAAAGTTGTAGTTTAGG
GTTTTCATGGAATGTTTAGCTATAGAGAAGAGGAATGAAATAAAAGGAATGATGCTAACA
TGAGTATTTTAGAAGTAGCAGAGATCATAAAGATCATTTCATTCATCACTCTCCCCAATT
TTTTAAGTGGGAAAACCATTGGGGAAGGGAAGGCAGGAATTTTATATTTAAGAAGATAAA
AGGGAAATTAAATTATCCTTAGAAAAATTTTTTTGAAGTATCTTTGCCAAAACCCTGTAT
TATGAAGGCTATAAAGGAACATGACAGTTGATAGGATTCTTTCCCTTGGAGCTTGCCATC
TCTTGGAATTAGGTAAAAATGAATTTAAATTCATTTGGAGCATTTTAATATTATCAGAAC
ACATAAGTACTATTGAGAAGAGAGCTTGGGGGACAGGTATATGTGATGAGAAATGATCCC
TAACTTTGACCTGACAATTTTTTTTGTGGGTTTTTGTTTTTAATTTCAAATACTGAAAAA
GTTCCCTAGGTTCTTTGGGGCTCCCCCAAATTTCTGCCTCCCCCAAACTTATAGCCCCAA
TTCCCACAGTAGTTCTACTTCAAAGGATCATAAAAAGACATTTAGATTTATTAAAGTTAT
GATTCCTAGCCTGCTTTACAGACAGATAAAAGGGAGCTGTATTTACAGTGGTCAGATCTG
GATAGATACCATTTACCTGATTAGATCACCTAGCACCAATTCTAGCACACGAGGCATTTT
TTCTGCAGAACTGGGCTGATCCATCTTCAGTCCATTTTCATTATAGCAACCACCACACCC
AGCCATCACCAACCAAGGGCTACAGAAAGAGTGGTAGCCAGCAATTTAAATTTTGCCAAG
TCCCAATTCATATTACCCCATGTCCCCCCACTTGACCCCATTGTCTCAACCCCACGCCAG
GATTTCATAGAGATTTTCCCCATATAGGAGATAGATATTATATAGATAGGAGGAGATATA
GGATATTAGATTTAGAGTTAGAAGAGATCTCAGCAGTCACTTAGCCCAACCTTCTCCTTT
TACAGAGAGGGAACTGGCCTAGAAAACAAGGATAAAAAATTTGGAGGGGTTGATGTCACA
CATCCAAGTTACATGATTCAAAATGTTACCATTTGTGAGGGTTTTATTTTTCATACGTAC
TGAAATATTATGATTGACTTTCCCTTATCCAACCTCCAAAAGGGAAATGTTGCATTTTTC
ATGTCCACAAAATAGTCAACAACCATACTGTGTACATTTAGCCATTCTGCCTTTGGGAGA
GAGAATTGTTAAGATTTTGAGATTATTTTGTCTTCACTGACATGTTTTGTTTCATCCCTT
AGTACCAGGAGGCTCAGATGGTCCAAGTGGTGTATTGATCTGTTCTGAAAACTATATCAC
CTATAAGAACTTTGGTGATCAGCCTGATATCAGATGTCCCATTCCTAGGAGGCGGGTGAG
ACCTTTTGGGCCTGGGGAGAGGGGGAGGGATATTTGAGAATAGCAATGAAGAAGGAACAT
GAGATGAAACAGTTGGTTGTATTAAGAGAACTTAATTTTAATTACCAGAAGGTAATCTCA
AATTTATAAGGCTCTAGGTCTTTTGGAGAAACTATTCCTTATTCCTTGTTTGCTGTATAG
TACTTAGCAAGTTAGATCTGCTTAATGATCATTGATTGTGTTGAGGCAGTAGTGTGAGAG
CAAAAGTAAATATCTAGTTACTAAACACTGAATGTTCATAATGTTTCTTACCCTATAGTA
GAGGAGATTTCCTGCAGTTTGGAAAGCAAGAAAATGCTTTATCTGGCAAGCTCTTGAAGA
GTGTTCTTTGGATTTTGTTGTGGGTGAAAGGAACTTAGTGGGAAGAATTTGAAAAAACTG
AATGAGATGTAAGTTCTTGCTAATAATAGCATTTTGAGCTTACAGGAGGAAGAGGTAAAA
GAAGTGACAGATGATTGATCTTGATAGTAATTTCTTGTGTCATAAGCCAATTGTATATGA
AGTCTTTATTGCCTGAAATGATGATTATTTCATGAATCTTCTCTGAAACTTTTTTCTCTG
AAGACAAAAACTTACCTCTCTGAATCTGATCGGGCACTGAGCTTCACATATGGTTGAGTC
ATTACATTGGCCCCAGTCTCCATCATTAGCATTGTTGAGACATCTATTGATGACATAGGG
CAGATAGAGTTTTTTATTTTTTATTTTAATTTTATTTTTTTAAACCTTTCTCTCTTGGAG
TCAATACTGTGTATTGGCTCCAAGGCAGAAGAGTAGGCAATGGGAGTCAAGTGACTTGCC
CGGGTCGCACAGCTAGGAAGTGCCTGAGGCCAGATTTGAACCTAGGATCTCCTGCTTCTA
GGCCTGACTCAATCCAGCTACCCAGCCCCCCCCCCCCCCCCCCACCAAAAAAAAAAGTTT
TCATTTTGGCCTGTTTCTAGAAAATAAAAGGATACTTTTTGAAAAGGGAAAATTTTCCCA
ACAATATTTGCCCTTGGCAAAAAGGAGGCCTTGGGTTTCGGCCCACTGAATGATTCTCCT
TAAAAAAAAAAACACTTTTCAAAACCCACATATCTGTGTTTGCCTTTGGAGAAAGAATTG
GATGACCCTGAGAGAGGAAAGATTTTTGTCTGCTCTGCCACCCCTAAGAACAAATCTATG
TTCTTCTTTTTGGGCCAAACCGGGCAAGGAGACATTTTCCAAATCACTTTGGAGACAGAC
GAAAACATGGGCGTATTTTAAGAAAGGATGTGATAACATTGTTATTTCTTGGAATTAATG
TTCATGATGAATGTGGTTGGCTGAGGCTTTCCTTGTGTCATCTTACATTTTAATGCTATC
TTCCTTCATTGAAGCTTATATTACTGGTTCATTCTCTTTTTAGATAGGATGGATAGAGAT
TTTCAGATTAGTAGAAGTTACTTGAAGTAGAGAGCTGCATTTCTCATTGGGCAGAAAGTG
ATGACATATAATCTCTCTCTTTTTTTTTAACCCTTACCTTCCATCTTGGAGTCAATACTG
TGTATTGGCTCCAAGGCAGAAGAGTGGTAAGGGTTAGGCAATGGGGTCAAGTGACTTGCC
CAGGGTCACACATCTGGGAAGTTTCTGAGGTCAGATTTGAACCCAGGACCTCCCATCTCT
AGGGAGCTGAGCTACCAAGCTGCCCCCTGACATATAATCTCTTAACTGTTCTTAATTTTA
TGGATGTGTGCCATGCAACAACTAGATAATTGTTCATTTCAGTATCCCAGTATTTTGGGT
GCTACTGATTTATTTTTATAAAACACACTTGACATATAAAACCCCAAATGGGCTCCTCAT
CTACTCTATTGATCCATTGTCTGCACAGCCACATTTCTGTTATCTCCTTTCAGGTTACTG
AGATCCGACTGAAGTATTTTGATACTGTTCCTGTGGCTGCTGCTATGTGTGTCCTCAAAA
CAGGCTTTCTCTTTGTGGCATCAGAATTTGGAAATCAGTGAGTAACCATTATCATAGTCA
ATCAGTTTTACTGTGGTTGATCTAGAAAGAGGAGAGGATAGAGTCAAGGGATTGCTAAGC
ATAGAAATGTGGGTGACTGTTCAGTTTTCTTTTTAGTCATCATTAATATGTAAATCACAA
AATCTAGTGGCCTTTTCTCTGTCTTTGTAGCATTTTGCCCTTACTACATACATAGTCCTC
TTTGAAACTTGTCCCTTGGCTTCTGAGGCATTGCATTGTCTTGGTAGTGCTACCACCTCT
CTGACTTATCTCCTTGAATCTTAATTTCTTTAACAGTGGGTATTCAGGATTCTGGCCTTT
AACAAGACTCTACTTTTTCTGAGCTTTCATTTACTCCCATACCGTTAACCTTTATGCTAA
CATTCCCCGGGTCTCTATCTTCTCTAATCCTCAATTTCATTCCTATTGTAATATTTCTAT
TAGGATGTCTTGTTGGCTCAGACATTTTTTGTTTTCTCATCTCCAGTTTTTATTTTCTCA
TCAATCTCTTCCAGCTTCAATATCTGTATTGCAGTGAGCTTTCTTTGCAGATCAATTCCA
CCTAACTTCCCTATTTCTGTGAATAACATGCCAGTTCTCTCCTAGTATAATCCAGTATCC
AAACCTTCACCCAAAATGCACAGGACAGTAAGAATAAGAGAGGACCCATTAGTGTTTTTT
CCCCTCTGTGTGAGGAAATTTACCCACCCCTTCTGGGTCACAAATATGACATCCCCTGGG
GACTGCCTGCATGTCTGGTTTCCCCTGCATATCAGTGTGCGACAACAGTATGGAGGGCAG
TGTATGAATGGTGAACAAGGAAGCAGTCAGTCACCCTGTTTTACTGTCATCTGGGTACTG
GCAGAAGGGGGACCTGCTACAGGATAAACATCCACATGGGAAAGTTAGATTAGGGTTCGT
TTTCTCTCTCTCTCTCTCTTGCTCTTTCTCTCGCATGGTCTTGCTCTCTTTCTCCTCCCC
CCTTTTCCCCTCCTTCCCCTTATTTACTTTTTTCCTACCTACCAATAAATCATAATAAAT
AATTCTGTGGACACTCATTTATATAAATACTTCCATTGCAGTGTACCCTTTGAACTGTTG
TCTTATCTCTAATCCATCCTGAATACAGACTTTGAAATTAATTTTCCAAAAGGAATCATT
CAGCCCAGAGTGTTGAGAAATAATTCCTGTTTTCTTATTGCTTAACAAAGAGTTACTGAA
GAGCCAGCCTGTCCTGAATACATCCTATATATGAGAGTTAGCTAGGAGTTTTTTCTGTTA
TACTAACCTAGAATTCAGGAATCTGGGATTTAATCCAGGCTTTGCCTCCTAATTATCTGT
TTGACTTTGGGGCTTGGTATTTGACTTAATTTGTCTCTGCTTGTGGATGCTAAGTGTGCT
TCATCTGTAGAATAAGGTTATTGTATGTTGCCATTGACTATTCTGGTTATCTGCTGTCAT
TATTTTCCCTTTCCTTTGTTGGTTTGTCCTTGAGCCAACCAGTACATTATACATTCATTA
GTCTGGCTGGGTAAATCAATCTTGTCGTTTATTAGGAACTTGAATTTACTGCATTGTTAA
ACCAGACCATTTGCCAATTCTCCATTCTAGGCTTTATTTTACAAAGTAATTTCATGTAAG
GTGAAAATTAGAGTAGAATGGGATTTTGGTCATACTTTGAATTTCATTTTTATTCAATTT
TACTAGGATGGTATATACCACGTTTATATAACCTGCATGTGTACATACCCTTTAAAGTTT
TCAGCATTTCCATCTCTATTACTCTGCTTTTCAAAAGAGTACTATGTTGGGGTAGACTCA
GTAAACTTCTTAGCTTTTCCCTATGCTTAATAATAAAAAAACGAATACTGATAAGAGAAC
TTTTGAAATTCCTCTTGATTCCATTGCAGTATGCTAACATTAATATAGGGTATTTCTGGA
GAAAGAATATTCTTCTTCCTATCCTCTGGCATGTGTCTTACCTGAAGTTTCACCACTTCT
TCCTCCACAGCTACCTGTATCAAATTGCCCATCTTGGTGATGATGATGAAGAACCAGAGT
TCTCATCTGCCATGCCCCTGGAAGAAGGAGACACATTCTTTTTCCAGCCTCGGCCTCTGA
AGAACTTAGTATTGGTTGATGAACTGGATAGTCTCTCTCCTATTCTGTTTTGTCAGGTGC
TGCTCAGTCCTTCTCCTCTGTCCTAGGGTTAGTGGGAGAAGCTCAGATGGTGGTGGACAT
TTTTTCTGGCTAGGTTGGGATATGTAAGTCTTTGATGAGTCTTTTCCTAAGGGGAAAGGA
CTATACATACTCTTCTAGGGAGTGTGGTGGTGTTTCTTTGAGGGACTTACATAGGGGAAT
ATGAGCCCTCATTTAAATCACTCTTTAAACTACTTGGGGGGATCATCTATAGGCTTTATT
GCTTCTAATGTATAAAAGCTTTTTGAGGGCAGACATTTTTTGCTTTTATACCTAGTTATC
TGCACAAATTGTAAAAATTTTTTTAATTGAAATGTCATTCCTTATATCAGAGAGATAGAC
AACAAAATGAGGAGTTTTAGTTCTCATAAGGATACTTCAAAAGTGGGGTTTTCTGCATTT
ATAATTAAAAGTCACAAATTCTAGTCAGGCCCTACTAAAATTACTAGAGCACAGCTAGTA
TGGCTACAGAACATTGATTTCTTTTTTGTCTCCTTTCTAAGAAGAGATCTGGAAAGAGTT
TCTACATTTTTTTTCATCAGACTTTTAAGTCTTTATTTTGAAAAAAGGACAGACCTGAGC
AAAAGAAAATGAAGCCAAGGACCACTGTTTTCCATTTAGCTAATTTTTTCTTTAGTGACT
TAGAGAAAATAATTGCTCCAAATTCACTTTGGGTTGCTTTTGTAGTTGAAGGAAATGAAT
GAAGATTTAATAAAGGAGGAAAGTACCTTAGTAAAATGTAGCACACCCTAGATTTAAGGG
AATTTCCCATAATCTCAGGTAATTGAGAATCTGCACAGGCAGACTTTGATTTTATACTTT
ATGTAAATTGACTAACTGAAGAATTTTGTGCTGTCCATAAAAAATTGAACATTTTCAGTG
AATGGCTCTCCTTTCATTCTAAAATGGATGTTGCCTTTTGGGTAGTGGGAAAGCCATATT
ATACTAGAGTCAAAGCATCAGTGTAGCTTCAGTTGAATCAGCTTGGCTCTATTTGATTTG
GGGTGACAGCTAAAGAAATGTGTCCTAACCCTCTTACTCTATGCAGATTGCGGATCTGGC
CAATGAAGACACCCCACAGCTATATGTAGCTTGTGGCAGGGGACCACGATCTTCTCTAAG
GGTTTTGAGGCATGGACTAGAGGTAAGGTTGGTTCCTTGATAGGGGATCATGGGATAATA
CTGAAGCAATAGGATATACTTTTACTTTGGTTGTAGTCAAGTGAATTAGGAATTGGTCTC
TTCATTGGTTTTATTTTTTTAATCCTTACCTTCTGTATTAGAATCAATACCTAGGTATCC
TCCAAGACAGAAGAATGGTTAAAGGCTAGACATTTCAGGTTAAGTGACTTACCCAGCTAG
AAAGTGTCTGAGGCCTTATTGTTTTAAAAAATGCTACTTTCCTGATGACTAATCTTTCCC
AGGCCAATCTTTATCATTCTTCTTGGAAAGGGTTATTTGAATTGATTTCGCTAATTCATT
AATAAGCAGCTAGGTGGCTAAGTGGATAGAGAGCCAGGCCTGGAGACAGGAGATTCTGGA
TTCAAATCTGGCCTCAGACACTTCCTAGCTGTGTGACCCCGGGCAGGTCAGTTGCCTAAC
CCCTACTGTTTTTCTGCTTTGGAACCAATATTTAGTGTCAGTTTTAACATGGAAGCTAAG
GGATTTTTTAATAAATGAAATCTACATATCTGTCAAGTTTTACTTTTTAGTATTTCAGAA
AAATTGAAATGTTGTTTCAAACATTGAATTGTTTGAAATTTGTACAAAATTGTACAAAAA
TTGAATTTATAAAACCCTTCATTAGTCTGCTGATTTTCATTGGTCTTAAGCATATTCTTC
TGTCAATGACACTTTTCTTTCAACATCTTTTATGTCCCTGGATATCATTATCACTTGGGA
TAGCCAGGTGGCACAGTGGATAGAGCTCTGAGCCTGGACCTGAGTTCAATTTTGGCTTCA
GACACTCATATGTGACCCTGAGCAAGTCACTTCACCCTCTTTGACTTGTTTTCTCACCTG
TCAGATGAGCTGAAGAAGGAAATGGCAAATCACTCCAGGATCTTTGCCAAGAAAACCCCA
CAACAGGGTCATGAAGAGTCAGACACTTCTAAAAAACAACTGAATGACAATAATATCATT
AGTCCCATATCTCATTTTGTCACTTCAGTTTATTTGCAGCTCTACAATCCTTTAATGCTC
ATGCATTTTAAACTTTAGCCTTTTTTGAATTGTCTGATGAGGGTACCAGCTTGGTGATGA
GATCTGATCCTGACTTAGCATTCTTGATGGCATTTCCCAAGGTCATTGGATTCTGAGCCA
CCCCTCTTATGTACTCCATGTATATATATTATATGTGAGGATGTGGGTCAGTTCTTGTGA
CATTGAGTGGACTTGGTCACATTACTGCTTAGTAGTTAGCTAACATGTGACATTGGAATA
TCACTGACACTTTTTTCTTGTAACTCTTAGACAGGGGACCTCTTGTTCCCATAGAAGTTA
GTAAAGCAGAGACTTTAAACCGAGAGAGAAATGGGAGGCACTAAGCCATACATAAAGATC
CTTTCAGCCTGCTGCCCATTGACTTAAGAAAACCACATATTAAATATATGTTTTAATAAT
ACATCCCATTTAGATGAAATAGGAATTGCATTTTAATCTGGTTCAACGCTGGACAGTGTT
GTCAACCTCAACTCAGCCTATGGTACTGGATACCTGATAGAGTAAATTAAAGACCATTTA
TTTGCTTCATTTAATTTTTGAAAGAGCCATAATCCTCATGTTTTATGCCCTCAGGATTTA
TTTCCATCAGTGTTTCTCCTCAGTCCTCATAGATATTCTGAGTTGCTTTTGCCTGGTTGC
TGAACTTATAGTAATGAACCTCTGAATGTAGCTACTTTGGTTTTATCTCATAGACATAAA
ATGTGTGATCAGGCTTAGATTAAAAACCTTCCTATCTTAGTTGACCCTTGTATAATGTGC
AGTCTCTTGATGGCCTTTTAGAAGCCAGGTCTTCCTTTAATTCAGGATGATGAGGGAAAA
CAGAATAGATACTATTCATCTGTGTTACATTTGAGCAGAGCAATAATGAATGAGTGGGTG
GAAACCACAATAAGATTACTCACTCTCTTGGGTTTTCGGTGTGCCCTTTGTACTTTGACA
TTGCTTGTATTCTTGGAAGAGAGCCTTTAGAGTTGATCTTGGGTGTTTGCTGTCTAGTCA
GTTGGTAGCAGGATTGTCCTCCTGGTAGTCTCATTCTTGGTCTCCTTCTGCCAGGTGTCA
GAAATGGCTGTCTCAGAGTTGCCTGGCAACCCCAATGCTGTCTGGACTGTACGGCGGCAT
ATTGAAGGTAGGTAACTTTTTCCCAATATCCAAGTACTCTCCCTTGTGCAAAGGCCCACA
ACCTTAGAAGGCTGCAGTCATGATGCTTCTGATTGTCACTTGACCCAGCATCAGCTATAG
TTGTTGATGTCTGATGTAATCTGACATTTCTATCTCAAGGCAGCTCCAAGTAATTGGGAG
TTTTCCTAGGCAAGATGCTCTCTAATGTCTAGGAAGAGAGTTGCTCCCGTTACAGCATAG
AGTAATGTAGGATGTTACTCATTGTCCCAGATTATGTTCCCTGCAAGGATAGGTCCCCCA
GGTTCCTATGAATTATGCCACAGTGTATTTCCCTTTAAGTCAGATTTCAGCATCAAGGCA
GTAGTTGCACTGCTCATTCCTGAATTGATTGCCATTATTTGGTCATATAAAACCAAAATG
TGTCTGATAGACATTAGTGACTTGCCAAGTGGGAGGTGCTCCCAAGAATCTCTTCTGCCC
AGCAGCAGTAATTATGTTTGAGGAAACCAGGCCCTGAGCAAGATATCCTGCTGAGACTGA
GGAAAGAGAGCTGATGGTTTGGCTGAAAACTGAGTGCCCTACAAGGAGGTGTGCTTCCCC
ATTACCATTTACTGAGAGGGCAAACATAAAGGAGGAGGCAGTAGCATTGGAAGGGCCTGC
TCCCGGGAGTTTCTAACCACAGGCAAGAAAACCCAACTCTGCCTTGGATTTCCTTTGTCA
CCCATCTGTTCTCTCTAGCTTTCCCTAATGGACCCCTTCATGGGAATACTGTCCTAAGGG
ATGAATGAGGTAGAATTCTTTGAGGGTTTGTTCCTTTTGTGGAGAGAGGACAAATGCAAG
GCAGCATAATGTAGTGGCATGAATTTAACTTGGCATTAGAAGAACTCAATTGTGAGCCTC
AGCTGTGCCCCTTGGTCACTCTTGGAAGGAGCAAATGGCATCCTCTCTGAGTTTGTCTCT
ACATCTCTGCACAAAGAGAATGCTGCATGCACTATGTCTTCCTCTGGGTTTTCATGAGGA
AAACACTTAGATGCTGCTTGCCTGGAGGGAGGGCATTTCCATTTTCTATGGCTGGTTTCA
GAGTGTATTGTTCTGTTGCTCCCTTGGCTACTTTATGTAGATAAAATAAGAAATTGCTTG
TAACATTAAAGCAACAGGACCTGGGTGAATTACTCTGGTAATTCTCAAAATTCCTAAGGA
ATTTTAAAAACTATTCTCATGGTGTTTATGCTGTCCCTAGAAGAGAATTCAGGCAACAAC
AAAATTCACTCCTTTGACATGGTGACTTTCTGGTCTTGCAGGTTTTCTGAAAAGTACAAT
GTGAGAGATTGTACCATTTGACCTGACCCAGGTCCCTAAGATGTGAGGATTTATAGAAGG
GCATTAGTTAAGATAAATTTGGACAAGATTGCAGGTCCCAAGTTCTCCCTCAGTAAATGA
TGTAGGAAGTTCTAATTGCTTCCTGCTTGTGACAAGGCCAGACCCCAGTTTATTCATGCA
CTCATTTCTTCAATAAATATTTTAGTGTGTCCAGGCCTCTCTGGTAGGAACCATGGAACT
TAGAAATATGAATGAGACCTAGACCCTCCTCTTACAAGGAATCAAGAATCCACTGGGGGA
AATAAGCCAGTGTGTAACCCTGGGCCATATGTGATACCTACCAGAAAAGAAGTCCTGAGA
GCTCTGATCAGACTCACACAGAGGCCTGAGAGAGAAAACCGGGGTGTGGGATCATCATCT
ACTCTCAGCTGAAAACCCAAAATGAAACCAAGTTTTACCCACATCGGCTCTTTTTCTCCT
GAAACCCCAGGTTGTAGTTGTGTTGCTGTTGCTGTTGAGTGACCTTTCCTTCTCTTGCCA
CATGCTGCAGTCTTCATGGCAAATACTAACTTTGGCTGGTACTTGGTGATACACACTACC
AATACCGAGCCTTTTTTTCTCTTCCACAGGTGGCTGGTGGAGGTGCTGATCACCACAGGT
GTGTACCTACGGCTAGGGTCTACTGTGGGGTCTCACATGTTCCCCAGGGAGAGGAACATG
CAAACAGTATTGGAGCTGCCCTGGCAGCAGAGCAGCTCCCAGAAAGTGACTGCAGCTGGA
CATCCGTCTGTGCTGTAGCAACACTGTGGACCCTCCTGCCCAGACCTTCAGTGGTCAGAG
GCAGAAATTAGTTGCCTTCTACTTCCCCCTTCTACCACAGCTTTTAGGGACCATGACTCA
CTCATCTGCTTCTCAGACTCTGAAAAGCCTCTAGAAAACATCAGGTTTAGTCTTCCTTTG
TATTTGGCACAGACTAATGGATTTGTCTCCAGGGGAGGAGGCTTATTGAGTGTATCAGGA
ACTCAGTTGAGGCAAAGGAAGAAAGTGCCACATGATAGTAGATGATTTAATTGAAAAGCA
AAATGTGCAATTGAGGTAGTAGTTCAAGAGGGTGGGAGGGGTTTGGGTATTGAACCATCT
AGAGATGGTTATTTTCATTCTTGTCTTTGCTATTCTGAGTTGAGCTGAGGCGGCAGGTCA
CAGGGCCTGAGTTGTGAGCATCTCCTGTTGGAAGTGTTTCCACAGTAGTTAGTTGCTCCT
ACAGCTCAGAAAAAGACCTAAGTCTTTTCTATTCGTGTGATAAACAGTCAGAATCTGGGC
AGGGAGTTGGCAGATGATCCTAAATGTCTTACTGTGGTGCTTGAGTTTTCCCTTTAAGGG
TCAGTGACAGTAAATTCTAATATGGGAGGTAGAAGTTTACCTGAGCCCATGAACCATACA
GGTGATCAGATTTCATTGGTTAATGTTAATCCCATCAAGCAAGGTAACAAATATTCAGGC
ATTTCTGGTCAGCTGTTATGAGTAAAGCCAGCTCTTTTAAAAAAATTTTAACTGTTACTT
TGTAACCTCTGAGGGTAGGGGGCTGTAATGGCCCTTCCTGGCTGCAGTTCAGAGTTGGAG
GGAGGGGGACATCTAAGATGTTCCACAAGGCCTTCAATTTAAGGAATGTGGAGGGGGGAC
TCTTTTGAAGTGATGGGGGACAGCAGTTGTCTCTGTTTCAAGACCAATTAAAAGTCCTCA
GCTCAATGAATTTACTATTGGGAGTATAAAGGCTGGGCAGTAGCAGCACAACCAACCATC
TCATCCTGATCTGCAGCATGAGACCTCAGTCTTGGGAGCCAGGCTTCTGATCCTATGGTT
AGCCCTTAGTGGTCTTTGTCCTCTCTGCAACAAAGATGCAGGCCCTTTTACTTTCATGGA
ATGGACTTTACTAAGTTGAGTCACATGATGAGAAATCCTGCCCAATTAGAGATCTTTAAT
TTCTTTCATTACCTTGTACATACTGCTCGTTTGGGATTAACTGCCATTAATGGGGGAACT
AGAAAAAAGAAACTGCCAATCTTGTTTTTAATTAAGCCATTCCAAGTATATACCAGAGCT
TTTAAAAGTGTGCCAGGAAACTTAGCCCAAAGAATTCTCAAGGTTTATATATAGCCAGGT
TCATCAAGCATATGCTAAATAGAGTTGGGTTTTGAATGTGTCCTTTGCTTTTAGAATCAG
AATGGAGGAAAATCCTATCCTTCTTTATAAGACATTTAATACTTGGTCTTGTGAAGCTCC
TTTTGAAGCTCTCAAAGCACTTGGCATTTATCTCCACTTAAATCAGAGGTACTGAAAAGC
AATTATTTGTCAAAGGCAATTCACTCTTACTGCCCAGTTAGAAATTAAGCCTGTAGATTC
CTAATCTAACCACAAGACAATACCCTCAGGGAAATAGACTTAAATTTCCCTTTAATTGTG
GCTGATGATTCGGAGTTATCTAATAGAATATTTGTAGATTTTTTTGTACGAATAATTTGT
GGGAGAGAGCTCTGTCATTTTTCCCCTACTAGTTATCTGCCAAATATATATATGTATATG
TATATAGAATATAGAACTGGAAGGACCCTAGGGATCATAGAGCCCCAATTTCCTCATTTT
ACCAATTAGGGAGCCAAATTCTAGAAAAGGTAAGCAGTCTGTCTGACTTCTCACAGATAG
TAAGTGGTAGAAACAAGTAGCCTCTTATTCCAAGTCCAGTGCTCTAATCAGTGCATCACA
TTGTCTTTTGAGCTGTTGGAGTAATCTTAGTTCAGGTGACATGAACAGAGTGCCACAAGA
CCAGAGTTGTGGGGTGGTACCTTCATGACTCAGTTAACTTCATAGAAAAAATTGTCTAGC
TGGCCATGTCAGAAGTGTTCGTTGTTGATTATAAAGTAGATTGGACAATAGTGTAGATGG
CTCAGTGAGGTCCTTCATCATTGATGGGAAAACTATTGTAAGTATATGTACTGTTAGTAC
CGTCATCTTCAAATATGCAAAACAGGAAAGTGGTCCAGATTATGCTTTAACCAACTTCTG
CTTTAGTTATTAACCAGCTACTCTTAATAACAGTTGAGGAGAAGACCTTTCTGTTTTATT
CCCTCCATTCCCCTCCCTTCAGTGTTCTCTCTTAATTTACCTATTGAAAGGATAAGGTCC
AAAATTTACTTGAGAAAAAGAAAAATTTAACTGTTATTTAAAAGAAAAATCTTTCTTTTG
TACAGAATTGCTTAGCTTCTATTTTTTAAGTTACATAGAGCTGAAAGTGTGGGAAACCAG
TGGCCTGTAACTACTGGATTTGCCTGAGGGAGCATTTCCTTGGAGTATGTGTGTACCTAA
AGGTCTTTGACCTCCTGATGAGTCTCATTAGTGTTTGTTTATCCAACTGCATTTCATTAA
AGGAAAGTTGTGTCCTGATAGGCTTGGTCTGGGCCAATAGGTCATTGTTCTTTTAATAAT
GAAAAATCCTCATTTTATTTCCCAGAGAGGTCAAGGACTAAACAGTACAAATTCCTTCCC
TGACCCCAGTCAGCCAGTGTTTGCCATGTCATTCCTACTGGAAGATACTGGTAGTCTTTT
TCATTACTGGATTATTTATTCTCGTCTATCCTTTGGAGTTTGAGTTCTCATGAAATAGTC
TTAGATTCTGTTGGGAGAAGCAATTTGGAATCCTTTTTGGATCTTTACAGTTTCTCCTTT
TGAATGAGCTCTTACTTGGGAGCCAATAAAAAGACAAACCTGGCTATATTGAATGAAAAG
TGAGTTGCTTTATGGTTTCCTTAAGCCACTGTTGCTCTTTTCTCCCTAGAGCCCTACATC
AACATTAAGCAGCCACATCTGGGGATGTGGGTTCTCAGTGGCTTTGGTGGCAAGTGGCAA
CAAGTTTGTCCTTAGAATGCCTTTAGGCTCAGACAAAGAACTGGGTTAATTTGGAAGCAA
GTTTTTCCCAGATTCTTGAGTGTTTTAGGCATAGTCTCCATCATTCTGGTCTGCTCCTGG
CTCATCCTGTGTTATTTAATATTTTAATTGTGTGCTGATGACCACAGATGCTAAGAGCTG
TGCTCTTGACAGGTTGCTGGAAGAGGAGCTCTTTACCTTGTGTATGTATTCATTTGGGGT
TCCAAATCTTGATTGTCCCAAACTAACCAGCTCCTCTCTTCCCTCTCCTTCCTTCCTTAG
ATGAATTTGATGCGTACATCATTGTGTCTTTCGTGAATGCCACCCTGGTACTATCTATTG
GAGAGACTGTAGAAGAAGTGACAGACTCCGGTTTCCTGGGTACCACTCCAACCTTGTCCT
GTTCCTTGTTAGGGGATGATGCTTTGGTGCAGGTGAGGGAACTTTTAGGGCAAGTCATCT
TACTCTGGCTCCTTGTCACTCTTATTTTGGGCACAGTCTTTGCTGGCCCAAAAAAGTATA
CAGTATCAAATCTAAACTGAGATTTTAATTACTCCTGTAGATTTTAGACCAAGAGTTTTT
CTCTAGACTTCATTTATTCTCAGGAGAACTTTGTAAGAATGTATGAGGTAATTAGATTTG
AATATCTCAACTTGGGAACGCAAAGCAAACTTTTTAAACAGTGGCTTCATCTGGGGCCTA
GGAGCCCTGTTTTTATAACCTTAGAAGTTACCGGCCTAAGTTGGTTGCCCTGGGGTTGGG
GATTGTTTTGGGCAACGGCCAGAGTAACTCTAAAATGAGTCTCCCTTTTGCTTTTGCTTT
TGCTCTTGCTCTAGGTATATCCAGATGGCATCCGGCACATCCGAGCAGATAAGAGAGTAA
ATGAGTGGAAGACCCCAGGAAAGAAAACTATTGTGAAGTGTGCAGTAAACCAGCGGCAGG
TGGTGATCGCCCTGACAGGAGGAGAGCTAGTCTACTTTGAGATGGATCCCGTATGTTGCT
TTAACACTGTCATATATTTTCCCAAATAGAACTTAGTGTTTGGTGTGGGGGCTGCTGTTA
CTGTGTTCCAGGCAGCTTAGGGATATGGCCACAAGAAAAGAGAACATGGGATGACAAGTG
GCTAGAACCCCACTAATCTGAATCCCTCCCTGGTCAAAAAGTTTCTACTTATATCTTTTA
GGAATGCAAAGTAAAATGTGAAACTTTCATTTGGTTCTCAACAGCTTTAGAGAATTCGGC
ACATTTTATAGCCTAATGCTATATTTTTCTTGAGTTTGAGTTTTTCCCTCTTTACTCAAA
TACATGTACCTTTTGTAATGGTGCAGATTTAATTTCTGTGGTCTTGGCATCACTTGCTTT
TCCCAAAAGGAGGGATGTTGTAATTATTACTTCCTTCAAGAATTGCAGTCTGTGGGTATG
GCTACTTCATAGTATATATATTATTATATTTGCCTTTAAATCTTTTTCTAATTTTCTTTA
AAAATCAAGTCTTGTAATTATTGATTGTTGTGCCTACAGGTTGATACTTCTTTGTCTTAG
GTCCCCAAACTTGTATGCTTTTTGAGACCCAGAATACTCTCGAACTGATTGGTGTCCATT
TTTGGTTCTGAAAGTTGAATGACTTTCAAAGTGCTTGAACCTAATGTCAGTGGATAAAAC
TTGATGAGTGTCCTAATGACCCCAAGTCACTGTGCTGATGAAGTTTTATCCATGGTTATG
ACTAGAATGGTTCTATATGTAGGTAGTGAGAGTGTCATGTCATTATGTCTGTAGTCAGGA
CAGCTGAATGAGTACACGGAGCGAAAGGAGATGTCTGCAGATGTGGTATGCATGAGTTTG
GCCAATGTACCTCCTGGGGAGCAACGTTCTCGTTTCCTGGCTGTGGGCCTGGTAGACAAT
ACTGTTCGGATCATCTCTTTGGACCCTTCGGTGAGTGATTTCCATAATATCTCTAGGGTA
GATTCCAGATTGACTAAAGGGATCACCCAGAATGTGAATTTCCCTTAGGGGTGCAAACTT
TTCTTGGGTCCAGTGTGGGGTGGATTGTGGGAATCCTTGCATGCTATCAGTTACATTGAT
ATGGGGTAGAGATAATTTCATTGATGGCTTCCTTGTTAACCAAGCTCCATTCAGATTGCT
TTTGACAGGTGGCTTGGAGTCTGTATCTTAGTAAGAAATTGGGAAGGTTGCATGTCCTTA
GCACCCTCATATTGGTCAACTTGACCACCATTCTTTTTTTCCCCCCCAGAAAGAAGGTAG
GAAGGCTCCCCTAGTGCTCAGGGCTTCAGGCTTTCTCTAGACATGGGCCCTTCTTGATTG
TGTCTTCCTAAGTGAGTTATTCCTTTCCATCTTTTTGTAGGACTGCCTCCAGCCACTGAG
CATGCAAGCCCTCCCTGCCCAGCCAGAATCACTCTGTATTGTCGAGATGGGTGGAGCTGA
AAAGCAAGATGAGCTGGGAGAAAGGGGCTCCATTGGCTTCCTCTATCTAAACATTGGGCT
TCAGGTAAGGGGCTGGAAAGAACTTGTCTGAGTGAACATTGTGTAAGTTCTCTTACTGTC
TCCAGTGACTCATCATTGAAGTGGTTGGGGAACCTTAGGTCATAAATTAGGAGAACTCTC
TTGTGGATTCCCTATACTGGTCTCCAGCTAGTCTGTTAAGAGTAGATCTGGAAAGAGACT
ACTGGCACAGGTTGCATGCAGGCTCACATTCAAGTGGTTTGGCACTCCATTAAGAGCAAT
CCACGGGAAATGTTTGTGGGTCATTCTCTTCAGGTTAAAGTAAAGGGCTGTGATCCAGAG
TTCCCACACTAGCATTTGGGGCCAGGACCCCCAGGTTGTGGATATGCTGTTGTAAACTAG
TAGTTCTCAAAATGTGTAGGAAGGGAGATGCCTCCAGGGGAGGCAGCAGAAGCTTCAGAA
AGCACAATGCTGTGCTATTATTTATTGACTGTACTTTGCATTTTTATTAAATTGCCCAAA
AGATTTTAAAAATTAATTGGTTAGCTTCCTCTTAACTTTAACAAGGGCCACAGTCTGTCA
GCTGGGTGCAGATGTTTGAGCAGGAAGAAAAGAGCTTATGTCTTCACCCTTGAAGGGCTA
TTTTCTCCTTTAGAGTTTTTCCAAAGTGAGGCTAGAGTCTGCAGAGGAACTTTCTCAAAA
TGAGTTTTTTTTGTGTCACCATAAATCACTTAAGGTATATTTTGCCTTTTCTCTGCCCTT
CCATTTAGAATGGTGTGCTCTTAAGGACTGTTCTAGACCCCGTCACTGGTGATCTATCTG
ACACCCGTACAAGATACCTGGGTTCTCGCCCTGTGAAGCTTTTCCGAGTCCGGATGCAGG
GCCAGGAAGCGGTAAGTGAAGTAGGAATCTGCCACCAGAAAAGGGGACCATGAGAAATAG
GGGAAGGTGAGAGAATACTTGCACCCTCTGAGAATGCCCCATATCCTGCTCTATGGGCAT
AGAACTGGTATGTAGTAGCATTTGTCTCCAGCCCGCTCCTTTATATGAGAAAGACACAGG
GCTCTTAAGCCTACGTGTTTTCCATAGGACTCTTTCCCCTTCTGCTTTTGTACATTCTTC
AAGGTTTTATAAAATTACATAGGCAATTCTACTACTATCTTCTGCATGAGCAGCTCAGAC
ATTTAGAGTGAAGTTCATAGCAATTTAGACTGATTTTAAATCTGTCTGGCACTCAGTGGA
CACTTTGTTTATTCAGGTTTTGGCTATGTCAAGCCGCTCTTGGCTGAGCTATTCTTACCA
GTCTCGATTTCACTTGACTCCCCTGTCCTATGAGACCCTGGAGTTTGCATCTGGATTCGC
ATCTGAACAGTGTCCTGAGGGCATTGTGGCCATCTCCACCAACACTTTAAGGTGAGTTTT
GCAATCCAGCAGTGCTGAAGAAGTCATTAACCAAAATACTGGTATTTTGGTCAGAAGGTG
TTATCAAGGGATACAGAAACCCTTATAGCCTTGCCTCTTGTGTCCTGGAGCCAAATTTCA
GTGGTTAACAAGGCAGTCCATTCCTTTGGGGATCAGATGATGGCTCCTTATTGCCGGGTG
AATAAGGGCCCAGCTGTAGCATGGTGTAAAGCCGTCTACATCTAGCCTGCCCATCTTTCA
GCTCATCTGCATGCTCCCTTTTGTAAACACTGACCATTAAAAGTAGAGTGGTGTCTGTCC
CCTGAACTTGCTGGGATTTTTGGCCTTCAACATAGGAATGCCAATTCTACCTAGCTCTAA
AGGCTCAGCTCAAACCTCCTTCCTGCAGCTTTTCCATATTTCTCTCGTCAGAAAGAATCT
CCATATTAAACTCCTGTAACCAGTCATACAGCATGTATCTCCCTTTGTTATATTCATATA
GATATCCTCTTCTCATTAGTTCCTATGCACTTTGAAGAGAAATTTCTTATATTTCTATCC
CCAAAGCACTTCATATAGATTCTTACATGTAGTTGATACTTATTTTTATTGAAAGGACCC
ATAAGTAGTTTATGCATGTTTGGACATTTTTCTCTTACTTGGGACATGTCATTAGAAACT
GATAGCAACAATTGAGAGAGTGAGTCTTGAGTTTGTTCTTGTTCTTTATTAAATTGTATT
TTTTCAATTACATGTAGAAACAGTTTTTGAGAATTGTTTTCTGATATTTTGTGATTCAGA
TTCTTTCCCTTTCTCCAAGGCAGTAAATAGTCTAATCTAGGTTATGTCAGTGTTTTCATG
CAATTCATATTTCCATATTCCCCTTGCTGTGACTGAAGCCACATATACATACAAGGAAAA
ATTCACGAAGTTAATAAAGGGTTGGTGTGCTTGATCTGCAATCAGATTCCCAATGGATAG
CATTTTTTAATACTGAGTCACTTGGGGTTATCCTGACAATGTGCTGAGAGTACTTTGACC
ATTGTATAGTATTTCTGTTGCCATATAAACTTTGTATTAGTTCATATATAGTTCTTTCCC
CATTTTTCTGCATGGATCCTGTAGTACAATAATTTTCCATTTCAACTATATACCACAGGT
TACTCCCTCGGTTTCCAGTTTTTTGCCACTACAAAAAGCTGCCAAAAAGAATTGTTTTTA
TTTTTTAAAATCCTTACCTTCCTTAGAATCAATACTGTGTGTTGGTTCTAAGGTAGAAGA
ATGGTAAGGGCTAGGCAATGGGGGTTAAGTGACTTAACGCAGGGTCAAACAATTAGGAAG
TATCTGAGGCCAGATTTGAACCTACGTCCTCCCATCTCTAGGCCTAGTTCTCAGTCCACT
GAGCCACCCAGCTGCCCCCTATATAAAATTCTTAAAAAACATTTTTATTTTATAATACAT
ATTGTCTCTCCCTGCTTCCCGGAGATGGCAAGCAGTTCAGTCTAGTTTATACATGTATTA
CTACACAAAACATGTTTCCATATTATTCATTTTTTTAATGACCGTATAAAATCAAAACCC
CTAAAACATATGCCCAAATAAACAAGTGATAAATCATTTACTCCATCTGCATTCTTACTC
CCAACAGTATCTTCTCCAGTGGTGGATAGCATTCTTTTCCCCGTAGTCATCAGAAATCTC
TGCATCGATGTATTGCTGTTTGTAGCAAAATGTCACATTTGATTTTTCCACAATATAGCT
GTTGTTGTTACTGCGTACAGTATTTTCCTGTTTCTGCTTATTTCATTCTGCATCAGTTCA
TGTAGGTCTTTCCAGCTCTCATATTATCTTGTTCATTCCTTATAGCACAGTAGTATTCCA
TCACCATCATATACCAAAATTTGTTCAGCCATTCTCCAGTTGAGGGATAACTGTTTAGTT
TCCAATTCTTTGCCACCACAGAGAGTAGCTATAAATATTTTTGTACAAATAGATCCTTTC
CCCTTTTTAAAAATCTTAATATCCCACAATTTGGGATATAGATCTACTCCTGATGTTATG
GACTCAAAGGGTAGGCATTAGTCCTTTGAGCATAATTCCAAATTGCCCTCCAGAATGGTT
GGATCAGTTCACAGATCCACCAGCAATGCATGTAGTATCCCAATTTTTGCCACAATCCCT
TCATTTATCATTTTCCTTTTCTGTCATATTGGCCAATCTGATAGATATGAGGGTGGTACC
TGAGTATTTCCCTAATCAAGAGTGATTTAGAACTTTTTTTCACATCATTGATAGCTTTCT
TTATCCAAAAAATGCCTATTCATACCCTTTGACCATTTATGAATTGGGGAATGACTTACA
TTAGTTTGGCTTACCCATGAGCTATTAATGTTTTTCCAGTTGTTCAGATCTAACTTTTAT
TTGTGTGAAAAGTGTTTTGTAATTGTTTTTATATTATTCCTGCATTTGTCTTGGTAAATA
GATTCCCAAGTATTTTATATTATCTGGAGTGATTTTAAATGGCATTTCTCTTCCTAACTA
TAGTTGCTGGGCTTTGTTGGAAATATATAGAAATGTTAATGATTTATGTGGATCCTGCAA
CTTTGCTAAAGTTATTTCAGCTAGCTTTTTAGCTGATTTTCTAGGATTCCCTTAAGTATA
CCATCATATCATCTGTAAAGAGTGGTAGTTTAGTTTCCTTATTGTCTACTTTAATTTCTT
CAATTTCTTTTTCTTCAATTGCTAAAGGTAGCAATTCTAGTACAATATTGAATAATAGTG
GTGATAATGGGCATCCTTATTCACTCCTAATCTTAACTGGGGAGTCCTCTAACTTATACC
CTTTGCAGATGATACTTGCTGATGGTTTTAAATAAATACTAATTATTTTAAGGAAAGGCC
CTTTTATTCCTATTCTTTCTAGTGTTTTTAGTAGGGATGAGTTGTATTATGTCAGCCTTT
TTCTGCATCTATTAAGAGAAGCATGTGATTTCTGTTATTTTGATTATTGATGTGGTCAAT
TATACTTATAGTTTTCCTAATATTAAACCAGCCTTGCATTTCCAGTATAAATAACACCTA
GTCTTAGTGAATAATCCTTGTGATATGTTGCGTGTAATCTTTTTGCTTCAGTGTTCATTA
GGGAAATTGATCCATAATTTTCTTTCTGTTTTTGGTCTTCCTGGCTTAGATATCACCACC
ATATTTGTCATAAAAAGAATTGGTAGGACTCCTTTGTTTATTTTACCAAATAGTTTGTAT
AATATTGGGATTAATTGTTCTTTAAATGTTTGACAGAATTCACTTGTGAATCCATCTGGC
ACTGGGGATTTTAGGGAGTTCATTGAAGACTTGTTCAATTTCTTTTTCTGACGTGGGATT
AAGTATTATTTCCTTTTTTGTTAATCTAGGCAATTTATATTTTTGTAAATATTCATCCAT
TTCAAACTAGATTATCTCCACTGTGCTTTCAAAAGTGTAAAGATTAAAATTAGGGAATAT
GGGGAGATTGAGGCAGGTAGAAATTTGTTTCTCTCTGCAAGGAGTATTAAATTTTTTAGA
GGTTTATTAAGGATTAAAGAATATACAAGTAAGAAACATGTGCCTAAGCCAGAGGCCTAG
ACAGAATAACCTCACATCATGGAAGAGATGCCTCTGCTCCAAAAGGGAAGTCCCAAAAAA
AGCGAGAGAGCCCTCAAAAGCCTTTGAATCAGCTTAAATACCTTCTCGATCTTGGCCTAG
GTGAGATTACAAGGCATTCTGGGGAAGTGGAGCAAAGGCTCGTGGGGATTATAGTCCTGT
ATTCGAGTCTATTTTTTACAAAAGGATGGTGGTATGACAGGTCATTTCTCTTCCTTCTGT
GCCAGCTCTTCAATGGGTCAGAAGACTTAAGAACACACAAGAAGATGGCTTTGGGGATTG
GTTGACAGTATTGTTAAAATTAACTTTATTAAGTCATTGGGAGAGGAAGAGATAGCTCAA
ATTTGGAAATTCAGGGATTCCTATTGAAATTGTAACTTTAAAAAAGACTAGGGGTGGAGT
TAATACTTATAGAGAAGGTACAAGTACCCATTTAATTTCTAACAAATTACTCTTCCCCAA
AGCAATGATATAATGCCTCAAAATGGATTCTGCAGCAGCACAACCTACAAAAAGGCCAGG
TGAAGTGATTTTTCAACCCAAAACAATTTAGAAGGTCAGCACAAGGAATCTAGTGCACCA
GGGTGGAGATGTACATAGGCAACATAGGTACATAGGCAAACTTTGAAGCATAGCTTAAGC
AGTAGCAAAGTCTTCTGACTCTCAGTCACAGATATTAAGGGAGGTGGTTTTGCTGGCTCT
GCTTGCAAGACTCTTGTCGCATTGCTCATTCTCAGAACCAAGTTGTATTCCTAGGGTGCA
TTTACAGGGTGAGAAAGACAACCAGCATTTGTAGCCACAGTGTAGCAGGAGACCCTTGTC
AGAGTTCCAAGGGATAAAAGAGGACTTGAGGATATTCATTCTAGAGCACAGACCTGGAGA
GTATCAAGTTCATCTCCTTAATATCATACCACCTTGGAAGAACTGAAAGCAAATAGGTCC
CCAGGTCCAGCAGAATAACCTGAAGTTTTGAAACAGTATTTCACCACAATTATAGAGCTC
AACTTTAATAGTTTTTTAAACTAAAAGAAAAGAAAAGGTCAGGAAAATGAGCAAAGAACA
AAAAAAGAAAGACACTCACCTTGGAAAGTTATTTTGGTGACAGGGTAGACTCAAACCTGG
AAAGTTTGGACAGGAATGCATTGGAGGAGTTGTGAACTGATGCATTTATTCAGAAGAACA
ATATGGACCAATGCCCAAAGGGATATAACAGTCCAAACCCTTTGACCCAGCAATGCCTTT
TAACTAGGTTTGTATCCGAAAGTTTGAAAAGAGGAAGGACCTGTATATACAAGTATATTT
AAAGCAGCTCTTTTTACGGGAGCACAATTGGAAAGTGAGTATACCCATCAATTGTATACC
TAAAAATGGCTAAGTTACAGTATATGATTGTAATGGAATATTATTGTGCTATAAGAAATG
ACAAGGAGAAACTTGGAAAAACCTGAAAAGATTTACATGAACTGAAGCAAGAATACAGAA
CTAAGAATACTTACAATGAATAACTGAATAAGAGCTATACTCAACAATATAGTGATCCAA
AACTGTCCCATGGACTCATGGTAAAAAATGCCATCTAAATCCAGAACAAAGGAAATTTTT
TTCACTTTATAAATTTTTCATTTCACAAAAGGATTAATAATGAAAAATGTTTTGCATGAT
TGCACATGTAAAATCTATTTTGAGTTTGCTCACCATCTTAAGGGGATGGGGGAGAGGGAA
GGAGGGAGAAATGTTGAGATTCAGTATTTAAATGTTGGAAATATTTTCCATGTAATTGGG
AAAAAATAAAAAATTTTAAATAAAGAAATTATAACTGTACAAGAAGGAATGCGGGAATAA
GATCTTTTGAGGAATCATTTGATTAGAGAAAAATCCACTGGCTTGATCTGTAAACATATT
AGTGGTAGAATTTTTTTGTATATATTTTTGCATGCTGCTGCTACGCATCCAGATAAAACT
GACAATCCTCATTAAATGGGGTTGTTCAGTTCTCTTTTGATACCTTTGAATTATGCTCAC
ACATGCACACACACACACACACACACACCTTAGAAACAGTATTTCTCAGCTCTATTTGAG
ATTCAGAAGTAGCTGATTCCAGTTTAGGACAGAGCAAAGGTTTGGATATTTGGAGCAGTA
TGTGAGATTTAAAATGGTTGAGGTCTTAAACTGTAGTGGTTAAAATAGTGGAAGATATAA
ATTGTGATAGATATAAGAGAGGGTAAGTTTGACCACAGAAATATGTTTCACTACAGTGTC
TTGGGTTTAAAATCAAATATAAGGTGGTCGACAGAAAAATATTCCCAATTATTCAAATAC
CCAAGTCAATTGGGTTTTATAGAGATTTTAATTAACAATACAATGAGTAATCAGAGAGAG
AGAGAGAGTAAGAAAGGAATAAGTATGAAGGGCCTCAAGCCAATATGGCCTAGACCTGAG
CCTTAAGAGAGGAATCAGTCAGTTTTTTTACACTCACCACAAGGTCTGACTAAACAAGGA
TTTTAGTAACACCAGGCCAGCGTCCTTCCTCAAAGAGTCTTCCAGCCAGAGATTGTTTCA
AAGGGCCTCTCTCAAGAGCCTCCAGAGCTCCTACCCCAGAGGGACAGAGCCCCTCAGAGG
AGCTCCTCAAGGAGCTCTCCTTCAGAATGAGAGTCAGAAATCGAGATCCTCAGAATGAGT
CTTCTCAAACTGAGCTCCCTCAGAATCAGCCCCAGCTCTTCTCTGAGCTCTTATTTTTAA
GGGCAAAATCTCCTATGTCACCTCCCCTAAGTCCTTACATCTACCAATCACTGTAGATGT
TTCTAAAGGACCGCCCATTTTGAATTCACAGCTGAGTAGTTTTAATCTCTTTAGTAAGTC
AGAAAAAAAATGCTGCTGTGTCAACAAATTTCATTAGAAAAATCCTCTGAATAAGTTATC
ACCCTTTTAGGTTTAAGTAGTTTACAAGTTGCCCCACCTTTATAGGTACTTAGTATCCCA
TTGTATCAATTCTAAAACAGTCATGACTCAAAAACTTCCTGTCCCTTCCATAAGCATGGA
TCAAAGTACTTTTCATTGTTCTCAAGGAGCTCTCTGTCCTAAAGCAGTCCTAAGTAGGGT
GGAGTAGGGATATTCCCAAGGCAAGGAGTCCCCACACTCAAGTAGAGTTTTCACCATCTG
CTAGGGAATTTTTTTAAGTAGAAGATTCCCCAATGGGGGAAACCCCTAACATTCATAAGT
CTGAGAAATTTAGAGGTTTACAAGTAACAGGAGATGACTGTTTTAGGTGGCTCATAAGTT
GTCAGGTTTGGAATAAGCACATTAGGCTGATGGAATGTTGAGATGACTAGAGGGTAGAGA
ATCACTTCAGTTCAAGTGTGTTATACAGTAGTGGTAAGAGAACTTGCCAGAGAGTCAAGT
GCCCTTTTTATCTTTTTATTTAGGTCTGTGTTTCACTTGAGCTAATTCTTGAACTCTAGA
ATGAGTGCTTAATGATATAAAGGATGTCCTTTTGTTCTGTGATCTGTCCAAGAGATATGT
TCACCCATTCACACGTTTCTCTCCTATGAATTTTTTGATGGGTCTCCTGTTGCATTGGTT
GCCAATGTTCCAAAGCTACAATAGTTTGTGTTTAGTAAAGGATGCACTCTGATTCTACAA
GAATTTATAGTCAACCCCAATGCAGAAGTTCTCGGGTAATCTTATTAGGTAAGGCCAAGT
TCAGACTAGGTTCTTCAAACTTCATTGTTTGTAGTGAAGAGGAAGACAGAATTATCAAGT
GAGTGAAGAGGTGACTCCTTGAAAAAAGGTGGTCCCACCCCAGGAAGCAGATGCATTTTA
TACATTCAATCCCATGGATATCTCTTTTCCCAATCCAGTATCCTTTATATTGTTTATATT
ATGTTATTTGTTGCTAGTACTAGAGGTAGGTATAGGCCTCAGCTTTTAATAGATCTGGGA
GTATGCCAGCCTCAGTTTTTGGGTATGTGTTTCTTTTGAGTGGGTTACCCATTAGCTACC
ATATCTTTCCTTCTAGGATTTTAGCCTTGGAGAAGCTAGGTGCTGTCTTCAACCAGGTAG
CATTCCCCCTACAGTATACTCCAAGGAAGTTTGTCATCCACCCTGAGAGCAACAACCTCA
TCATCATTGAGACTGATCACAATGCCTACACTGAGGCCACAAAAGCACAGAGGAAACAGC
AGATGGCAGAGGTAATGATCCCTCCCTGCCCTTGTTGAGGGAGCGCTGGGATAGCTAGAT
ATATTTAGAGTAGAAATATTTGACCTGCCTTATGTCCTGGGACCTGCTGCCTTCATAAAT
GGGATACCCAAAGGCTTCTGCACTAGACATTAAAGGGGTCTTGGGTGCAATCCAGGCCTC
TGAGCAGCACAATAGTCTACTGCTATTTGGGGGAAGGTCAGATCCTGACCTGAACAGAGA
ATTAGCCCTTATTTTCCTCAGCTCTAGCTCTTTAAGATTGCAAAAACCACACTGCCCTGG
AAGAAAGGAGCTAAAAACTACGCATTCAGGAAAATTGTACTGGCTAAACAAATTGTACCT
TCCTCCTCCCTGCCACCACACACTTTAATTTCTCTATCTTAACTACTCTTACCAGTGTGG
TCACTGCATGTCCTCTGTTCTATTCTGAAGGAAATGGTTGAAGCAGCAGGGGAAGATGAG
AGGGAATTGGCAGCTGAGATGGCTGCTGCCTTCTTGAATGAGAATCTCCCAGAATCCATC
TTTGGAGCCCCCAAAGCGGGCAATGGACAGTGGGCTTCTGTTGTCCGAGTAATGAATCCC
ATACAGGGAAACACCTTGGATCTTGTCCAGCTGGAGCAGAATGAAGCTGCTTTTAGGTAA
GGAGCCTTAAAGAAGTAGACATTTGCATAGGAGGTCTGAGAGATTCCTGGGCTAAGACTT
ATTCCTGAATCTTTCTCTTTCTACAGTGTGGCAGTGTGTAGGTTCTCAAATACTGGTGAT
GATTGGTATGTGCTGGTGGGTGTAGCCAAGGACCTCATTCTGAACCCTCGGTCTGTGGCT
GGAGGCTTTGTTTATACCTACAAACTTGTGAACAGTGGAGAGAAACTGGAGTTCTTGCAC
AAGGTATGATCTTGTCTGTCCAGCTTCACTCTTTGCCAAATTGCCAGTTATACTTTGTAT
TGACTCCTCATTGCTATTGGTCTAGAACTATTTCTGTGACTGACTAAAGTCCACCTCATG
AGAGAACAGTGGCATCCTTAATAGTACTGAGATTTTCCTACTGGAGTTTCACTTGCTCTC
ACATACATCCCCCTAGGTCCTCCCACACAGGAAGCCTCTATGTAATAGCCACCCACGCCA
GAGAGAGATTGAATTGGCCCCTTGTTTACCGGTCTGACTAGTTTCAGGAGCAATGTATGA
CACAAGACCAGCAATTCCATAGAAAATGGTATTTTCAGACTTAATGTGGTGCTTTAACTA
TCCTCAGGTAAAATTGTTTATCTTGTGTTTTTTCCTATATATGATAGTAACTCCTTTTTT
GATAGGATTCACTGAAATTTGCTTCTCAGATAGAAAAGACCAACCCCCCAGCAGAAGACA
CAAAAGTACATGCTTCCTTCTAGGTTGTCTGGCATCTAGCTGACTTTCTCCGATATCCCC
AACACTAGCACAACAGTTACTGTTATTTGGAAGTAGCAGCTAGACCCAACTAAGTTGACA
TCTCCTCTCCTGAGGAGGCCTTTGGAATTTAGGTCAGAACCCCCAGATTCTGTTCCTAGC
TGGGTTATCATCCACTTCTTTGATGACTCACACAGAGCAGAAAATCTCAGTACCTTTGTT
TCCCATATGTAAAATAGAAGTTACCTTGGATTCCTTGTAAGACTTAGGGCAGAATCAGAC
TTTGCTAAGCAGATTCCCTTTTTGGAAATTAAAAAAAAAATGAAAGGAGAGCAACCTATT
TCTTAAATTAGAAAAAATCATAGTTGGTGGCCATCGTGGTGGTGTCACATGCCTGGGATG
CATAGGAGGACATTAAGGTCTCATGACTGCAACTGCACACTTCAATTGGCTGCTGTCAGC
CACTGTGCTATGTACTGAGGGTGCAAAGGCCTTCATAAGGCCCTTGGCATCCTAATGAGA
GGCACTTGTGTGTGCGTGAGAGGTACAGGATAGGTACAGAGGACATGAATACAAGGTATT
GGGAGGGGACGGGCACTAGCAGTTGAGGAAATGAGACTATATCTGTGGAAGGTGGTGTTT
GTGACATGTGTTTCATTTCTCATCCAGACTCCAGTGGAAGAGGTCCCTGCAGCCATTGCC
CCCTTCCAGGGCAGGGTATTGATAGGCGTGGGAAAGCTGTTGCGCGTCTATGACCTTGGG
AAAAAGAAGTTACTCCGGAAATGTGAGAATAAGGTAATATGAAGGGGAGGAAACTAAGAC
AGGTCAGGATATTGGAGAGAGCCCAGTTTGGAGGTGATGAGTAGAAGCTATAATTTAAAT
TTCTCATGGAACCCTGTCCCTGGGATATTAGGGGAAAGGCCTCCCTTGAGGAAGTTAGGG
CACTACATTGGCACACCAAGAGGAAACCATGAGGAATTGATTGTTCAGGATCTTGTTAAT
AAGATTAGAGATATAGATGTGATATTTCTAGTTAACAGAAGACCAAACATCTTTCTATTA
GGTGCTTTGATGTGATGTGCCAGCTATTGATTAAATATGAGAAGTTCAGGAAGATTCCTT
TTAAGATATATATACACACACACAAAAATATATGCTAAAATTTGGTCAAGCCCTTTCCTT
CTGTCTTGGAATCAATACTGTGTATTGGTTCCAAGGCAGAAGAGTGGTAAGGGGCTAGGC
AATGGGGGCTAAGTGCCTTGATCTGAGTCACACAGCTGAAAAGTGACTAAGGCCAGAACC
CAGGACCTCTTGTCTCTAGGCCTAGGTCTCAATCCACTAAGCTACCCAGATGATCCCAAG
ATTCCTTTTCTCATGGCGTTGTAATTGGCACTATTCTTAGGGCTTCAGAAAGAGCTCCTG
AGCTCTAGTCACTGTTTGCCCATAACTTTGAACAAAAACAATACCAATCATTGTCATTGC
TAGTATTGCCGCTGGCTGCTTGCCTGATCATGATGCCTGATCTTTGTGTCCTCTGATCAG
GGAAAGGTAGGTGGACCCCAGTGAGTTCTTCCTGAGCTCTTAGGACTCACTTACACCACT
CTCTTCTCTTGCAGCATATTGCAAACTACATTTCTGGGATCCAGACAATTGGACACCGGG
TCATAGTGTCTGATGTCCAGGAAAGTTTCATCTGGGTCAGGTACAAGCGCAACGAAAATC
AGCTCATCATCTTTGCTGATGACACTTATCCCCGTTGGGTCACGACAGCCAGCCTCTTGG
ACTATGATACTGTGGCTGGGGCAGATAAATTTGGCAACATTTGTGTGGTGAGCCTCCTTT
ATTTAAGGGCTTTAGCTGGCTAGAAAAGAACTATTAGTTGTCAAGGGACTTAGGTTGTTG
ACTTTAATGCTGGTTTGTAGAACTAAAGAGGTAAGACTAGTACAGAAATCTGTCACATTT
AAAACAGGCTTGTAGTTAGATTTTTTTAAACCCTTATTTTCTGTCTTAGAATTGATTCCA
AGTATCAGTTCCAAAAGTAAAGCTAGGCAATTGGGGTTAACTTACCCAAGAAGTGTCTGG
GGCTAATTTGAACCTCCTGTCTTTGAGCTCCCAATGACTGAGCCACTTAGCTGTGCAGCA
GCTCTCCCCTCTTACCCCCCCCCCCCCCCCCCAATTGAATTTTACAATAAATTGGAGTTG
AAAAAAATTTTCATCAACTCCCTTGCACACTGATGACTTTTTTTTTTTAAGGGAACTTCT
TAGAGTCAATACTGGGTATTGGCTTCCAGGCAGAAGAATGATAAAGGGCTAGGCAATGGG
CATTAAGTGACTTGCCCAGGGTCACACAGCCTAGGACCCTGGCTCTCAATCCACTGAGCC
ACTCAGCTGCCCCCTCAAACTAGTGACTTTTTTATACTATAATAATAAATTTATTATTGA
CTATTTAGCTTTTGTTAGAATCTTTGCTTTGTTCTGCAGCCTAATTTGAACCCAGCACCT
CCTATCCCCAGGCTTGGTTCTATCCACTGAACCATCTAGCTACCCTAGCCGATTTCTTTT
AATTCTTATTTAAGCCTATTTTCTCTAATGTGTGAGCATGTACCCAATTCCTGGTGACCT
TAGAGCCTTTTCCTTATGTTAGGACTTTGCTGTATCCCTAATAGTGTAATGGCTTTTGTT
CCTCTCCCTTTTTTAGCCCCTCAATTTCTCAGGAATGTGAAAACTATTCTTTAGGAATAG
CCCATCTCTACTAAACTGCTGGAGTTCTCTGCCTAGGTCCCTTCTTAGAGTAGTAGCAGT
CACCCTGCCCAGGTTATTGTCATAGCTCGTGGAGCAGAAAAGAGCTGTGGTGTTTCTTAT
TTCCTGGTAGGTGAGGCTCCCCCCCAATACCAATGATGAGGTGGATGAAGACCCAACAGG
AAACAAGGCTCTGTGGGACCGGGGACTGCTCAATGGTGCCTCGCAAAAGGTAAAGTAATG
TTTCTAGACTGCCAAGGCTTAGTCAGGCAGTGGGCTCAATGCCTCTTCTGCTTTCCATTC
CCCTGAAAGACAGGCCTTCAGGAACTATCTGCATGCAACTGCTCCTGGCTCCATTGGAGC
TCCACTCTAAAATCAATAATAATATTTTTGTGTAGGGATCAATGAGTTTCTCTGGGTCAA
CAGTTCTTGGGTAAAAGGGGCTTTAAATCCTGGGAGGGGAGAGAAGGGGTATAGTTTGCT
CAAAGGAATACTGCGTGTTGGCCTTTATTTCCTTTTCACTTGCATAATACTGTATAACCC
TTTATTCTATTTTGTTCCCCACTATGACCTGTTGGTGTAGGGTATTCCCAGAAATGATTC
TTTTATGTTTCAGTTGGGTAACTATTTTGTAGCTTAGAATTTTAGCAAGTTTTGTAAGGC
CTTAAGGGGTTAAATGATTACCTAGTCACATAGACAGTGTGGGGTGTTTTTTGTTTGTTT
TTTTCTCAAACTCTTATCTTCTGTCTTGGAATTTTCCATCAGAAGTGGCAAGAGCCACTG
TGCTACCTAGCTGTCCCTAGCTAGTATGTTTCTGAGGCAGAACTCAAACCCAGTTCTGAG
TCAGCCTTTAGCTAGGGCGTTCTGCCTCTCCCTCCCTTTTAGATGCTTTTTGGGTTCACT
TATAGGCTTACCTGGAATTCTCCCACTTTAGGCTCTGTTGGACCATTACCCTTGTCTACT
TTTTTCTTTTAAAGGTGTATACCTAGGTTTTTTTGTCGGTTTCTATTAATTTTATTTTGT
CTTGTCTAGGTTTTTGCCGTAATAACCTTGACACTGATAATAATCAATTATATTCAAGTG
CCATAATTTATTTAGTCACTCTTATTTGTTGATCATTCAGGCTATTGGCAATTTTTTAAC
TATAACAAATAAAACAGCTATGGCTTCATACACAGAACAGTCTGTAAACTTTAAAGCATT
TGCCAAATCCCTTCTATGTGCCAGGCACTGTGCTAAGCATTAGGAGTGCAGAGATCAGCA
AAAAGTAGTCTCTGCTCTGCAGGAGTTCCCAGTCTAATAAGGAGACAGCATGCAGACAAC
TGTGTACAAGCAGACTGTAGACCAGCCTTAACAAAAATAGATGAAAAAGCCTGTTTCCCC
ACAGCACAGGATGGCACATGGATGTCTTGAATTACATTTTTCTCGTGATTAGGGGAATTG
GAATATCTTTTGACAGGTTATTAATAGTGTTTAGGTTTTTTTGTAAAGTGTTTTTGCCAA
TCGATCATTGCTTCATTAGAGTGTATTGTGTTCTTGAAGTCCTTCATCAGTTTCTTACTG
ATTTGGAATGTCAGGTTTTTATCTAATAGAATTACTTCCAACATTTTTTTCTATTCAGTT
AACTGAGAGGAGTTCCTCACCTGAAAAGTAAAGTCCATCTCAACCCTTTGAGATTTGATA
CTATTCTTGGCAATAGTATCAAACTGCTCTTGGCAAACCAGAGCAGACTGTAGTTAGAGG
GCATAAATTGGTGTGATTTTGTTTGCAGGCAGAAGTCATCATGAATTATCATGTAGGGGA
AACAGTGCTTTCCTTACAGAAGACCACACTGATCCCAGGAGGCTCAGAATCCCTTGTCTA
TACCACTTTGTCGGGCGGGATTGGGATCCTTGTTCCTTTCACCTCCCATGAGGTAAGAGC
TCATTATTTCCTCATTTATTTTTTAGAATCAATACTCTGTTAGTTCCATGGCAGAAGAGC
AATAAGGACTAGGCAATGGGGGTGAAGTGTTTTGCCCAGAGTCACACAGCTAGGAAGTAT
CTGAGGCCAGGTTTGAACCCATATCCTTCCAATTCCCTACTTGATTCTCTGCCAGTGAAC
CACCCAGCTGCCCCATTATTCCTTGGGCTCTTGTCTTTCCTTGAATAATTTGTTGCTATT
AGTTTTGAGCCTACAATGAAGCTACTGCTTAGAAAAATAGATATAGATGGTTCTTTCCCA
TTTAGCAGTTATTAGGCCTCATGCTTCATATCAGGAAGACAAGGGAGGCAGCCATATTCT
GTTCACTGGAATGTTAAGTAGGGTGGGTACTCTGGCAAGTGGTCCTGCAAGCTCTCCTAA
TCTGGCATTTGAGGGATTTAGGGTGAACTCTGCTATGAGTACAAGTTTCTATTCAGTTTG
AAACCATTGAGTCTACTCCTAGAGTAGAAAAAAAGTTCCTAAACCTGAATTCTAACCACT
ACATTGAAATATAGTATTGGTTAACTGCCTTTTGGATTCACCAGGTTTGTGCTGTCATGC
TATTTTGCTGCTAAGGAATAGTTTGAGCCAAGACCTTGGTTTCTGTGGTAAATGGAGCAG
GAGGCCTCCCCAGTCACAATGTCCCCTGTTCATTTATGTCCAGAGCCTTATTTTTTAGAC
ACTTACCTTCCATATTAGAATCAGTGTTGTGTATTAGTTCCAATGCAGAAGAGCAGTAAG
GGCTAGGCAATGGTGGTTAAGTGACTTGCCCAGGGTCACACAGCTAGGAAGTGTCTGAGG
CCAGGTTTGAACCCAAAACCTCTCATCTCTGGGCCTGGCTTTCACTCTACTTGGCTGTCT
CCACCATAGCTTTTCTATGCAATCTAGCCCCTGTCTCCACCATAGCTTTTCTATGCAATC
TAACCCGTCACTTGAGATAGTAGAAAGAAAGGTTTGGAATAGCAGAGGAACATGATGCTC
TTTGAGCCTGGAGCTCATGTATTCTGTAGTCTGAAATAATACATAGGGAAATCAGTGGCT
TATCTGTTACCTACCTATTTTCCCAGCATCTCTAACCTAGGAAACCAAATCAGGGGATTC
ATTTTTCCAGCCTTTGTTTCTTTCCTAGGATCATGACTTTTTCCAACATGTGGAGATGCA
CCTACGCTCGGAGCATCCCCCTCTCTGCGGGAGGGACCATCTCAGCTTCCGTTCCTACTA
CTTCCCTGTGAAGGTAGGTGTGCATCTGGGGGCATCAGACTTTGGGAGGCTCCTTTACTG
ATCTTGCTGATCCTTCTTGTGCCCTCTTTTCACCAAACCAATTCGACTTCCTCTTACTGA
ATGTTTCCATTAGGAATCAAAATAATTGTTAGTGACTGAGTTGACAAAGGCACTTACAAA
CACAGATCTGGTTGGAGACTGTCCTGCCCTGGGCATGGGAGTCTGCGTCCATTTATGTTT
ACAGCCTTTAATTCTTTGGGGATTAATCACTGTGGTCTAATCTTCAGGATAAGCCATAAT
CAATAAGTGCCTCATCATTTTTTTTCCTGGTGTATAAGCTTCTTTTCCACTGCTCTATGC
CCAGAAACAATTCTTTTTGACCCCAGATCTCTTTTCTAGTAACCACTGGTCTAGACTAGG
TATTCAGGACCAAATAGTCATGGGAGCTTAGATGAACTTCATAGATTAGCTAGGGGCCAT
CTAGTCCCTCCCAACATTAAATGTTGGGGAGCACACAAGTAGAAACCATCAGAGGTAGAA
TTTAACTCAGATCCTTGGATTGGGAGGCCTTTTCACTATCTTATTTGCTCATAGTTGTTC
CCATTCAGCCTTAGGGTATTGATCTTTCTTCTTTTTTAGAATGTGATTGATGGTGACCTT
TGTGAACAGTTCAACTCAATGGAGCCCAACAAACAGAAGAATGTGTCAGAAGAGTTAGAC
AGGACTCCCCCTGAGGTCTCAAAGAAACTAGAAGATATCCGGACCCGCTATGCCTTCTGA
GCCCAACCATGGACTTGCTCCCAGGCATGTCAGAGACTATGTTCTAGAGAGAGTTCTGAG
GACATGCAGGTTGTTGTTTACTCCCTTTTCCCTCCTTTTTTTCTTTGTGATCACTTTGCT
TTGATCCCATGGAACAGGAGGAAGAGGCAGTTCTTCCAGATCTTGAAATACTGAAACAAA
TAATTCCATACACTTTATGGTGATGCATGGGCCCAGCCCAGCCTGGGATGTCCCTTCAGT
CCCAGACATTCCCTGCTTGGATTGCCTTTCCCTCCCAACCGTGCCCTTCATTTTTGTACA
CACCCTTCATTTTTAACTGGTTTTCTTGTAAATATAGTTTTGTACAATGTTAACTTTAGA
AGGGGGTGGATGGGGGAGTGTTGGGGAGAGCTGAAATGGGACTGAGATGGTTGGTTATTC
AGTACAAACACCATGAATTGTACCACCCTGGATCATAAGAAATACAAGCCCATTCTTTTT
AAAAGCATTCTTTCATTGTCTTCCTTGTGGCTTAAGGCTGGGATCTATAGGAAAGATTCA
TTTGTCCCAACAGCAAGAGTTAAGTTGTAAGTAAGACTAAAGTTGGAAACAATTGTTTCT
TCTTTTTTGGTGCCTTATTGAACTTCAGTCTTTCCCATTTTGTTCCCTTCACTAGGTTTT
TCTCTACTTTCCTTCCACTGGTGTCTTGACAGGCCACAAATTACTTTATTACTTTAAATA
TTAATTGAGTTGAAGTTATAACTATGTTTTATCATTGCAAAGCCCATCGGAGGGGCAACA
TATGACTTCTTCCTCTTGGTTTATGGACCTTAAGTTGTCAAGTAAGCTCATCTCATTTCC
TCTCCTAATTTCCTTCTAACATTTGTAATTGGTGAAACAAAGCCAACCCATTCCCTTGGT
CCCATAGTGAAGTATTTTACATTCATTCCATCAGTGGGTGTCCTTTTGAGAAAATCCCTC
CCCCCACAGTTCCAGAATGGCTTCTCTTTTAAGATGATTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1102, 1884..2210, 3127..3304, 5034..5149, 5822..5934, 7071..7211, 7853..7956, 9970..10135, 11206..11301, 13434..13506, 19020..19171, 19574..19729, 20514..20669, 21100..21243, 21968..22090, 22456..22610, 30256..30430, 30870..31075, 31166..31322, 32487..32612, 33434..33646, 34690..34788, 36328..36471, 37648..37752, 38379..38519
1033..1102, 1884..2210, 3127..3304, 5034..5149, 5822..5934, 7071..7211, 7853..7956, 9970..10135, 11206..11301, 13434..13506, 19020..19171, 19574..19729, 20514..20669, 21100..21243, 21968..22090, 22456..22610, 30256..30430, 30870..31075, 31166..31322, 32487..32612, 33434..33646, 34690..34788, 36328..36471, 37648..37752, 38379..38516
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved