Monodelphis_domestica Locus AP1G1
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica AP1G1
Monodelphis_domestica
AP1G1
1
SNORD71
52630..52715
68438
CTATTCATCCATCCATTTATCTATCAATATGTGCCACCTTCCCCATTTGACTGAGCTTG
AAGGGGGGGGACTAGCTTTTGCCTTTGTGTCCCCATTGCTTAGCCCAGTGCCTGGCATAC
AGCTGGTACTTAATAAATGCTTCTTGCTCGAGTGACGGAAGACTGTTTGCTCGGAACTGA
GTTGCTCCAGCTTGCCTCTTGCCCTACAGCCCCGTCCAAGTTCACCTTCTGGAGTCCTTC
AATTTTCTGGGCTCTTGGCAGGGTAGACTTTCCCGCCGGCTTTGCTAGGTCACCTTGCTT
CTCCTCCCCTGTGAGCTAAAACACTTTGACCCTTTTTGCATTTAAATGGCAAACACTGCC
CAGCCTGTCTAATCATTTATGGAGCCGGTCTATGTCTGGGTTTCAGGTTGGAGACTTCAG
CTCACTCTTGGCCAGGATGTCAGAAAACTATTAAAATTCCCTATCCAAAGGTCAGCAGAC
CCCTCCTTAAGCACAAACTGAAAGCAAAAATTAAATTCCTAACTGGGGTGTGCTCATATG
ATCCTAGGACTCCACTCGACTCCCCTCCCTCCACCCCTACTCTGTAGGAGTAGTTTTATC
CTGTTCCTTTTCTGTCTGCCCTGCTTCAATTCCATTCCTTTCTCTCCCGGGCTCCCGGAG
TAAGCCCCGCCCCTGCATTTGTGGTCACGCCCCCCAGCGGAACGAATATCCTGGGCTCCG
GGCCCATCCGGACTGTTCTCGCCGGGGCTCACCGCAGCGGTGACTCGGCAGCGGCGTCTC
TCGTCATCAGTGACAGCCCCGAGTCGTGCTTCGTTTTGCGCCTCCCGTTCAGATGCAGTC
ACTTCCACCGTGGCAAATAGTCCTGGGAGGGAGCAGAGTTCCGGGACGCTAGGGAAGCGG
CTGGAACGTCGGAGGCTGCCTCCTGGAACCTCTGGCATAGGCGCGGAGGTCTTTGGGGCT
GTCCCAGCTGCGGCGGGAGCCGGCGAAGCGGGTTAAAGCCCCGCTCCCCGGCCTGGATCC
CTCCGCCGGCTGTCGCGGTGCTGAGGCCGAGGGAGCCGCCATTTTGGATGTTCGGTTCCT
GCTGCCACTGCTGCCGCCGCCCCCGGAGCTGCCGGTTTTACTCGAGGTTTCGGGCCGGTG
AGTGTCCTTCGCGGCGCCCGGAGCCGCTGCCTCCCGACCCTCGCGATGGCGGCGAGCGCT
CAGCCGGAAGCCTCCTGTCAAGCCGGAGGGCCGAGCACGGAGTCCGGCCGTGGGGGGTGG
GGAGGAGGAGCAGGCCGGAGCCCAGAGGGGCAGCCCGGCAGCGGCTCCTCCAGGGGGTCC
GCCCCGAGGCCTTGGTCCCGGCTCGGCCCAGGAGGCTCTGCGCGCCGCACCCACGGAGGT
CCGGCACGGAAAAGTCAATGGGCCAGAGGCCCAGCGGGCTCACCCTGTCTCTGGATGGAT
CCTCCACAGGACCTGGGGCTTTCGCGGCAGTCCCGGGCCCCACCCCCGCGTGGCTCCCCG
GAGCCTCGGCTCCTACTCTATCCGGACAGGTCTCCCTCAAATTCCTCGTTCGCTACCCCA
CAGCCCGCCACCCCCCAGCTTTCCACAGTGGGTGCCTGACGAGTGAACACCGCTGCCTGC
TCTTTGCAGGACCCTCCCACCTTCCTGAAACTTGACATCTGCATCCCCCAGCCCCATTCT
CCACGTGTACATGCACCCACCCATGCGTGCCCCTTGTGTCTAATAATCTGTCTCCTGGGT
TCTCCTTCATTTGGGTTTCTGAAACTTAGCGCGCTAAGCGTCACCCTACTCCTTTCTTTT
CCCCTTCCCCTGGTTCAGCTCCCCAAATCCCCTGGGCCATAGTTTCTTCCAATTGTCTTA
GCCTTTTATTGCCCACTAGCGATGGTGCTTTTCCCAGAAGGGGGGCTTGTGTTCTCTTAA
CTGCCTGTTCAAGGTAGTTATATCTTCCTGCACATCTTTTTGGTGGAGAACATATCTACC
AGTTTGTCTAGGTGTACCACTGTCATTTTCAACTGTAGCTGAAGAAGGCAAATAAAATGG
CATTGGTTGCTATCGTGATTTCTTTTGCAAGCATCCAACTTTACAATAATTGTTATTACT
TCTGGATCTCGAGCTCAGTATTACTTGACTTGAATGCCCTTGAAGATCGTTCATCCACCG
TTGTATAAAATAACTTTCTTGGTTGTCATTTAGGACTTAGTTAACAAGAGAGGAAAACTT
AATGGGGACTTTGAACTATTCTCATTTTCAGGCTTGTAATAGTATGTACAGAGAGTAGTT
TTCACTAACTTTTGAGTAAATTGTCCTCCCATTTTTTTTTTACCTCTCAACTTTATATTA
AAAATTTTAGACTTTTGGGATATCCTGCCTTTTATGCATACTGGCCCAACACATTCTTAG
CAATGATGGAGTTGGCAAATGATGAAAAGCATTTCAATTAGTTTGTTAGTTATTCTTTAT
GTCATTTCAAGTGAGTTGAGTGAGACTGAATTATCCCTATGTCACAGCCTTATTGTAGAA
ACCTAGGTAGAGAGATGGAGTTGCTTTAGTTCACAAAAAAGGCATAGTGTTGAGTTGGTA
TCCAGCTTCAAACAAGTCAATTAATTCCTTTGTTTTATGTACTAGGGCTTTATTCTTTTC
ACCAAGATATAGATAAAAACCCTTTTTCAGTATAAATACTCAGTGTTTACATGTATCTTA
ATTCTTGTTTTTGGTTTACTTTGAGGAACATTTTGAAAATGTTTTAAAGTATATTAATTT
CAGGCATTTAGTCCTTTTGAGTGCTTTTGTATTGATATTTGAACTTTGGAATCTTTGTTT
ACTATTTAAAAAACATGTAAAAATCTTTACTTTTTGTCTCAGTAACAACTTCAATATAGA
AGGACTAGGACTAGGCAAGTGGGAATAAGTGACTTGCCTAGGCTAGGAAGTATCTGAGGC
CAGATTTGAACTCAAGTCTTGTCAAATGTAGTCCTGACACTCTCCACTGTGCCACATAGC
TGCCCCTGAGTCCTGTAGAGGAAATTGTTGCTGTTTGAAAAGATTTGTTCATAAGAAATA
AGATAGTCTTTTGCTTAAATGTTGGAGTTCAGATATATTTCAGACAAGTACAAGTTGACT
TAATGTGATATAGTAGTATTATTTGTTCAGTATAGTAACTACTCACATTTCTGGAGCACT
TTAAAGTTTACTTTGTTTAGGACTGCATGATGGAGGTAGTCTATCTCTTATTTTACAGAT
TCCTAAAGAGACTCAGAAAAGTTCAGTGACTTAAAGCTACTGTGAGTACTGGGATATATT
GAACAACCACTGAAACATGCAGATATTTTTTTCAATTACTATATGTAATAGAATATTTTT
TTCTTGAATTATATTGTTATGTAGTAGAATCCAAAGGTCTGATAAACATTATTTGTTACT
TAGAATCTCTAATATTTTAACATACTGGAGTGTTTTTTTAAAAACTTTGTTAGAAAATTT
ATATACTTTAAGTACAACGAGGAGGGCTTTTGCTTTATGAGTTCCCATGCTGGGTATTAT
GCTGGGTACAACACTACCAATCTAATAAACATTGAATACTTACTAGGTGTAATTATTTTG
AGGAAGATTGTTTGCAAAACACTATTAAGGTTTTGTGAAAACTTAATTTGGGGACCACTT
ATATGCTCTTTTGTCTGACATGATTCATTTTTATTACTAGATTTGGAGATGAATTTACAG
TGAGGTTATTAAATAAAGATATTGTCTACAAGGCTTCAATGAGATTTGATTCTTCTGTTT
AAAATTTCACGTTTGTGTAAGTCAGATTAGCTTAAAAAAGAAAAGGAAAGAAAGGAGAAA
GCTTAGTGGCATGATTTGGACTAAAAAGTTTCATCACCCCCCCCCCCCCAATATAACTGA
GGTATTTAATTTTTTAAGAGGCAGAAATTAGATGCTCAAGCAGTTTTGTTTTAAACCTAT
GCTTTAGGTTTTCAGCAGAAGTCAAGGATTTGAATATTTCTGGGGGTCTGTGTAATGAGG
TTAGTTGATAGTCAAACTTAAAACTTAATTTGCATTCTGAGATTTTTTAATTTCAGCAAA
TCTACAGCTATGCTCCCATCCATAAAGACAACCTGTTTAGCTGTTCTAGATTCTCATAAT
GATTTGATTTTAGTGTTATCTGTGGATTTCCAATACTTTCCTTGCTTTTGACTTCCTTTT
CCACTTTTTGTTGCTTTCAACTCCTTTTAAAATAGCATTTGAAAGCAATTCATTTGGGGA
GGCATTTTTATTTCTATCAATTTTGGCTTATAGGTTAAAAAAATAACTTCATTGTGAATG
TTCATTAGGATTGTCTTGGGTTGTTTTGGTTAGAAAACCTTGTGTGAATAGAAAAAAAGG
AAGTAGATAGGCAAGAAAAGTGTGATATATACCTTGAAGACAAATGAAATTTTCCTTTTC
TCTTAAGGAGTGGCACTGTTGCATACTTAACTTGGCACGAATCCTGGTCTCTATAAGAAG
TCAATTTAAAAGGGAAAAAGTCATAAAGTTAAAAAACAGAAACACACCTCACACCTCAAA
CTTAGTGGCTAAACATGTTCAATTATCAGCTAATTGAAAGATAGTGCACTTTTTCTGTGG
ACTTGGAAGTTAAAAAATTAACTCCCCCAGTCTACCTAGTTAAACAGTAAAGTCATTTTT
GTTTAATGACCCAAGAGGAAGTATATTTGCAACCTTTGATATTTTCTGAATACTTGGAAG
ATCTTTTAAAGACAACATTAAAAAAAAATTTTTTTGTATGGTTGTTACAATTCAGTAGTC
ACAGTGTAACCTGATAAATGGCTGCTTTACTAACCTCAGACTGCTGCTTCTTGTATCTGG
TATTTGTGTTTTGCCAGCTGAGCATCTCTTGCCTTTCAACTTGAATTTCAAGTTAGTATT
ATGGGAATAATGAGATGTGAGAGCTGCATGAATTTATAAAGCTGGATTTCTATTTTTTTT
TTAAGAAAAAAACTTGTTTTAAGGTTAAAAGACTTTATGAAATAGTATTCAAAGCTGAAT
CTTTCAAACCCATTAAAATCCATAAACTCAACAATAGCAAGAAGAGTCCTATTAGTTTTG
GGAGTGGGGTATAAATTCTGGGTTGTGTTTGTTTGACTCAAGTACTTGAGTGTACCAAAT
AATATAAAGCTACTTTCCAGAGGTTCTCATTACTCATTTATGAATCTGTTCTCTATTTAT
CAAACTTCAGAAGTGGAAAATAGTTTTACCTTCATTTTGATACTGAGCAAAGTTAAATTT
GTTATTACTATTTTTAATGCTCTGCTTAGAGTACATAATTTCCTTCTCTTTTAAAACTTT
TCTTTTTGTAAATTACACTGATGTGGAAAACCTAGTAATGATTGAGGTATTGGAAAGCAA
TTTTAGGAATGACATATAAATCATATTTTATATATTACATGACTGAAACAGTTACCAAAT
TTTATATTACATTTTATTTGACTGAAACTTTACAATTTTCAGCTACTAATTATTTATGTT
TGGTTTTTTGAAAGTACAGGGGACTTTATTGTAGAAAATGGTAGTTCTTTTTTTCCCCCT
AGTTTAGTGTATAGGTATTTTTAGATGTTTTTATCCTCTTTCTGTAAACTATTATATATA
TATATATATAGTTCTTTAATATTTTCATGGCACTTTACAGGTGTTATTTTATTCCTTCCA
ACAACCCTGGAAGCTAGATGTTATTATTATCCCCATTTTACAGATGAAGAAACTGAGAGA
AGTTTTAAGTGACTTACCCAGAGTCACACAGCTAGTATGTGTCTGAGTCAGGATTTGAAC
TCATTTTCTCCCTCACACAAGTTTCCGTCTCACTGTATATTCCCTGACCTCAAGAAGCAT
AAAATATAGTGGGCACTGTTGACTGTTTTTTATCTTCAGCTGAATTATAATACAGTGAGG
TCATGATTTGTGCAAATAGTAAATCCCCAGTAGTGGTCATATGATTGCAGTGGGCTGGAA
AGTTACTATATTTTATATAATTTTTAACTTCAAATAGTGCAAATCCAAATATATTAGGAA
AGGAATTCTTGCAAGTAAATCAGAAAACCCTAATTTATATCAATTTGGTGGCATAGTACA
TTTCCTTAAATTGCAGATTTACCTTCCCCACTATTTGGATCTAGTTTCTCATCCTATATT
TTAGTGGTTCATAACTTCAGAAACTTAAATTAGCCCTGTCTTTTAGAAAAGAAAATTTTC
CAACTATATTAATAGGAAGTTAGGAGAAAGACATTCAACGTTTTTTTTTCCTGTTTGCTT
GTTGCATTAAATCGGTGAAACAATTTTCAACTGCAAATAGTAGAGAGAAGTTTATACAAT
TTTTTTCATATCATTTAATACATGACTTGTAGTCAGACTTACTCAGTAATTTAAATGTGT
CTTTTCTCTGAGTTGTGCTGTTAGAATCTATTGTTGTTAGTTAAGGATTTAACTGAATTA
GGGGAAAGACATGGTCCCATTGTGCTCCTGGTAACCCATTTAGTAGATAATAGAGTTGAC
CTTATAGAAAAAAGGTTCTCAGTTTCAGAAATTATGTCCTAGACTTCATCTTCGTGTTTC
CAAATGTACTTGGAATATCTTACCTATGGAAATTTTTTTTTGCATTTTTTGCACTTTTCT
TTATGTTTTTCTATTAATGTAATTCCAGAACTGTCTGCAAGACTTAACTGACAATGTTAT
TTATTCAACAAATGTTCCAATGCCTACTATATGCAGTTTCTAAGCCTGAACATGTTAGTG
ATGAGGCTTATATAGAATTCTCCTTGTGCTCATGTGAGATAGGTACATGGATCATGTAAG
TATAATTATCCCCATTAACAGATGGGGAGCCTGAAAGAGATTGGAATCTAGGACTTCTGA
CTTAATGTCCCGAATACTTCAGTCTTCTAGCTGAAGGTGATGTCCTAATTCTTTTGTGTT
TTCCAAGTTTTCCTTGTCTTTTTATTATGTGATTTCATGTTACCTAATGCACTGTGTAAT
TTTGAAAACTTGAGTTGCTTTCCAAATCTTTCTTCAAATGTGAAATATTAACAAATGTTA
AATCAGTGGTGTCAAACTCAAATAGAAATAGATATCTGCAGGCTGCTTATTGGTTTAGAA
AACTACAAATTAATATTATCTATGTTTTATTTTATTTTTTGCTTTGTTAAATAGTTCCAA
ATTATATTTTACTTTGGTTCAGTCAGCACTGCTTTTGCAGGCATGACACAGACCTTTGAG
TTTGACATCTGTTTTAAATTATATTTTTTCAGGGTATTAGACATATCATTAACTTTCTAC
CAGCTTAGGATGCAGAATTGACTTATATTAAAATAGTATTAGGATTGCAGTCCTAGAATT
AGATGGGGCCTAGAAGCTATCTAGTCTAATGGCTCCTAACTTTTTCCTTTTATAATAAAT
TTAAGTCAAGGCTTTGGAACTACCCAGAGACCACCTCTTTAGTTAAGCCACTTACACTTC
TATGATGATCATATTTATTGTATCACATTGATCTGGATTAGATTTAGGAAATTTCTTAAC
TTCTTGAATATAAATTTGTCTTTTAATGCAGTGCCTCTAATTGGCCTGGATCAATTTTGG
TTTGCTTTAATCTTTCTTTGTTTATTCATTTGTTATTCTGGAATTTGAACTATTATGCTT
TCTTTGGATAGTAAATACTCACAAAAGTGATTTTTGTATTGATTCTCAAAAATCACTTAC
CAGTTGTGATGTGACTTGTTTATCAGTAGTAACCTATATTCTGTCTGGCATGTTGAATTT
TGGAGTACTGTAGTAATTGTCATTCCCTTTTTTTCTTTCAGTGGTATTGTGGTTGCTGTA
GAAGTTGTAAATCATTCAGTTAATGAAAATCTTAAAAATATTAGAATTTTATTGGTGAGA
GATACAGGGTAAGGAGAATGGTTACTGTCTTTGTCAGTCAACTAGCATTTAGTAAGCACC
TGTTAATGTGTCAGGCACTGTGTTAAGTGATGGAGTTGCAAAGAAAGGCAAAAAAAGTTT
CCTAGGAAGACAGAAAAGATGTACAAAAAATAACATAAAGAAATACAGTTGATGTAGAAG
CAAAGATGTCCCTACCAGCAACAACAGCACAGTTAGAAGGAAACAAAATAGAGATGAAAC
TGGAAAATTGAGAGAAAGGAAAAGCTTCCTGAAGGAGGGCAACTTAGAGTATGATTTGTT
AAGACATTAGATAACCTGACTACTTTTTAAGATTATAGTGATCAGCTTGTAGGAACATTC
AAAATTTGGAGTGGGCAAGGCAAGAAGAGAATAATAGGGTCCTAGTCTTAGAGACTATCT
CATCTAACTTCTTCATTTTACAGATGGAGAAACTGAAACCATGAAGGCCAGTGACTTGCT
TTTGGTCATATATAGGTTGTAAGTAACAGAGGCAGGATTTGAACTCAGGTCTTGTCTCCA
AAGTAGAGTTCTTTCTAATAGTAAATATGTGGTCACCTCAAGTAGATATACTTGGTTAGA
ACAAGAGTTTATCTGGGTAGTCTTACATGATGAAAGTTGTCTCTTCCCTATTGCTTTTGC
CACTAATCTCATATTTCTAGCTGGATTACTGCCCTAAGGTCCCAACAGGTCCTTCCACTT
GCTTTCTCTTCTTCAATTTAAATTCCATGTGTGCACATGCCACACAAACTCTTCGGCAGA
AACTTATTGCTACAGTGTAAGTTTTCTTAGCCTAGGTTCTATGAACTATTTTTTTAAAAT
ATCAAGATAATTGCATGCCATAATTGATTTCCTTTGTAAACTTACCTATTTTATACATTT
AAAAATAATGATTCTGAGAAGGATTCTGTAGGTTTCATCAGACTGCCAAAAGGGAGTCTA
GTAATGCAAAAAAAAATTTAAGAACTCTTGACTCTAGGGAGTCAAATTAAAACATTCTGG
CCCAGAATTAATGCTTATAATCTGATGCCTTCCTTTCAATTCAGCCTTCTCTCATGCTAC
TTTTCTATATTTTTTCCATTTTTTTTCCTGTCTACTCTGGAGATATGGCATGGTTAAGTG
GAAAGACCACTCAACAGAGCAGAGTTTGAATTTGTTTTAGACACTTATTAGTAGCTTTGT
GACCATGAACTAATCAGTAAACCTCTTTATTTTTCTCATTTATAAAATGGGCATAGTGAT
ACTTGTATACCTTAGAAGGTTGTACTGAGGATCAAATTTGACAACTGTAGGTTATCAAAC
AAAAGGCTCTCTTGTAACCCCTCTTTTATTTTCCTTTGGTACTGTTTCAACTCTCATTGA
CTCAGATACCATTTCTGTGCTGATTTTTTATCAGATCTACTTAACCAGCTCTGTATTCCT
TTCATTGACCTCCAGTCTTACATCTTCAACTACTTATTGGAAGTCCCTTAGACATCTTAA
ACTCAGCTTGTCTAAAATTGAACTAATAATCTTTCTCCTCTACCAAACTCTCCTCTCTTC
CTTAGTTCCCTATTACTATTGAAGGCACTACCATCCTCCCAGTCACCCAGGCTCACAATC
TTGAGTTTTGTCTTCAACTCTTCTCTCCTGTATCTAATCTGTTAAGTTCTTGACCTTATC
AAGATCAATATTTCCAAATATCTTTTGCATATATACCCTCTTTTCTCTTTTGACACTGCC
CAAGTTGTAAGTTTGAACATGTAAGCCTCCCCCCCAAAGATTCTTAAAACCTATTCCCTC
CACTACTCCTGTTTTTCTCACCTCCTCCCATATACTTACTGCACCAGTGACACTGGCTTC
CTTGCTGTTCCATCAAACAAGAAACACCATCTCCCAACTCTGGAGATTTTCCCTGCCTGG
CCCCCATGCCTACAGTATACTCTTTCCTCATCTCTGCCTTCTGGTATCTCTGGCTTTCTT
TAAGACCAGCTAAAATTTCAAGTTTTACAGGAAATCTTTCCCCATCACCCTCCATTTTTA
GTATCCTCCCTCTGTTGACAATTTCCAATTTATTCTCTGCGTATTCTGTTTGTACAGTTG
TTTGCATGTTCTGTCTCTGATTAGACGGTGATTACTTTTGAGGGCAGAGATTGTCTCCTT
CCTTTCTTTGTATCTTCCTTTCTTTGTTCTTCAGTGCTTAGCACAGTGCCTGGCATGTAT
TAGGTACACAATAATAACATTCATGAAACATGTTGCAAACTTCAAAGTGCCCTATAAATG
TGTGTCATTGTTCTGTAATTATTATTAATCCAATTGTACTCATTGTGCACCAGTCGTATC
CCATGATTCCTACTTAATTTTTGCTTATTCAGTTCTTTATGATGAATGCTCTCTTCTCCT
TAACTTTTAAATTCTTTTCTACTTGTTACAGGTGTTCAATGCCTTCTCTCCTGATCTCTT
TGTTAGAGTCAGTTAATGATGTAGTGGATAGAGCATTGCCCATGAGGGGAGGGTGACCTG
AGTTCAAATCATACCTCAGACTCTTGAGTGATTCTAGGGAAATCACTTTTCTCACCTATA
AAATGACACTTACCTTATGGGGTTATTATGAGAGCCAAAAGAGATAACATTTAAACTGCT
ATATAAGTGCTAGTTATCATTATCATAGCCTAGTTAATGATGAACCTTACCTTCTCCAGT
CTCATAGGACTTGACTTGTACCTTTTTTATATGTTTATTTCGAGTAATTTGCTTATTTAA
TTCTAGCCACCAAGTTTTACGAAAGATAAATTGGAGCAGGTCCAGAGGAGGGGGTGACTA
GGTTGTTGAGGAAACTAGAAACTATTCCACATAATACATTTAAATATTTAGGGATATTTA
GCCTGGAGAAGAAAAAATAGGGAGTTGTGATAGCTGTCTCCAGGTATTTGAATGGTTATG
GAGAAAAGGAAATAGACTTATACTCTTGTTCTAAAGAACAGAACAAAGAGAGAGTATAGC
TAGTAAAGGCTAGCATTTATAATAGTAAAAAACAGTTTTATAAAAGTTTAAAATTTACAC
AGTAACTCTGTGAAATAAGTACTATTATTATCCCATTTTGTAGAGGAGGAAATTGAGGCT
GAGGGAGAAGAAATGACAATTATTAAGTATCTGAGGTAGGGTTTTAACTGTACACCTGGT
ACCTGCCTAGATGGGTAGAAGTTGCTGAGAAGCAAATTATTGTTTGACATAAAGGAAAAC
TTATTTTCAGTTGGCAAGCATTTATTAGGCACCAGCTATTTGCCAGGAACTGCACTTAGC
ACTGGAGATATGAGGAAAACCAAAAAAATAAGCCCTTAATTAAAGGAACTAGAATTTTAA
AGTTATTCCCCATTCAACATAACTACAAAATACTTAAAATACTTGATTGGTAACATACCA
AGGCACACTTGGGAGTTACACAAATTTAATTGTAATGCACTCTTTACAAAAATAAAGGAA
CACAAAAGTAGTTATTGTTCATTATGGAGTGTTTCCATTAATAATACTACCTAAAATAAG
TGGATGAATTTCTAGATTGTTATGCCACTCAAACTTCTAAAAGGCCACTTTATAGAACTA
GGTAAAATACATAACAGGATTCACTTGGAGAAACAAAAGGTTGACAACCTCAAGGGAAAT
GGGGAAAAGGAAGGCATAAAAGGGGGCATTAGTATTTTCAGATCCCAATAAATTGAAAAA
TAGATCTGTGGAAAAAACCAGATAAGTGAGATCAGTGACAATAAAATGTAGTTACTTATT
TAAACCCCAAAACACATTGCCTGGTAACCCTCCCCCCCCCAATAAAAACAAAAATTTCAT
TCAACAAGAACTATGAAGGAAACTGGGAAACAGTTTGGCAGAAAATGGATTATACTAGAA
TTATCTAACATATGCTCCAAATAGATGACCAAAATATAAAATGTTTTATCATTAAAAGAG
GAGAAAGGATGATAAAGAGGATTGTTAAACAGTAGATGTGGTAATCATAAAAGTTAAAAT
TAGTTTAGATTAGTGATGTTAAACTCAAATAGAAATGGAATCCTTTAGTTTCATATTGAC
TTAGAAAATCACAAATTAACATTGAGTTGTGTTTTTATTTATTTTAGTAAACATTGCTCA
ATTGCATTTTAATCTGGTTCCAACCACTCAGAGTTTGCTGTTTGGGAGTTTGACACTTGA
TTTAGATAATATAAAATTTGAAAGTTTTTTATGAACAAAATTAATTCAACTAGAATAAAA
ATGCCTGGGGAAAATTTTTTGGATCAAATAAATCTATCTTATTGGCACTTTACTCTGAAC
TGAAGGTTCAGAGACCAGACATTTGGGTTGGTACTCTCTGGGAACTATTCTCTTAGGTTG
CCATTACTACTTTCCATCTCTTTTTCTAAAAACTAATCAAATCAACACTATTATTGCTTT
TGGAAAGAGTGTGTCATTTGACTGCCTCACCCACCATTTTTGTGACTTCCTAATCTATAA
CTTCCTGTAAACCATTTCCCTGTAATATTTCTCCCATTAGAATGGATGAAGGACAGCTAC
TATCTTTTCCATTTGTATACTCCATGGTTGGTACTGTGTTTGGTGCATTGTAAGCACTTA
ATGTTTTAAATTCAATCACAAGGCTCTGTTATTGAATATCCATAAGGAATTAATGAAAAT
ATGTAAGACCTAGAGCCATTCCTAATAACTCAGTGTTGAAAGGATATGAACAGTTTTTAA
AAGAAGAAATAAAATTCTGAGCGACCATATTGAAAAAAAATATTTCTATATTGCTAATGA
TATATTTGTAAAGTGCTTAGCATATTGCCTGGCACATAGTAGGAATTCTAAAATGCTTAT
TTCTTTTCCTTTCTTTAATAGAAATGTAAATTAAATGTCAGATTTTTATGTCATATCTAT
AAAATTTGTATGGATATTAAAAGTTGGGGATAGATTGTCAGAAAACAGGTGCACTAATCC
TTGGTGGAAATATGCATTGGTTTAACCATTCTGAAAAGCAATTTGGAATTATTAATAAAA
ACTGAACCATATACTTTGACCTTGCAGTCATAATGGGACATATAACTTCAAGATGATCAA
AGATAGCCCTCATATTTTAACTTATCCATAGTGCATTTTTTGCAATTGCAAAAGTCTAAA
ATAAATTATATGCAAATATCATGGTAATGGTAATATCATGTGCCCTAAGAAATGATTCAT
CATTCAAATTCAGATTTGAATTCAGGAATTCAGAGAACATGAGAAAGTTGTATGAACTTT
TTCAGTGTAAAATATGCAGGACTGAGAAAATAATACAAAAGAAGGCTGACAATATCACTT
TATTTTGTCATATCTTGTATTACCTAACCTAGGCTAAAAGGCATTTGACAGTCTAAGAAA
TTTCTTGTATTTGGTCTGCAAAGATGTCTTATTAATTCCCATACTTGATTGAATCAGCTT
GTTATTCTCTACAGATTAAAAAATATATTTTAAAAAATTTTGAATTTAAACAAATGAAAG
AAAATATCTGAAACAGTAGAATTGAGAGTATTGTACATGAAACTTTGTATCTTTTATGTA
TAGTTTGCTTTTCTTTTTAAGTAGAAGTTCAACATGTGGCTTTCAAAGCTGTGTTGTCTG
TGCTGCTTTCTGACCTTTCAGTTATTTGTAATTTTAAAAAATTGCCATAATGACCATGTT
TTCTTTAGGCTACTTGAACTTGCTTTGCCCACCCACTCCTTCCACTGTGGGGGAAGGAAA
TACAAAGCCTTTATAACAGATTTGCATCGCCATGTAAAACAAATTCCCATTTTGTCTCTG
TCTAAAAATGTATGTTTTATTCTGTGTCTTTAGTCCATCTCTTTTTTAGGAGGTGGGTGA
CATACTTTCATTCAGTTCTCTGAAATTTTAGTTGGTTGTTATGTTGATTAGAATTCTCAA
GTCTTTCAAAGTTTTTTCCCTTTATAATATTGTTGTTATTTTAAATTATTCTAATTATGT
TTCTATCACTGCATCAGTTCATTCAGGTCTTCCCAGATTTCTCCAAAACCATCTGTTTTG
TCATTTTCTATGGCAAAATGATATTCCGTTATATTCAAACTCAAATTCATTTAGTCATTC
CACAATAGATAGGCACTTCTTTTGTTTCCATTTTTTTTTTGCTATAATAAAGAGCTGCTC
TGAATATTTCTGTACATAAGTCCTTTTCCTCTCTTTGATCTTTTTAGGGATATATACCTA
GTAGTGGTATCACTGAATCAAAGAGTATGCACATTTTCGTGTCTTTGGTGCAGAATTTTG
TTTCCATTGTTTAGCTATGTATAATTTATAGCTTTTCAGAGCAAAGTAATCGTTGCTTCT
TAAAAAGTTAATAAATGTCTTTGCTGAAAACAAATTTAGATTGTTTCCTGAGTTAACTGA
TTTTAGTAATGGAAGTCTTACTGAAGAATGAGATAAACTTTGTCAGTAACTTAAAAAAAA
ATCCTACCCTCTGTCTTAGAATTGATATTAATTATCTGTTCTAAGGCAGAAGAGCTGTAA
GGGCTAGGCAATTGGGCTTAAGTGACTAACTCAGAGCTAGGCAGTGTCTAAAGTTAGATT
TGAACCCAGGTCCCCTTGACTCCAGACTTGGCACTCCATCCACAGAGCCAGATAGCTGCT
CTTTCAGTAACTTTAATAGTAGAGTCCTAATGGTGTTTTATACCTTATACTCACAATTAA
AAGATTAGCTTCATAGATTAGAGCTAGAAGGGGCCACCTCAGCCATCAAACAGGTCGGCC
AGTGTAGGACCACAGAGCCAGAGAAATTTTGAGACTTGCACAAAGTTATAGTATAAGATG
ATCCACTTATGAGGTAGAGTTGGAGATTAAACCTAGGCCCTTTTAAAACCATCATTGTTT
TGCACTTGCTAGCCTTTGAATATTCAAGCATTTTAGGATTTTATATGTGAAGTTTTTATG
TTATCCTATATATTTATTTGTTTGTTTTTGTTCTCTAGAGGATGCCAGCCCCTATTAGGC
TTCGGGAGCTGATCCGGACTATCCGGACAGCCCGAACCCAAGCAGAAGAGCGAGAAATGA
TCCAGAAAGAATGTGCTGCCATTCGATCATCCTTTAGAGAAGAGGACAACACATATCGCT
GTCGGAATGTTGCAAAATTACTTTACATGCATATGCTGGGCTACCCTGCACATTTTGGTC
AGGTAGGCTTGTCTGGGTTGATCCTTGATTCCCCCTTTTCCCCCTATATTGTAAGCTTTT
TTTTTTTTTAAACCCTTACCTTCCGTCTTGGAGTCAATACTGGGTATTGGCTCCAAGGCA
GAAGAGTGGTAAGGGCTAGGCAATGGGGGTCAAGTGACTTGCCCAGAGTCACACAGCTAG
GAAGTGGCTGAGGCCAGATTTGAACCTAGGATCTCCCGTCTCTAGGCCTGGTTCTCAATC
CACTGAGCTACCCAGCTGCCTCCATATTGTAAGCTTTTTGAGGATGAGATTGTCTCACTT
TTGGGTTGGTGTTCCCAGCACCTAGCCCAGTGCTTCATAAATTTTTGTTCGTTGATGATA
TTCTTCTGGAATCTTTAACTTATTTTGGCAAGACACTTTTAATTTCCCTCATTTTGTGTT
CTTTGTGAGAGTAGGGGAGGCATGGAGTAGTGCTAGCTGTGTTCCTCTTCCCATTGGGAT
TCTGTTCACATTTTAGGGATGTGGGATATGGTAGTAATAGCCAGTTTAAATATTAATTGG
TTGGTCATATTGATCTATTGTGGGGGATGTTTCACTTTATTTCTTAATTCATGGGCATTG
GTGTATATATGTCTTTTCTACTCAAGTCATTAGGAAGTTTTTAAGTCATAAAAGACTGAA
ATACTCTTTAACTGATGCTTATAACATGCCAATCCAGTGGCTTTTTTTTTTAACTAAGGA
GATATAGTTTGGAAGTAATTTATTGTAGAACAGTGATATTTACAGACAAGTTCAAAATAA
CATGCAAATATATGCTTGTTTATAAGAAGCATAATATGAATATTTACAGTTTATATTGTG
TTTTCTTATTGTTGATTATATAATGCTTTTCTGATAGTTGAATTAAAAATGTGTTGGAGA
TCACATGGCAGTTGCTTTTTTATATTGTTGACTTCAAGACTGATAATTGCCTGTGGACTA
GCCATCATAAATTTTCTTAAATTAAGTGTAGGCTATATATGACATTTGTTGGTGTCTTTA
AATATAGAGCTTGACCTGATTCTCAGGTTGACCCAGTCTTCACTTGGCTGTGTTACCTCT
TGATTTAAGCACATGTGAATCAGTTTATATTTGTTCCTACACGTGATCATTATACCTTAA
ATGTTTTTTTCAAACACAGGACCTTCAAAATACTTTTTTAAAAATAGCATGTAAGTGGGT
AAGAGAGAGAGTGCATGAAATCCTGTGCTCCACTGAAGTAGTCTAAGGATGGATCACTTT
GAGAGTCAGGAGCACTGATTTATTATGGTTAGTATTGTAAAGGGTGAAATAAATAAGCCT
TATAAAGACTGAGTCTTTATAAATTCCTATTTTATTGTACTTGTGGGGTTCTAATGGACA
AGTATTTTAATACTTTTTCCAGTTTTAAAGTGAAGAAGATATTATAGCTAGAGATTTGAT
CATGCTGTGATATTCAGGAAAAAAAGTATCGTCAACTTTTTTTGGTAATGTATGGCTTTG
AATTTAACTTTTTTGGCTGTGGGAGTGCTGACTGAAGGAATTAGAGTAATAAGTCTTTGG
GAAACAGGATAAAGTTTCTTGGTTCCTTTAGTGGAGAAAATAATAGATTAAAAAACTTTT
TTTGGTAGGAACTTGCCTTATTCCACTTTTTCTAATTAATACAATTATTAGGGAAGTTAT
CAACATTTGATTAAGGAAGAGGATTTTGTCTAAAAGAAGAATGAGGTTAATAATATTAAC
TTTAGCATTTTCCCCCAACCCCTTTGCTCTGGCACCTACCCACATGCTTTCACACATTGT
GCACAGGATTTAGGATTATACATATATTAACTAGCTAACAAAAGACCTGGATATTGCCTC
TTACCTTGGACAAACCTAATCTCTGTGAATCTCAGTTTTCTGATCTGTAAAATGGGGATA
ATAGCTATAGTACCTCCCTGCCTCAACAGGATTAGATGTCAAATGATATAGTTGTTGTTG
CTTTGCCGACTTTAAGACTTCTTCTTTTTGGTCTTTTTGTTCTCCTTCTCTTCTTCTTTT
TCCTCTTCTTCCTCCTCTTCTCCGATTTACTGAATCTCCAAAAAAGATTTGGCTGAGCAT
ATTCCACAGCACTAGTTACAGAATAAGTCCTCAGTAAATCTTTGTTAGCTAGTTGATGAA
AGGCATATTAGGTTAGATTTAGACTCTAAGCCAAAAATGTAGAGTTTGAAGTACAGAAGA
TGCCAGTGAGTGAGAAAGACAGATAATTCTTTTCCTTAAATTCTTCTTCCCAAATTTATC
TTGTGAATTGGCTCAAAGCTTTACTTTCTTTATGTGAAATAAAACAAAGGTAAGTTTCTC
ATTTTGTCTTTTCGCTGTATTTAAGAATTTATTCTGATTATAGCATTATTAAAGATTATT
ACTAAGAATGCTCATTGAGAAAAATTAATGTGTATATTCTTAAGAAAAAATTCTAAGCTT
CATTGTATTATATTTTTCGATATAAATGTTATTTTGAGCCTGACAAAAAATTTGTAGATT
TTTATATTTTTTGTACTTAGAGTAGGAAAAGAAGGCTGTAAATGAAACCATTGATTTTCA
TTACTTATTGCTTGTTGTTTAAGTTTAGAATACATTTAATGTATTTGTTCCAAAGTTATC
TCCCTTGTCTTTGTCTAAACCCTGTATTCTGTTGTGTGTTCTTTCTTTACTACGCTGTAG
TCATCTTATAAATTGTTCTGGTTTTGCTCACTTTGGTCTGCCTCAGTTTATACAAGTCTT
TGTAGGTTTTTCTGAATTTATTCCTTTCATCATTTCTTAAGGTGTAGTAATATTCTATTC
TATTCTTATATACATAATTTGCTTAGCCACTATCTGATTGATTATCATTCCCTTAGTTTT
TTTTTTTGCTATAAAAAGAATGCTGCTATGAATATTTTTATATATTTGTGTCTATTCCCT
TTTTCTTCTAACTCTTTGGAATATTAGTTTAGTAGTATTGCTGGGTCAATGAGTATCTGT
GTTGTGTTGAATTTATGTTGAAATTGCTTTCCATTATGGTTGTACCAATTTGCAGCTCCA
CCAACAGTTCCTTAGTGTGTCTGCCCTTCCACCTGCTCTGCAACAATAGTCATTTTCCTT
TTTTGTCATCTTTGTCAACATATATTGTATGTTAGATGGAACCTCAGATGTTTTCATTTA
AATTTCCCTTAGTAAATTGGAGCATTTTCCCCATATGATTGCTGATAACTTGGTTTTCTT
CTGATTATATCCTTTGACCATTTATCTAATGGTATGTAGAATTTGAAAAGGAGTCAGAAG
GTGTGGCATTTGGAAATGGGGAGGTAGGTATAGAAGAAATTGTTGAGTTGAAATAAAAAG
CATAGTCAATTACTTGTTCATTAAAAATAGGAGTTAATTTTATAGAGGGCACAGTCCTTT
TTTGATGGTTAGTTAGAAGCATCCAAGTAGGAGTAAATTCCTAGTATTTTGCTAAAGTGT
GGTTAGCTTTTGGATAAGAATTAAATAGTGCTGTGAAAGATGTGAAAAACCATGTAGTTT
CGTAGACTGGAGGAATCAGTCACTCTGGAATTCTTGACCTTGAAATAAATAAATAAATAA
CTAAACAAGTAAACACAGACAGTTCCTTGCTTTCTGTCTTTGAATCAGTACTATGCATTG
GTTCCAAGGCAGAAGAACGGTGAGGGCTTGTTAAACTGAGGGTTTGTTAAACGGGGGATG
TCACTTGCCCAGGGTCATATGGCTTGGAAGTGTCTGAGGTCAGATTTGAACCCAGGATTT
CCCCTCTCTGGGCCTGGCTCTAAATCTACTGAGCTAACTAACTATTCCCTAAATACTGAT
TCTTCATGAATTTTTTTAAAAAAATATTTTTTTAGAATTTTAAATATGTTAGTTGTAAAG
TGTCTTATAAGCCCCCCCACTACACCCAGTCCTTTCAGGTAAAAATAACTGATGTTTATA
TATAGTCCTTTTAAGTTTTGCAGGAACTTTATGTACATCATCTTAAGTAGAATCTATTAC
TACCTAATGAGGTTCTCAGATTTAATTGTTAAGGCATTCAAGATTCTCAGTTGGAAAGTG
TTAAATACATTAGCTTGATTGAGATTCTTGACTATATACAGCATGGTTCTGGGGAGTTAA
GATCTCCCTGTGAGGAGATATAGAAATGTAATGGGAAGTGTTTGGGTAAAATCTTGCAGA
GGCAGAGGCAAAAGAGAAGTTGTTACTGGAGTACATTCAAGGCCTCTGGACGAACAGAAC
AAGGAAAGGAAAGAGGCAGACAGGAAACATCTCTCTCTGTTGGAGTTCTTTTCCTTTCTC
TCTGCCCAAAACAGAATGGCCAGTATCTTCTCAACTGGTTTGAATGTTTTGTAAAGATTA
AAATTTAGGGGAGATGGGGAGACTGAGGCAGGTAGAAATTAGTTTCTCTCTGCAAGGAAT
ATTATAATTTTTAGAGGTTTATTAAAGTTTAAAGATTAAGAATATACAAGTAAGAAACAT
GTGCCTAGGCCAGAGGCCTAGACAAAATAACCTCACATCATGGAAGAGACGCCTCTGCTC
CAAAAGGAAGTCCAAAAAAAAAAGCCTTTTCTTAAATATCTTCTCGATCTCGGCCCAGGT
GAGATTACAAGGTATTCTGGGGAAGTGGAGCAAAGGCTCATGGGGATTGTAGTCCTGTAT
TCGAGTCTATTTTTTACAGTTTCAAATTTATGGTTGGAGTAAATATTTTAATTGATCGTC
AGGGATTTAATTTCTAAATCCCCAAAATGAATTACTAAAGTAAAATGGAATTTATGGTAG
TTTATTTTTACAATAGAGGGAAGATATTAAGGAAGAGAGAAAAGGGGAGAAAGAGCTCCA
GCTTCTTCTGAGCCAAGTAGAAATTCTAAGGCCCCAGCCAGGTGAAAGGAGTCTCAAGAT
GATGGGCCTTTCCCAGAGGCTCACTCCTCCAGAAAGGGCAAGGAAGGAAGTCAGCCTTTA
CACTAACCACAATGTCAGTTCGATCAGCAGATTCTTTTATCAGCCACAACTCCATCAGGC
TCCATTCCAAGAGTTTCTCTTTCTTCACTCCAAGTGACTCCCTTCCCTCCAAGTGCCTCT
CTTCACTCCAAGTGTCTATCACTTCAAGTCACTCCCTTGAAGTCTCCCTGTTTGTGTCTG
TTTCCACTTCTAAAGACCTTTTTCTCTTGTGTCACTTACCCTAAATTTTTTACCCAGCTG
ACGCTCCACTTCAGGACTGCCCACTCTTTCACACGTGGATCACAGACCTCCCACTCAATG
AATGAAATGGGTGTTCACACATTTTTGTGGTTAAAATCCAAAATGGGTAGATCTCCATAC
TCAACTTTAAGTAATGTGGTTTATAATTTGGGGATTAAAATCTAAAAATAGACAGGGCAT
TAAAATTTAATCTTCACAATCAAGGACGAACTAAGTACCTTCATTGTTACAATCAGGAGA
GAGCCAAATCCAATCTTCACAAATGTGAGTTCAACTTTAATCCTCCAAAGGTGGAGGAAT
CAACAAGGGGAAAATATACAGTTCTTCCTTCCATATTGCTGGGATTAGGGGTGGGGCATG
AAAAATCTGCATAAAATTTTTTGGCCCTTTCATATTAGAGAAGTAGTTTGAATTTTTTCT
TACTCTTTTATAGGGTGTCTCCAATACCTTATTGTAAATTTTGGGTTAAATATACATTTC
TCAGTTTCTAAACTGTCATCTGTTGACCTTCATGTGTCATTTGCAGTTTCCATAAAACCC
CCAAATTCCCATTTAATTTCTTATGTCTACCTGCAATATCTTGGAGTTGTGATATGAAAG
GGATAACTGTATTCTGAATCCCAGTTAGGAAGAATTAGTTACTAGGGTTAAACATAGGAA
TCTTGCAGGGGCAGAGGGTGTGATCAACATCACTCCACCTAGACTTTATGATAAGAGAAG
AAAACCATACATTGTGATATTTATCCTAGACTTTGGGAGAACAGATCTTATAGGTTTAAG
AGTAACCAATTTTATGTAGGGTTCAGAAAATGGAGAGATAAGATCCTATGACCTAAAATT
CCATAGGGAAATTCAGTTTTTAGGGGAATGAGAAGCTACAGAAAAATGTTATTCTGAAGA
CACAATGAAAAAGCTTTTTAATCATTATGAAAAGCGACTTGTTTAAAGGGACTAATGTTT
GTGCACAGGGAACTCAAAGAAATGTACAAAAGATGGAAACAAGGTCAAGTAAGAGGTCGA
GTTCAGAAGTAAGATATAGCCTAGTAAGAAGAATGTTAGGAAAGTCAAAGCTCAGGATAA
GCTAAGGGCAGTGAGAAGCTAAGAACAGCAAAGATTTTTTGGCTTGTTTTTCTTTTTGCC
ATATTGGGGGAAAAGAGAAAGCTTGAGAGTATGGATGGGATTTTTGTGCTACATGGATGG
AGTGAAGGTACCAGGAGATGGAGAAGGCAGAACTGCTCCACATTTTGTTTTGCTTCTCTT
TTCTCTGCTAAGGTGGGATGATCTTTGAATTGAAAAGAACAGATTAAAATGGGCCTTTAG
GAAAGCTGATATTTAAGGTAATTGGGATGTCTGGTAAGAGGACACCAAACTATTCTTGAA
TCTTCAGGACCAGATGAACTATGTATACTTGGGTACCGCAAGAACTAGCGAATGTGATTG
CTAATGGTCTTTGAAAGATTTGGAAAAGAGCAAATCTCCTTTTTTCCCTGGGAAGGAAGG
AGAGGGCAAACTATAGCATATTGAGCCTGACTTTGATTCCTGGCAAAATCCAAGAATGTA
TTATTTTAAAAAATATAATTTATTGTTGATATAGTTTGTTTTTGTTTTTTAATATGTTCC
ACTGTACTTGTACTCCCAGAGAACAATTTCTCATGTAGTCCTTTATTAGAAAAAGTAGGT
GGAGTGAGTGGGAATTAGTTCAATAAAACTAACCAACTTGTTAAAAAATTCAGTGTTTTA
TTACTTATTCAAGTGTTCTTTATATCCATAGACCTTACCTCTGCAAAGAAGTGGGAGGAG
GTGGCTCTTGTATTGTTATGAGGGAAGATTGGTGAACATTGGGAAAAGGAAGGGCCAACA
TGACTTCATCAATAACAGGTCATAGGGGCAGCTAGGTGGTTCAGTAGATAGAACAGACCT
AGAGTCAGGAGGTCCTGGATTCAAATTTGGCCTACTTCCTAAAAATGTGACCCTGGGCAA
GTAACTTAAATTCAATTACCTAGCCCTTACCACTAGTATAGATGGATACTTAGTATCCAT
TCTAAAACAGAAGGTAAGAGATTTTAAAAAAGATCAGATTATATTAAAACTAATTTGTTT
CCTTCTTTTAACAGGGTTACTAGACTGGTAGATCATGGCAGTGCTGTAGAGATAAATAGT
TTTAACTAGATTTCATTAAAGCATTGATAAGAACCTTTCCTCTTGTAAACTAGAGAAAGA
GATATGAGCTAGATGATTATACAGTTTCATGGGCTCACCTGGTTGAATGGCTAGGCCCTG
AGAGAATTCATTTAATGATTTGACATCATCTTTGTTGAAAGTTGCTTGTGGTATGCCCAG
GGGATCTGTGCTCAGCAGGTAGGTGTTACAGTGGCTAGAGCAATGGACTTTAAATCAGGA
ATTAGGAGGAGGAAAGGTAGGAGAAAGCATTTATATAGTAGTCTACTGTAGGTCAGGCAT
TCTGCTTAGCACTTTATAAATGTTAACTCATTTGATTTTCAGAACAACTCTGGGAGGTAG
GTGTTCTTTTCATCCTCATTTTACAGGTGAGAAAACTAAAGAAGAGGTTAAGTGACTTGC
CAAAGTCACATAGCTAGTAAATATTTGAGACTGGAGGGTTTTCCTGACTCCAAGACCAGC
TCTGTATCCACTGTACCACCTAGTTGTCTTAGAAAACCTGTTCAAATCCAGCTTCAGATA
TTAGTTGTATGACCTGGGTTAAACCCACTTAACCTATGACTGCCTTAGTTTTTTCCTCTG
TAAAAATGGGGGAAATGGCTCTTACCTTCCAGGATTTTTGTGAGAATTAAATGATTGAAC
ATTTGTAAAGTGCTTTTAAAACCATAAAGCACTATTTAAATGCTTGTTATTATTAGCTTT
TAAAAAAATCAGTGATTTATATATAGGCATAGATGGTGTAGGCCTATATTTTTAGAAGTC
ACACAACGGGAAGATATAGTTAATACACTGAGTAACAAAGGCAGATATGAAAAAAATCTT
GTCAAGTTAGAACAATAGACCAAATCTAATAAGATAAAATTTAATAGGGATAAATGTAAG
TCTTAACTAGTGGATTCACAAGAATTAACTTTACATTTATAAGTAGAGGAAGCTGTGGCT
AGATGTTGATTTATCTGAAGGTTGTAGTGGAATGCATCACATTAAGAATTACTAGGGTGA
CATGTTGGCCAAGAAAGCACTACAGTTTTAGGGTACATTATGAGATATGTCCTCTGCCAT
CCTAGGGAGGTGATACTCCACACTGTATGATATATGTGGTCTGACAACAGTGTTTATGTT
TAGTTCTGAGACCACATTTTTGGAAGAAAATTGATGAACTGAAGCATAGATAGGAGTGCA
GCCAGGATGGGGAAAGTCCCTTTAGGTCATTCAATATGTGATTCAACTGAATAAACTGGA
GATGTTCACCCAGGAGACAAGACTTGTGGGGCCATAAGCTTGGATGTGACAGTTGTCTTT
AGTTATTTTAGGGTTTGTTACTTGGAAGAAGGATGAGGCTTGTTCTGCTTGAATTTAATG
GGCAGAAGGAGGAGCAATGGATGAAAATTGCAAAGAACAAATATAGATTTGATATGGAAA
GACTCCATGATTCTTCTTGCCTCCTTTAGGCTGCTCTAGAAGGGTACATTCTCCCTCACT
GGCTGGTTGAGCACTTGTCAGCAGTGTTATGAGGGATTTTTGTTTGGGTACGGCCTGAAG
TAGGTGGCCTCTGAGATTCCTTTGAAAGCTGAGATTCTCGGGTTGTGCTGAAAATTGAAA
ACAAAATAGTAAGTTGAAGATATACTCTAGGTTAGACAGCTTTTTGGGCAATTACAATAT
TCTTAATTTTCCCCAAGTCTTCTGTTTGAATTAATCATAGGCTTTATCCTTGGTTTACAT
TTTTGTTTAAATATTAGCTCTGTATCCCCACCTTTTGGAATTTCCTCCTACTTGTTTTCA
TACCATAACTGGTTTTATATGCCTCGCCTTTGTGGAGGAAATGTGGTTGGTATGTCTCAC
TTGCAGAATGATTCATCACGTTCTGCCCAAGTATTTGAGTAATTGTTGGATGTTGTAGGA
AGGACATGGCATTGGGAGTCAGGAAGAACTTTGATTCTAAACCCACCATTGCCGATGACT
AGTAGCTGTGATGTTGGGCAAGTCAATTTCTTTTTAGTTCCTTAGCTATAAACAAAACAA
AACAAGAACATCAGATTAGAGCAATGATTCCTAACCTTGTTTTGTGTCCTGTACTCCTGG
TAGGTAGTAGTAGGAAGCCTATGGACCCCTGCTCAGAATCATGTTAAGTGCATGACAAAA
ATTCATAGGGATGTAGAAGAAGCCAATTAAATTGAAACACAGCTATCAAATTTAAAAAGT
TGGTAAATCCTAGGTAAAGAACCTTTCCTGGATTAAAAGATCATCTCTTCTAATTTAAAC
TTAATGTCATTGCTTTCTATTATGTCACCTTTTTTTATTAGTACATAAGGAGGCTTAAGT
GGGTAGCTCCAACTAATACTTTTGTTCACTGAAATTATTAAGAAGTGATTTGGTCTTTAA
GCCTATTGATAGGATCTTTCTAAAACACATATATTTAGAAATATCTTCTAACATTAGAAG
ATAATAGAAAGAATTTTCTGTATTTTGTGAATTAAAATGATTACGAATAAAATATTTTTA
TTTCCAGGACATACTAAAGGATTCCATACCTTAAGGGCATGGAATATGTAATTTACTGTT
GTCTCAATAGCAAGTAGATCTGTTAACAAAGGGAGTTGAACTTTCTTTTTTTTTTTAATT
TTTATTTGGTCATTTACAAACATTATTCATTGGAAACAAAGATCATTTTCTTCTCTCCCC
CCTCTCCCCCCACCTCTCCCATAGCCCACTAGCAATTCCACTGGGTATCACATGTGTTCT
TGATTCAAACCCATTTCCATGTTGTTGGTATTTGCACTAGAGTGTTCATTTAGAGTCTCT
CCTCAGTCATATCCCCTCAACCCCTGTAGTCAAGCAGTTGCTTTTCATCGGTGTTTTTAC
TCCCACACTTTTTCTTCTGCTTGTGAATAGTGTTTTTTAGATCCCTGCAGATTGTTCAGG
GACATTGCACTGAGACTAATGGAGAAGTCCATTACCTTCGATTGTACCACAGTGTATCAG
TCTCTGTGTACAATGTTTTCCTGGTTCTGCTCCTTTCGCTCTGCATCACTTTCTGGAGGT
TGTTCCAGTCTCCGTGGAATTCCTCCACTTTATTATTCCTTTGAGCACAATAGTATTCCA
TCACCAACATATACCACAATTTGTTCAGCCATTCCCCAATTGAAGGGCATCCCCTCATTT
TCCAATTTTTGGCCACCACAAAGAGCGCAGCTATGAATATTCTTGTACAAGTCTTTTTCC
TTATTGTCTCTTTGGGGTACAAACCCAGCAGTGCTATGGCTGGGTCAAAGGGCAGACAGT
CTTTTAGCACCCTTTGGGCATAGTTCCAAATTGCCCTCCAGAATGGTTGGATTAATTCAC
AGGAGTTGAACTTTCTTAACAGACATTGGTTTTTATCTCATTAGGTATAGGAAATTTCTT
TTATGTTCAGCCCTAATTAAAAAAATTAATTTTATGATGTTTTTATATCATCTATTTTTC
CTACCTGATTCCTCCATCTCCTTTCCAAAGAGTCAAAATAACAAAGAGGAAGAATTTTTT
TTTTTAGCAAAATTAACCAACATATTGAAAAGAATTAACATTATTTGAAGTATTCCATGT
CAATGGACCTCTGCAAAGGGGGTGAGGAGGAGGAGGGAGGGGGAGGAGAAAGATTCCTTC
TATCTCTTTGGAGCCAAGTTCTTGGTCATTTAGAATTTTGCAGCATTTAGTTTTTGTTTT
GTTTTTATTTCCCTTTATATTGTTGTAGTCATTGTGTATGTTGTTTCTCTGGTTTTGTTT
ACTTCACATTGTATCAGTTCATATTTTTTCTCATGCTTCTCTAAATTTGTCATAGTCTTT
GTTTCTTATGGCATTGTGATTTTCCACTACAGATACCAAGTACTATGCCAAGGGCTGAGG
GTACAAATACAAGTAAATAGTATAGCCTTGCTTTGAAGGAGCTTATATTTTAACAAACAT
ACATGTACATAGAAGAGAGCTGGAAAAGGGTTATAGGCATAGAAATAATTGTCTGGTAGT
GTTGTGGAGGCATGGTAGAGGCCAAAGCTTGCTGATCAGTCCCAGGGTGGCTCCAGGAAT
GGAGTCTAGTTTTTTAGGAGGGAGGAGATGATGAGATGATGGCCCAAGTTGAGATCTCAT
GTGATAGAGATAGCCAGATGTACTATTGAGGGTTGGGGTCTGAGCAAGATGTGACCAAAG
CTTATATTCATGTATCACACCTTGTTTGATGTAGCCCCAATTATTTTAATCTGTTTAATT
ATGACCTTCCTCTCTTAGGAGTATTTTTAAACTAAGTTCATCAAAAGTAGAAGTTGTATA
GCTTCCCCACCCCATGGTGGGATAGAACTATCGCTTTTGCTTTCCTGACTCTGGAAAATT
TCCAGCCTTAGTCAAGTGCCATCTAGAAATGCAGGAAAGAACTGTTAGTATGGAGCTTAA
GGTCTGTGGGAAATTCTAAAAAGAAACAACTTCTTGTAATTGTCATAACATTGATTTATA
TCCCTTTGTTAAGAGATCTGTTTAATGTTGAGACAGCAGTAAATTACATATTCCATGCCA
TTTAAGGTATGAATGAATCTTAGTATGTCCTGGAAATACATATTCTTTATTTATAATAAC
TTGAATTCAGGAAATACAGAAATAATGATTTCTACTCCTTTTCTCTTAGTGATGCAAAGC
AACTGTTCATTAACAAATTGGGGCTGTTTAAAGGAAAGAAGCATTACTACCATAGTGTTT
GAGGAAAATTGAAAATTATGACTGTACAATTATTAGGCATAGCTATAATGAAGAACAAGA
TGTAAGAAATAATCCTCATTGTGTATAAGTATTAATAGGAACAAGAGATATGAATATCCT
CATCTGATACCTCTTGATGTGAAGGTCATGTTGGGTTTTTGAGGGATCTGTCAGATAATG
CTAAGTTTTGGAAGGTCCAGAATTTGGAGAAAGATTTGGTGATGTAGCATGTCATCGTGT
GCATGGTTACCTGGCCTGTTGGTTCATCCATCCATCCATCCTTCCATCCATCCATCCATA
CATCCATCTTTTTGTCTGTGTCTTTTTATTGTAAGGAACTAGCAATTTTTGGTGAACTGT
TGGCTATAGAGTGACAAATTTCTCAACAATAGCAGTTTGATGTACATAAATATATGTTTA
TCAGTCTAGAATATTGCAAAAAGTTAGGTAATCATTGAAATTTAGACTATTTTTGAGATC
TCTGAATAATAACATAGCTGTTTATCAAGAACCATCTGTATCATACAGATTATTGCAATG
GCTCTATCACAAAGCTGAAGGGTAAATAGCTTTAAAAAGCAAAATTTGTGAATTTGACTT
GGGAAACCAATCACAGAGTGACAAATTGAGTGCAGCTTTCTTTCAAAGTGCAACCTAAAT
AAATAGTGGTAAAAATAAATATTCTATATAGCATATAATGTGTTGGACTCTTCAATATAC
TATTGCAGTAAATTTTTTTTCTTTAAGGAAAAAATATATAATTTCAGAGATTTAGAGCTG
GAAGGGATCTCTTCTAGTTTAACTTAATATTCATCATTACCTGAAGTATGGGGAGGTTAA
CTTAGCATAGGTCACCACAACTAGTTAGTAGTACAACCAGTAGAAGAATCAATGTTTTTT
TTTCCCCTATTATGGTGAGTTAAAAGGCATAGCCTAATTTGGTTAATTGTGTTGTTTGGA
TTTGTGTGTACATGTATTTATACATTATAATGAATTTATTTATTTTTCTTAAGAGATCTT
CCTTTTCATTCAGATTCATTCATTCTTTGGCTTAAACATAGGTTTAGCAAAGTCAGTGAT
GTACTGATATTTGTACAGTGATATTTGTATATCTGTTAGCCCTATGAGCTAAAAGTCCCA
TTTCTGGTCTATTGTTATTTTTATAGCACCTAAACATTGTTGCAATATAGCACTATGTCC
TGCTCAGTAGCTCTTCTTCAGTAAATATTTTTTGACCATTTCTTGTTTGAAATATTTTTT
TCTGATATTTGATAAAGTTAATGAGGACTTTTGGTTGGTACCTCTTCTCACACATCAATC
TGTCTGTCTGTCTATCTATCTATCTATCTATCTATCTATCTATCTATCCGCTTATGTAGA
TATAAAACTATCCAAAGCTGTACAAATATCAATATCTATAGATATGTTACTAAGTTGACT
TAAAGTACTAACACTAAAAGTTTTAAAATATTTTTCTCTTAAACATAGAAAGAAAAGATC
AGACATTTCTAGAAATTTTTTCCTTTCTAATATTTGTAGTTAAATAATTATTCTTTTTGA
TTCAATCTAGAACAAGCACTGTTTTAGATGGAGTCAAAAAGAATGTTTTTGTTTTGAAAT
GAACCCTCTTGGTAGTGTTACCATTTATAAGGTTATTATTTTTAAATTCATGAAATAAAA
CAGAATTACAAAAGGAACTAATTATATTGAAATACTAAAATACTGAAATTGAAATATTTT
AAAAAACAAGCTAATGAACCTCAGGTTAAAGACTACAAGAGGGAGCAGTAGAACTTGATA
TACATGTATTCTGTTGTGTAATCTGTTTCTGTCTCACACTGCATTTGTCTTTCACTTGTC
TTAATTCCTTCTACCCCTCAAGGTTCTTTATGATTTATTTCTGTTAAAATATTAGAAGCT
ATTTTTAAAAATTGCATATCTCATAGTGTATGTACTTGGTCCAAATGCCAGGTGAATTGT
TACATTTCAAATACTTTTTGATAGTATTTGAAAAGGCTACTTTAAAGTTATTGACCTATA
GAATACAGTCAGATTGTGTTATTTTAGTTAAATGTACTATTTCAGTTAAATTTTCTGCTG
TTAATAGACATGCTTTCTGGGACTCTGTCTAGGTTTATGCCAACTTTGAATTTTTCCTTC
TCCTTTTTTAGATATTTTTGTGTGTGGAATTGGGCACTTGATTGAATTAGGAGTTGGATT
TCACCTTCTATAAAATATTAGTGTATGTTTTCTAATTTGCATTTGTATGCAGTTTAATGA
ATAAAACTCACAGATTGGTTAGAAAAGAAGCCTCTGTAGCTGAAAACTTCAGAGTAGGAC
TCAGCCAGATTAGAGTATAATTAATAAATATTTAACAAAGTAATTAAAATACCATAAAAT
ATTGATCATGTTAAATTATGGTTTTCTAAGTTAATATGTGGTAGGATCTTTTTCTTTCTT
TTTCTTTTTTTTTAAACCCTTACCTTCCGTCTTGGAGTCAATACTGGGTATTGGCTCCAA
GGCAGAAGAGTGGTAAGGGTAGGCAATGGGGGTCAAGTGACTTGCCCAGGGTCACACAGC
TAGGAAGTGTCTGAGGTCAGATTTGAACCTAGGACCTCCCGTCTCTAGGCCTGGCTCTCA
ATCCACTGAGCTACTCAGCTGCCCCCGATCTTTTTCTATTTCAATGTGACATCATTGCTA
TAGAAGGTAAGGAAGGATACTAGGGACTAAATAATGTCTAAAAGTACTTCTTAACTAAAA
AAATGTATAATTCTTTGTTTCTTATCAAATTACCTAAGATCTGAAATCTTTGCCTTTTAA
TTGAGAAATTTAACCATGTGTGGTCATATCTGTACACATTCATGATACTGAAATAGATTC
TGGGCAAAAAATATTACTTTTTATATTTGATGATAGTTATTTCCCAATTTTTTATTTATT
TTACAGTTGGAGTGCCTCAAGCTCATTGCTTCTCAAAAATTCACAGACAAACGAATTGGC
TATCTAGGGGCCATGCTGCTGCTGGATGAGAGACAGGATGTACATCTTCTAATGACTAAC
TGCATCAAGAAGTGAGTCAGTTCCTTTCCTCACTCCTCATCTGTAATGGCATGTTGTCAT
TGATAATGCATGATTAGAATCATAGATTTAGAGCTGCAGGAGACCCTTCTGGTCATCTAC
TCTCCTGGTGTTAGAGGTGAGGACCTGAAACCCAGAGAGAGACTAAGGAATGTGTTCAAG
GTTACACAGGTAGTAGGTGAGTGATGAAGTTAGGATTCAAACTAAGGTCCTCTGACTCCA
AACATAGCACTCTTCCATTGACTTAAAACACCCCTATACCTCTTTATTTGAATTGTATTT
GATTTTAAATGACCTCTGTGTATCTAAGCTGGCTCTGGAGAAATTTGAAACATTGATATC
TTTAGAAAATAGCTCGTTTTTAATTCAATTTTGCTTTATTTCCAGCTCTGATTTCTGTCT
CTTCCCCTCATCATTGAGAAATTAAGAAAAGTAAAGTCCATTAAAAACATTTATAGCCAT
TCTTGTATTAGCCTTGTCTAAAACCAAACCAAACAAAAACCCCTCAGTGTTCACTCTGAG
CCCAATGCTGGAATGGATATCATCTTTTATCATGAATCCTCTGGGAGTATGGTTGGTCTT
TGTATTGAACAGAGTGCCTAAGTCTTTTATAAATTTTTATCTTTATAGTATTGTTATTGT
ATGAATTGTTCTGCTCACTTAACTTTGCATCAGTTCATACAAGTCTTCCTAGGTCCACTG
AAACCATTCCTCTTATCAGTACAGGTATTGACATAAATCTCAGGGTGTAGAGATTCCTTC
AGACTTAGATCTGAGAAATAAAGTTTGTGTGTTGTTATGCTCCTCCCCCCAAAATACAGA
AAAAAAATTCAACAATTTACTATTTACTTCCTACCCCATCTCTTCAGTGATGTAAATAAA
AATTTGTGGTAGTAATTCTTTACTAAATGAATAATGGAGGTTGCTATTAAGTACACTAAT
TTTTAGAGAGATTATAAAAGGTGAGAGAAATTTTTACCTTATTAAAACATCTAGTCTCTG
AGGTTTCAATTGTACGGAATGCAATTTAGTGACAAAATCCTTCGTCTATTTGGGTTTTGC
TTTCCATTAATGTATATGTATATGACAGAAAGTACATTTGTGGTAGTAGATGAATTTGAT
GTAAAGGTACTCATTTTCCTCATATATATATAATGTTCTACTTTTTTAACTTTTTTTTTC
CTGTAGTTGAAATCATGAAGACCTGAGTTCATATCCACCCTCAAATATTTATTAGTTGTG
TGACCCTGAGCAAGTCACTTAACATCTGTTTTCCTTGGTTTCCTCAACTATAAAATGGGG
ATGATATCACCTTCCTTGCAGGATTTTTTTTTTCCTTGCAGGATTTTTGGGAGAATGAAT
AAGATAATACTTGTAAAAAGCACTTAATAAATGTTTATTACCTTCCCTTTCAGCCCTTCT
CTTTTCCCCTTGAAACTTTGAAATGGAACTGTAGAAATGTAATTACGTTGTAGCTATAAA
ATGTCCTCTAACCCACTGGGCAGTGTTTGTAAACTGAGTCTTCAATGACTTCTAATTAGC
TTTCAAAAATATATTGATGAGAAAAGTAGTATGTTGATAAGCTATCTAGCCAGTTTGACT
TGTCCTATCCTGGGATAAGGCCTCTTCTCCTCCCACTTTTTATGCATTCCCTGTAGCTAC
ACTTATCACTCAAATTTTCAACCACATTGCTAATAATGTGGTAGTTCTATAGAGCAGTCA
GTTCTTTACATCTGAGTCAAAACTAAATCTAAGTACAAATGCTAAAACTGATAAGTTGAA
AAGAATGAAACATGTAGTCAGAGAGCAAATCTAACTTTTTATGGGACTCTGTGAAATCTT
ATTCTTTGAATTCAGGATTGTGAAATCCTGAATTTCATCTTTATTGAGACAATAACATTA
GTCCATATAATTTGGAAATGAATTCATAGTCCCATGACAATCTTAACTAGTTAAAATTTC
TTGGATTATTCAGATATTCTGTAATTACTAGTGACATTGAAGACTTCTATACCCCCTTAG
CAGTTTTTATATTTGCTAATAAGTTACGGAGAAAACAGTATTATTGGTAAAGAAGTAAGT
TCAGATTTTTTTTTTGGCTTTAATTGATGCTCTAACTTTTTGTTAGTGAAAAGATCTTTT
AGGTGTGCATTAGTTAAGAATACTAATTGTGCAAAACTTATCTTTTTCTTTAAGTGAAAA
ATGATTTTTACATAAAAAAGTGTGTGTGTGTGTATGTAAATACACACAATTAAAATGCAG
TCAATGCAAACTATTTTTAGATATTAGGCAATATCAATAGCATATAAGTGTGTGTGTATA
TATATACATACATACATGTGTATGTATGTGTATGTATGTATGTGTGTATACACACACACA
CATATGAGAGAGAGGGGGGGGGGGGAGGGAGGTGGGAGTGCCAGCTAGCTACAGGTAATC
TCAAGACTTAATTTTAACAAGGAATTTCAATCATTTTGATTTTATTCTGAATTTTTGAAT
TTTTTTTTTTGAATTTTGAATTTCATTTTGAATTATTGAAATTTTATTTCAAATTATTGT
CAGAGTTGTTGATAAGCAGCAAAGCTCATTAATTTTAGTTTCACCTTTCTATTCTCTTGG
AGGAGTTAATGAGAGAGAGATAGTGTGAACTAGTGGATAAAATTCTGGTCTTGGAGTTAG
GAGATCCATGGTAAAACTTTGAATACTTAGAATGATTTCTTTAGATTTTATGATCTTCAT
AGAAATGAGAATTAATACTTTGTGTACCACCTGCCTTATAACAGACTTGTGAGGAAAGTG
TTTTGAAAACTTTGTATTATTATTTAAATTTTAGGTGATAATGGTGTTAACAATGAAAGT
TAAAGAGTGAGAAGAGAAATGTGATTGGAGAAGAAAAATTATTCTGAGTCTCTCCTCCTG
AATATCAGAGAGCTAGATTTAAGTATTTTAAATTATAACATGTTCATGTTTTTTATGTGT
GGTATTGCTGGGTAATTTAGAAGAATTAGCTATATTAGCCAAGACTGTTGAAAACCTGTC
TTTGTAATGTAGCACCAAATCTCTAAGACCTATATTGAGAGACTATATAGCTTAGTTGGT
GACATTTGTCTGATTGGGCATATTAGTAAAAACTATAGAAAAGGATAATTCTTTTTGTGG
AAATCAAATGAAAAGGAAAAGTTCCTTGTTTTAACACAAAATTTCTATATTGAAACATAA
GAGCAGATAGCAAATAATTCCTATTATGAAACCTCTTTTTTCTTGAGTTTATGCATGGAG
TGACTGAGTTAAAGGTATTATCTGATTTTTTTCATGGAGCCCTTCACCTTTTTTTAGGGG
GTAGAAGGGTGGTGTCACTTGGTGTATTATGAAACTGTTCTTTCAAAAAACAAGATTTTG
TGGTATGTTTATATAACTATTTCTGGACTTGAAACAAGAAATAAGTGTTTGAATCCTGAT
TCTGCACTTCAGTACCTGTGTGATCTTGGACAAATCACCTACTCTCTCTGGGTGTGTTTC
TTCATTGATAAAATGACATCTATAAAATGTCTAGAACCGTAATCCTGCTATATAGAGTAC
TTCAAATTTCTGGAGTAAGCATGGCTTTTTGTTAGGCACATTGGGCTACTGTGAAACATT
TATGATTATGTTGGTAATTAATAGCTAGCATTTCTATAAAGCTTAAGGTGTACAAATGAC
ATCACATGCTATATTCTTTGATTCATTTACACAACAACCCAGTGAGGTAAGACTATTATT
GGATAATATTTAATATGTAATATTTTTATTTTACAGAAATGTTAGATAATTGGAATCAAT
ATTTCCTGGGATTGTATATTGATAATAGGAGAAATTCTGAAATCTGTTTTTAAGATCAAA
GTTCCCTAAACTGCATGCAGGCTTATGATCTTCTTGATTTTGGACAGTTTGCTGGGGCTT
TGGACAAGACATAGAGAGTTACTTTCATTTTTATTTTCTTTTGCAGTGACCTTAATCATA
GCACGCAGTATGTGCAGGGGCTGGCACTCTGCACCCTTGGCTGTATGGGTTCCTCAGAAA
TGTGTCGAGATCTTGCAGGAGAAGTAGAGAAACTCCTTAAAACTTCCAATTCTTACTTAA
GAAAAAAGGTAACAGGTTAAAGCTAATTTTGCTTCTTCAAATTGGGAAATCCTATAGAAA
AGAGAAGGCAAATGATTTCTTTTTTAAGTCTCTTGACTAAAAAATTTAGGTGTATCTTAT
TTCTTATAAAAAATGGGCTCCTAACCAATTGTGTTTAATAATTTGGAGTCAGAGAACCCG
GGTTTGAAAATTACCCTTGGAGCTCATTGCTGTTACTATGACCATGGGTACTTTATCCTC
TTTGAATTTTAATTTCCTTGTCTATAAAATGAAAAGAGTTTGACCAGATGATCTCAAAGG
CTCCCTCCAGCTCCAAATCCTTTGATTCTTAGTAACATTTTTCAGGGATGATTTATCTTC
ATTTGTTATTGATGTCCATTTGGTAGTGATTCTTAATTGTTTAGTTCTGCTGGTTTTTCC
TCAAGTACTTAATGGTTTATAAACATTTAAATACTTGATAATAGGCATTATTTTAATATA
TCCATCTTTAATCCTATTTAAATAATAAGCTCTTAAGTGAGCTGATAATAATACTAAATT
AGATTGACACAAACGTGTTAGAAAGCTTTGCCTTATTCACTCTTCTTAAGTGAATTGTTC
TATAGTTGATGTTTTTGAGAAATAAAAAGCAAAAATTTTTTTATATTTGGTTTCTATATA
TCTACCGAATAAGGGAAATTCTGTAGGACTCCAGGTTAGCTTAGAGAATGTGATATAGAG
CACACTTTTAAAAATTTGACTTAGTAGATGGAGTAGTAACATGATAGTTGTTAATTTTAT
ACTTGCTGGCTTTTCATCTTTTATTTTTGCCTATGTAAATATTATAATAATTTTTTTGAG
CTGTGATTGTAGAACTCTTAAAGTATTATGCTTAGAACCTTCAAAATTTTTTAAATTTTA
TTACATAGTATATGTGTCTTAGCAGTACAGTGATTTAAAAATGTAAATGGAATCTACTTA
AAATCCTGTGCACTTAGCACATTATTTAAAAAAAAATCTCCATTCATTTCCAGTTATAGT
AATATTAATAGCAACTCCATTACTCCATTAAAGCAGTCCATTGAAATACTTTCTTTTAAG
TTGGATAACTGTTTTTCACCTTTCCTCCTTGGTTTTGTGGTTCAGTGCTTGAGTTTTAAT
TCAGAGCAGTGTTATTGTGCAACAGTTAATTATGTTGAAATAAATGTGGCATATCATGTC
ATAAAGCTTTAAAAAATATCTTAAAAACTAATCTGCCCCTAACATTATTCCCTTCCCCCC
TATTGGAACAAATGATAAAAAGACTTGAAAAATATTCCTCAACAGAAAGCTACAAAGAGA
TCTTTGTACCTAGAGGTCTGTGGTTATGAGCCCATATCATAAAAGAAGAGTGATTCCAAT
AAAATAAATCACTACATTGGCCATGTCCAAAAATGGGTGTTTTTTCTACATTTTAAGTTC
CATCACCTGTCAGGAGGTGAATGGCACACTTCATCTCAAAAAAAAATTTTTTTTTTTTAA
AATTTGAGGCTTATCTTCGAGTTGAACAGAATTATAAAGGGTTTCCAAATTCTCAATGAT
ATCATTGTATAAACTATTTTCTATTATTTTTAATAAACTTTTTCTATATTTTTCTGCTCA
TTTTGCTCTGCATCAATTCATAGAAATATTCTCAATTTCCTCTGATACTGTCCTACTTCA
TCATTTCTTGTATCATAATATTCCATTACATTAGTGTACTGTAATTTCTTTAGCTATTCT
CCAGTAGGAAGACACCCCTTTACTTTCTAGTTTTTGGCTATACTACTTGAAATATAAGAA
TCAAATATGCTGTTTTGTTTGCATTATTCCCATTTTATTGCAACTGTAATTAAAGCCTAG
AAAAGGCTAAATTCCTTTTACTTTTAAATATACTATTAAGGGTAGAATTGAAAGTGGTAT
TGAAGCCTTGACTGTAAACCAGCCCTTGTTTCTATAGATTATATGCTTACATTATTTGTT
AAGTTAAAAGAAAAAAAAATTTCAAGTATAATGGGTAGAGTTAGTACTTGCCAGTATATT
TTAATATACGCTGTTAGGGTTTAATTTTTTTAACTTATAATCTTTGCATCTTATTTGAGC
CTTTAACCAGTCATCTGTGTTGTAGTTGCCTTTGTGCTTCTTACTTCATTTTACCTGTGG
TCACCAAATACCAGACAAATCATTCTTCATGTGAAGAACACCTTATGCCAAATTTATTCC
TTTTAAAAACCATGCATTTCTTATAAAACTAGTAACCACCTTATTTTATTTTTATTCTTT
TGATTTCTAAGAATGTGTCACTAATTAGTCTATTAGTCTAAGAATGTGTCACCTACTAAT
TAGTAGGGGGAAAGATTGTATATGATATTGTGATACAGTGGAAGCATAAATCATAGGGAT
TTTGGTGAATGAGGGATAACTGGAAGTTCTATAGACTTAAAAAACAAGGAGAGGAGCAGA
GCCAAGATGGTAGTGAAGTAGCAGTGAAATCCTGAAATGGCTCTGATTATCCTTTTAGAC
CAATCTTTAAAAGTCACCTCAAAAGGACAGGAATCAAAGCAGGATGAGCAGGGAGCTCTC
CCACTGAAAACAATGTGAAAGTTAGGCATAGAGAGTGGATTTCCATCATATCAGGGGTAA
CTGAAGGCAAAACTGCACAAAGAAAAGTGCAGGCTTAACTCCGCGCCCCCCCCCCCCCCC
CCCCCCGACACAGAAACAGAACCTAGGCAACTATGGGATCCATAGACATGGGCTATACCA
ACAAAAGAGCACCACAGATTCACCCCTGGAAGTCCCAGACCTGAGCAGAGAGATTTGGAG
CTCCACAGCACTAGGTGCTCTCAAGATTCTACTATTGCAGTGAAGATAGTCTGAGTACAA
AACACTATGAACCAGGACCTAGGTAACTCCAGAATCCCCAGAGGTAGGTTACAACAAAAA
AAGAGCACCTCAGACTCACCCTTGGAAGTGACATTCAGAGCTCAATAGCACTAGACCCCA
CTCAAACCTCTGCAGAGGCCGTGAAGATAGCTGTAGGGAAAAACTCTGCGAGTTAGTCAC
TAAAGCAGAAATGGCCAGCAACTTGTAGATCTTCTGCAAACAGCAGCAAAAGAAACTTTT
GACCCTTGAAAATTTCTATGGGGAAAAATAACTCAAAACAGAAGCAATAGGAGATGGTGA
GAAACAAGCAAATACATGCAAAATCTCCGGGAAAAAAATGGGAATTGGTTGCAAGCTCTG
TAAGAACTCAAAAGGAGTTAAAAAACTAAAGACAGGTAGAAGAAAAATGGGAAAAAGAAA
TTAAAGTAATGCAAAAAAGAAAATTAACAGTTTAAAAAATCAAAATTAGTCAAATGGAAA
TGTAGACACAGAAATCAAATGAAGAAATAAACAGATTAAAAACCAGAATTGAGCTCCTGG
AAGAAGAGACCAAAAAGTTTAATTAAAAAAGAGTGACATGAAAAGTAGAATGGACCAAAT
AGAAAAGGAGTTTCAAAAGATCTTGGAAGAAATTCAGTCTTAAAGATTAGAAATAGGTAA
GTAGAAGCTAATGACTTCATGATACATCAAGAAACAATATAACAATCAAAAGAATGAAAA
ATAAAAGAAAATCTGAAATATCTTATTGAAACAACAACTGACCTGGAAAATAGATCTGGG
GAGACAATTTGAGAATTTTTGAACAATCTGAAAGTCATCACCAAAAAAAAAAAAGGCTAG
ACATCATATTACAAGAAATGATCCAAGGAAACTGCCCTGATATTCTTGAACAAGAGGACA
AAATAGTTATTGAAAGAATCCACAGATCATATTCTGCAATAAATCCTCAAATGACAACTC
CCGGGAATATTATAGCCAAGTTCAAGAGCTTTCAGGCCAAGGAGAAAATATTGCAAATGA
CCCCAAAGAAACAAGTCAAATATCATGGAGCCCCAGTCAGGATTACACAGGATCTGGCAG
ATTCCATATTGAAGGACCACTAGGCTTAAAAAATAAGATATTGAGTGTACTTAGGATACC
CCGTATCCTTTGCTCACACTTCTTAGAAGTGTGAGTGGATGAAAATGTATAGTGTCAAAA
AGAATACACTCCTAAATTAGTCACTGGATAAATTGCCTTCCATGACTTGTTAATTGATCA
TGCAATTGGTCCTAAATGCTTTGCTTTGAGAGATAGCAATATGAATATAGGATCAAGTGA
AGAAGTAATTAGCTTTAATGCAGTAGTACCATTAATTTATAGACAAGTTTTTTTTTTTTT
GGTAACCATCAAGTACTTCTCAATGTATTCATTTTTTAGAAGTAGTTATTAGTTACATTT
CATAAAGATAATGATTTTGATTAAAGCAAAGGGACCTAACATTTTGTCACTTTATTTCCT
TATAGGCAGCACTTTGTGCTGTACATGTCATCAGGAAGGTACCTGAACTTATGGAGATGT
TTTTGCCAGCCACAAAAAATTTATTGAATGAAAAGAACCATGGTAATATCTTCTTAGAGC
TTTTACAAAGTGTTAGGGGGGCAGGGTTGGGGTTGGAGTCCAGGACTATTTTATGTAAAG
GTGAAAGAAGTTGTTATTTGACTAATACCCCTTGATGGGTTCCAGTAAGGCCCTTGTGAC
CAAGAATATTTTTCATAACAAGGTACTATAGTGCCTGAATCTTATCATCATTCTTTGAAC
CAAGAAGAGTTATTTCCCTCTAGTCTTTTACAAAAAAAGAAGAGGCAAATGCTCTTCTGA
GGCTAATATAATACATTATAATTAAAGGGCAACTTAGTACATTTTCCAGGGGTTGATCTT
TGTTTCTGGAGACCCATGGTTTTAAGCCCATTTCATAATAGTAGTAAATTTTCCATTGTG
TCAGGGGTAGGATTGATGATAATTGTTTTGGTATCCTTATAACAGGTAGGAAATTTATAG
AAATTTCAGAAGAATTAAGTGGAATTTGTAATTCTTCAAGTATTTGTGATTTCTTTTTTT
GAAGCCAAGAAATAATGAGTAAGGAAGTTCTTTTTTGAATGACTAAATTGCTTAATTAAC
TTATTTTATTTTCTACAAAGTGTTGCATATGTAAATGTTGTAGATTTCCTTTTTTCGGGG
GCAGCTGGGTAGCTCAGTGGATTGAGAGCCAAGCCTAGAGATGGGAGGTCCTGGGTTCAA
ATGTGGTCTCAGACACTTCCCAGCTCTGTGTCCCTGGGCAAGTCATTTGACCCCCCATTA
CCTAGCCCATACCACTTTTCTGCCTTGGAGCCTATACACAGTATTGACTCCAAGATGGCA
GGTAAGGGTTTAAAAAAAAAATTTCCCTTTTTCCCCCACCCTGGGATTTCCAAAAGAATA
TCTTTCCTGACATACAAATATATGTAGGCTAGAATGAAGTTTTAGTGTAGGCTTCATCTG
AAAATTTAAAATCTGTCTCAGTTTCTCTCTCAAATCTCTTATCAACTAGCTTTTAATAGC
TTAATAGTATATACCAGATAGATTTTTGTATCTCCTGAATTTATAATTGTATGTGTTTTC
CTATGGGTATTTGAGGGATTGAAAGATTTAAACAAAGTTTCTAGCAAAGTTAAACAATAT
ATGCCAATACTGGTCATATAGTAAAGAATGTCATGCTATCTTGGTTTGACAGTGAATTGA
TAAATATTTATTATTTCAAAATAATGAAAATAACAGTACTATCTAAATTAATATATTCAG
TTCCATACCCATCAAACTTCCAAAGGATTATTTTATAAAACTAGAAAACAGTAATAAACA
AATTTATCTGAGGGAACAAAAGGTCAAGAATTTCTAGAGAAATAATTTTTAAAAAAGGTG
TAGTAGCACTACCAAATCTTAAACTATACTACAAAGCAGTAAAGCTATTTGGTACTAGTT
TAAAATGAAATAGATTAAGTATACAGCATATAGATGCAGACAAACATTGTAGTATAATGT
TTAATAAACCTAAACACTCTACCTACTGGAAAATTGAAAGTGTGGAAGAAATTAGGTACA
AACAACAACTCACACCAAATAGCAAATGGAGCAAGACTTAAATATAAAAGACAACATCAT
AAACAAGTTAGAAGAATGAAGAAGATTATACCTTTTTGCAATTATGGCCAAAGGAAGAAT
TCATGACCAAACAAGGAATAGAAAGTATCAGATAAAAAGGACAATTTTAATTACTTAATA
TTGAAAACGATTTTGCACAAACAATACCATTGCTGGTAAAATTGGAAGGGAGATAATTAT
CTGAGGAAAATGTTTGTAATAGATTTCTCTGGTAAAGATTTCTTATTCAGGATATAGAAG
GAACTGATTCAAATAAGAACAAGAACTATTTATTTAGTCAAAAGATGAACTAGGTGTTTT
CAAAGGAAAAAAACCAAGCTATCAACAAATATGAGGGGAAAGGCTCCAGATCCCTAATTA
TTAGAAAAAATGCAAATTATAAAACAACTTTAAAATTTTGTCTCATACCCATCAATTGGC
ATATATGAAAAACAAAAATGAAAATACTTGATGGAGCAGTCAACACTCTATCACACCCCT
TGGGGTTGTGTAGTGGAGAAGATACAAAAGAAACAGAAAGTCAGAATTGTTGCTTTTGAG
AAATTTATTCCTAATTGTCATTAAGCTGATGAGAGTGATGTAGCCTAATTCATGCCTCCT
ATATATATTTTTTTCTGTTCAGGTGTCCTTCACACATCTGTTGTCCTACTCACAGAAATG
TGTGAGAGAAGCCCAGACATGCTAGCACATTTCCGAAAGGTAAGGTGTAGAAATCAATAT
GTTTCTAAATGAACCCCCTTTTTTCTGTAAAGTACATGAATTTTCTTATCATCAAACTTC
TTGTTGTATGGAAGGAAGTTGAGAAGCTTAATCTTAGAGGATGATTTAGCTAGTTTTTAT
TTTGCAGTTGGATCAGGAGCCAGAATATGTACTTGAAGGCTGACAGTGTTGTTTGTCTTT
TGCCTTTTTCGTGTTAAGAAAGAGGTTTTTCCAAAAGTCTGACTTTTGGCAGACAGTAAT
CTCTGTTCTGTGTCCATCTCTCTTTTTTTTTTTTGCACTACTGAAATAAAGTGAAGTAGG
AAATAGTAATTAGATAATTTGTGGCAGTCAGTTTCTTTGTTCTTAAATTTTTGTACCCCA
AATATTAAACTGAAGCTTTTTCTCCAACTTTTCCAGTGTCTCTTTTTTCCTTTACCCAGT
CTGCCTCTTTACTGTTTGTTTTAGGCAAGTGACTCCCCATGTATGACTTTAGATATTTTT
CTTCCTTCCTTATGGAATAATGAGTTAAAAATATTTCTGCTAGTTGTGATTCAGGCTATA
AGGGGTACGAAGAGAGAGTGGAAATCTTCTAGAAACCTTTTGTCTATTTAATATATGATA
AAAGTATTGAAACCCTTCATATATTAGAGCTAGTGGAGTTTTGACAGTTTTTTTTACAGT
ATTTTTTTTTCTTCTAGATGTGTATGTCTTGATTAAATTATTGTAAAATAGTATGAGACC
CGTATCTGTCCCTAATGCTTGCTTTATGTGTTTTGTTCCTGTTTTCTGTTTGGAATCCTG
CTGTATGTTAGAATGAAAAGGTAAGAATTAACCCTCTTTTAGATGGTGCATGCTGGCATT
AGGTCCTTAGAAGCTTTTGTGTATCCATCCACAAATGCAGCCATGATTAACTGTAACACA
CTAATGCTGTGGCTCTGCTTGTGATTTATTACATGAATGATCTGTTTTAGTTTTTATTTT
GCTAACTCCTTGTAAGTCTTGGGTTTTTGGTCTTGCCATTTAAACTCCACAATCAGCCTT
GGATTTCAGTTGTCGCCTGTTCTGAATTAGGAGCCTATTTCTCTGCCATTTCTTCTTCCC
CTTTTTGAGAAATGTTGAATGGTTTCCCAGTGACTTTGGTCATTCTAACCCTGGGTTATT
TTGGACATAAAATTTTTTTACTTCCTTTTGAAATAGATAAAGGAAGCCAGGAGAACTAGA
CCCTTTGTAGGGGGAATATGGACAGCTTCTTACTTGAGAAGCTCTGTAGGTAATTCTGAG
CAATTACATTGAAACTTGTAGCAGGCCTTTTTCACTTCATCTGAATTTTGCTAACAGTGT
TGAATTAGGGGGAATGAGCAAGGCATTGAAGGGGGGGTAAAGTATGTGGGCATTAAACTG
ATCTTCTTGGCTGCTGCCTTTCTCACTGTCCTCTTATTTTGTTTGTCTTGTCATTTGGTT
TTAGTAACTTTCATTGTATTTAAATAAACCAGGTTTTTTTTTAAATTTATTTAAATAAAC
CAGAATTTGAATGCTTAGTACTTAGTCATCTGTGATGTGCTGGCCTTTTGATAGTAATTA
AGACCATCTTTGCTTTGTAGAAGCTTAAAGGGAAAAGACTACTCTGAGTTGAGCCAGATT
TTCTTCATTGTCTTGGAATATGTATAGGACAAAAAAACATGGTCATTAGGGAAATATGTA
AGAAGTTTTTAATGAATATGGATGCTTTTTCATTCTGAAGAAGCTGTTAATTTTTGTACC
TTATGGCTAATGTAAATTTGCCCATCAAGTAGAGAGACTTAATAAGGATTCTATTTTGAT
TTTGCACCTTATCCTTTAAGTTCAAAGGATAGGCTTAAATTAGTTTTAACTGTCAAACTG
TTCAAATTAGATTATGAATCAACTCCTGAGTATTGGCCACATCACTGGAATTCATATTTG
AAAATGAATATTTGAATTGCATGCCTTCTGAATAGCTTAACTACACACCCATATAAGCCC
CGCTTCTCTTTCAACATTTTTTGGAGTAGAAAGAGAACTAGAATCTATATGATGAAGAAA
AATGAATGGAATTAAATAAGAATTATCATTGTCTAAGCCATTTTAAAAAAATCAGGTGCA
ATTCATTTTAGTTTGCCTGGGCCATGCAGTAAGCTAATAACTCCCCTTGGCTCCTGGAGT
TGCTTATTTGGTCCTCTGTATGTTACAGCAAAGCTGAATTTTTCATTAACAGATTTGAAA
AGTTCTTGAAAACCATGTGATATGAAACCTTTTTTAGGTAGCGGGCTTTGGCTAAATTTC
AGGTGACTTTGGTAAACTATATAGTATTTTCCTAGTGTAGAAATGGCTTTAGTTTACTTA
AGTTAATTACTTTAATAATCCAATATAAGCTGTACTTCCTCCTCCCCCCCCCCCCCAAAA
AAAAATTCTGGCTTGTATAAAACTCAAATGTGACCTATAATGGCATTTTAAAAAAATGTT
TATTTTTTCTTATTCTGAACTTGACAAATATCAACAAACATGGACATTTCATTTACAAAG
AATGGAAATTGTTTATGAAATGACAAATTTCTGATTTGTTACTTGTTTATTTTAAATGTA
GATTATGCAATGGATAGAGAACCAGACCTAGAGACAGGAGGTCCTGGTTTCAAATCTGGC
CTCAGTCATGTCTTAGCTCTGTGACCCTAGGTGAGCCACTTAACTATAATTGCTTAGTCC
TTACCACTCTTCTGCCATGGAACCAAATCTTAGTATTGATTCTAAGACAGAAAGTAAGGG
TTATTTAAAAAAAAAAAGACAAATTATAAATTGAACACATTAGTTCCAAAGCTGGTTCTG
CTTGTCTGTATCTCCCTGTAAACTTTCTACTAGTTTCTTATGCACATTAAAAAAATGCTC
TGCTGACATTATTTTCTTTTTTTTCTTTTTATTATTTTGTGGCATTGCTATCATGAACAC
CTCCCCAATTCTCGATTATAAAAAATTAAAAACCTTTCATTACAATAAAAACCCATAGTC
AAGCAAAACAGATGCATATGTTGGCTGTGTCTGAAAATGTATATTTCATTTTACACCTCT
AGTCTGTCACTTCTCTATCAAGAGGTGAGAAGCATGCTTCATTATCAGTTCACTGAAATT
GTGGTTGGTCATTGCATTGATCAGAGTTCTTTTAGTTGTTTTTTTATTTTTTGAAACAAT
GTTATAATCATATATATCTCAGCATAAATGGTACATTTATAAAAACCAATCATATCATAG
GGCAAATTAAACTCATTAACAAATGTAGAAAAGCAGAAATATGAAGCACGTCCTTTACTA
CAGTACAAGAAAAATCATCAGTAAAGGGCTTTTAAAAAATAATTCAAATTTAGAGATGAA
TAAGTTAAATCTTAAAGAATTGGTAGGGCAAAGAACAACTCAGAACTGGTAGACCAGGTT
GTAGCCAAGCCCACCAATCTTTACAAGGGAATTTATATATTACAACTTTCTGGTTAGTAA
AAGAGAGAAAGATTGAACATGCCACTTAAAAAACAAAAGCACATTTCACAAAACCTCATC
TAAAGATAGTCTGAAAATCAGAGATGAACAAATTTGAAAGAACATTAAAACTAGTTTTCC
TAGACAAATGGATAAACCATTAATTAATCTGCTTTTTTAAAAGAGAGGAAAACCAATTTG
CCAGTGTCAAAATTTTAAAAAAGGCATAATAAAAGAAGAGGAAATGAAAGAAATGATTAG
AAGCCATTTTATTCAACCATGTGTCAATAAAACTTGATGTGCTATATATGAATGTTTACA
AAAATCTAGAATGTAAAGATTGATAGTATGATAGAAAATTTAAATAATCTGATATCAAAA
AAGGAAATTAAATAAGCAGTAAATGAATTTTCCCCAAAGCCCAAGACCACCAGGATTTAC
AAGTAATAAATTCTGTTAAACATTCAAAGAATTAGTTTCATTAATATAAAGATTTTCAAA
CATAGGAAAATAAGGGATCCTAGCAGATTTCTTCTGTTATGCCTTTCTACCTAAATTAAA
AAGAGACAAATCAGAGAAAGAAAACCATAAGCTAATATCCCTAATGGATATCTATGTAAA
AATATTGATTCAGATATTAGCAAAGAGATTACAGCAACAAACTGAAATGATTGTATACTA
TATGAAACTGGGTTGTTTTTATATCAATTCAGAATTCATTCAGTATTAAGAAAATTGCTA
ATATATCAGACCATATTAATGTTAAAAATAATCAAAATAACATGCTTATATTAATAAATT
CTGGAAAAGCTACAACTTATTTGTTTTAAAAATATTAAAGTATAAGAATAAACCTGCCTT
TAATATGGCAAATAATATAGAATAAGAATTAGATCATGTTTATCTGATTTTTATGTAGAA
TACAAGAGCTATAAAAATGTCTGCTATTAGTATACTAGGCAGGACTGCTTACTGCAAAGA
GCTTATAGTCTCATTGGAGATATGTTATATATGTGACGACATGACAGTTAAAGTAATAGC
ACAGAAAAGTATATCAGGTGTTTTATAATTAATATAATAGATATAGAGTTATTTAACTTA
TTGATGGTTCTATACATCTTGGAGGTGTATTATTAGATTTTAAAGGATAATGTAGATAAT
ACTTCTTTCTGGAAGAAGAACTTGGCTGGGTTAGTTGTAGTTTTAAAAATTCCTTTTTGT
TGGAAACATACATTGCCTTCTGTTGAAGGATTTTTAACTATTAAAAGATTTTGTTAGTAA
TATAGGTGTGGATAAATGTCATACCTGTTATCTTAATTTTTATTTGAAATAATTGTCTAG
CATAATAATCTAATATATGTATTAGAAGTATCTCCAGTGGTAGGCATTTAAACATGCTGG
GATAAGTTTCTTTACTTGTGGCTCAGTACTCTCTGATTATAGTATTTGTAGTAGCACCAA
GTCTTAAATTGTTAATGCACAAGATTAAGAAAGTAGATGGGTCTTATTTAAATGAAATAC
ATTTCTTAAAAGCAAGCAAATACTTGTTCATTTTAAAATTTCAGATCTATTTACTTCTCA
CTCAATATTATTTATCATTGATTTTTATCATTTCAATTTGCAGACTTGGGAGAAAAACAT
GCTTAGACTCTCTCATGCATCCTTTCCTAAGGCAGTGGATCTACTTCTCAAAAACCCTTT
TTTGATATGGTGATCATTTTTTAATGTCTTTATTTTTTTCAGCTTGTACCACAGTTAGTA
CGTATTCTAAAGAACCTTATCATGTCTGGATATTCACCAGAGCATGATGTGTCTGGGATC
AGCGACCCCTTCCTACAGGTAAGGATAAAAAAATACTTGTCATGCTCTTTTATCTCTTTC
TCTTTTCTTTTTTTTTTGGAAGATTGAACATAACTGCTTTGAGTTTTAGTTTGTTTTTCT
TTTAAATGATGATATCTTTCTCACAGAGTTGTTCTGAATAGCACCCAGTATACTTTAAAT
AAAAAAAAAAACCAGATATATAAATGCAAGCTTTTATCTTGTGCTGTTTTGAACATTTAA
AAAAAATTTTTAAATTTTTCCATGGTTACATGATTCTTACTGTCTCCCTTTCCTCCCCCT
TCTTGGAGTTGACAAGCAATTCCACTGGGTTATACATGTATATTATCACTCAAAACTTAT
TTCCATATTATTCATTTTTGTAATAGAATGAGCTTTTAAAACCAAAACTCCAAGTCATAT
ACCCATATAAACAAGTGATAAATCATATGTTTTCTTCTGGATTTCTATTTCCTTAACTAG
TTGTGGATAGCATTCTTTCTCATAAGTCCCTCAGAGTTGTCCTGGATCATTGCATTGCTA
TTTGATCGTCCCACAGTTTTTTAGTTTCTGTGTATAATGTTCTCCTGGTTTTGCTTATTT
CACTCTGCATCAGTTCATAGAGGTCTTTCTAGTTTTTATATAAATCAAGCAGTTCATCAT
TCCTTATTTGTGCTGTTTCTAAAGAGTGACAAATTGACTATTAATAGGTTCATATATTGA
GGTATTTCTTAAATTGGGAAATGCACACTAAAATAGCATTTCTAAGTGAAATAACTAGAA
TGTAGTGTTCCTTTTATTAGAATGAAAAGAAGAGATGATTCAGTAGTCATAATGGTAGTT
TTTTACCATAGACTGTTGCTAGGCCATTCATTATTCAGGTAGCAGTTATGAGCTGTGGAA
TATCTTTATTCTAAACAGAGATAGAGAAATAGGCGAGGTTTTTCATTGTGAGAAGAAGTA
CATATGCCATTTGTAAACATTCTTTTTAATCTCTCTGAAATATGTGATATTTTCTATCTG
CATTTGTTACATGTTCTCAGTAAAATTTAAACTGGTGAGGTTGTAGAAGAAACACTTTAT
TGAACCATAATATGTTGGCATTTTTTGTACTTACTCTAGGTGCGAATCCTGAGGTTACTA
AGAATTCTAGGACGAAATGATGATGACTCAAGTGAAGCAATGAATGATATATTGGCACAG
GTGAGTAGATGAATAGAAAAACTTCACTTCTATTGTCCACTTGAGATTGTAGCTGAATAC
TTAGTATGCTTTGGGCACTCTCAAACTTAATGTCTTTAGATATGCTGCTGGGCATAATTT
TTTCAATTATGTATTGTTCTTTTTGTCTTTTTCAGGTTGCCACCAATACGGAGACTAGTA
AAAATGTAGGAAACGCTATTCTCTATGAAACGGTTTTGACTATTATGGACATCAAGTCAG
AGAGTGGACTAAGAGTATGTTTTTTTTATCTTGTTTTCAGCAAGGCTTCTAGTTTAGAAT
GAACTACGTAGTCATTAGTGTCTTTGGAGCTGTTAATGACCAAAGTAATGCTGGAAAATT
GACTTAAGGTATGGGTCTTTCCATTATAGAGGGTCTACATTACTGATACCTGACGTGTCA
TTTCCCCCATTGAAGACTTACAACTGAATTTAATATGGTATTGAAAGTATTGGTCAAAGT
TAGACTTGGGCATATAATGCTCTAATATTCTAAGAATAACTAGCTATGTGATGACTGAAA
TGTGAATTTGAGTCCTACTAGCTTTAAAAAAAGATATTTAGCTGTGATACTTCAATTTTA
GAGTATTCCAGCATTTTCAATTATTATTTATTAAACACACACACACTCTTATGGATTTGT
GATCTCATCAGTATGGGTACTCTTTTCATTTTGTGCCCTCTCCTATCCAACTCTTTTTTA
AAAATTTTTTTTATTTTTATAATTTATTTATTTAAAATATTTTTTCATGGTTACATTATT
CACGATTTTCCCCAAACCTCTTCCTTCCCTCCTCTGGGAGGTGACAAACAATTCCACTGG
GTTATACATGTATTTCCTATATTCCTATTTCCATGTTACTCATGAATGATCTTTTAACAT
CAAAACTCCAGTTATATCACCATCAAGTCATGTGATCCATCCTATATTTTTCTTCTGCAT
TTCTGTTCCCACAGTTCTTTCTCTGGATGTGGATAGTATTCTTTCTCATAAGTTCCTCAG
GATTGTCCTGGATCACTACATTGCTTCTAGTAGAGAAGTCCATTACATTTGATTGTATCA
CCGTGTATCAGTCTTTGTATACCAAGTTCTTCTGGTTGTGCTCCTTTCACTCAGCATCAG
TTCCTGGAGGTCTTTCCAGTTCACATGGAATTCCTCCAGTTCATTATTCCTTTCAGCACA
ATAGTATTCCATCACCATCAGACACCACAATTTGTGCAGCCATCCCCAGTTGATGGACAC
CCCCTCATTTTCCAATTTTTGGCCACCAAAAAGAGCGTGGAGATAAATATTTTTCATTGA
TGGAATTTTCTTTTCTTTTCTTTTTTTTTTAAAAACCCTTACCTTCCATCTTGGAGTCAA
TACTGTGTATTGGCTCCAAGGCAGAAGAGTGGTAAGGGCTAGGCAATGGGGGTTAAGTGA
CTTGCCCAGGGTCACACAACTGGGAAGTGTCTGAGGTCGGATTTGAACCTAGGACCTCCC
GTCTCTAGGCCTAGCTCTCAACACACTGAGCTACCCAGCTGCCTCCTGGAATTTTCAATC
AATCTCTCTTGTTCAATTGCCTCACTTGATCCCTAGTTCTCTTAGTTTTACTTGAGTGTC
CAAATTTGTAGACAAAGTCACCTTCTGTACCCATGGTAGCTTTAATGTCTTTGGAATCTT
TGGATCATCAACCCAGCTATCTAATTCTGTTCATGGAGGAAGAACTAAGTCCTCTGGTTT
CTTCTCTTGCCTTATGTCCCCTATTTTCTGGTGAAGGATACTATTTTACTTTTCTTGATT
TCCATTCCACTGCTTTTGTCCTTGGTTTTATTGCACTTCGTACTGGGAGGGGGTGGTGGG
CAACTTTGTGTCCTTCAAAGATCCTAAAGGAATAGTGGTCATGGAGGAGATTAACATATT
TTGCCTTACACCGCTTTGGTAGTTCCGCATTATCATGTTCCTCCTTTTTAAAAACCCATT
TGCCATTCTAGTAGTGGTCTTTGGCATGTTTCCTGGAAACAGGGAGGAACGTTTCTATGG
TGTTTTTGTTTCAGCATTTCCTGCAAGACCTTCCAATCAGAAGAAAACTCTTGCCTCCCC
AATATTGCTACTCTCTAGTTTCTTGGAAGCTTCTATTGGTTACTCGATGTATTTTTTTGC
AAAATTTCTTCTTTAGCTTAGTTTCTGATCTGGACTCGCTGGTAAGTTCTAGCTTGGCCA
TAACTGCCCTTGGTTGGTTTGGCGAACCTTTCACTTTTATCTGGGATGCTCTAGCCCAAT
TTTGCTTTGGAGGCAAGCTCAAGACGCCTCTTTCCTACTTCCTTATCGTAGAAAACCTCC
TATCCAACTCTTGTCTGTGTCCTTCTGTAGGTACTCCACAGAGGTCACTTCATCTAGATC
TAGATGCCATAATGGAGCACCTGGACTGTTCATTGGTTATACCTTGCTCTACTTTCCAGT
CATATTTCTCTAGTATTACTTATGTCCCATCTCATCTGTTGTAGTTCTTTGATAATTGTA
CATTGCAGGTTATTTGCACCCATCCTGCACCTATCCATTGCTTTTGGGTGACCTTTACCA
TCAGTTCTTCAGACACTATAGTATTCCATGATTTACAGCACCACTGGAAGAATATTATTG
ATAAAAAGATGGTTCTTTGTTTCAAGTTGAAACTTGGGGTTATATAAAGCACTACGCAAT
TTCTCAGATACAATCCAGCTTCTCTGATTTTTAATTTTGGACTTAATATATTATTGCCTG
TGGATAATGTTGTTATAATATTGTTTATGGGTATAAATGAACCAACTTTGTAGGTTTTGT
GTACAAACTGCATGTTGGTCTCATTGATAGTTATTCTTAACCTATTTTTCTTTTTCTTTT
GTGGGTAGATAGACTGCTGTGGTCAGGGTTTTTAGTGTTGTGGGACTCAATGAAACAGGG
TCATAAGTAAACATAAGTACCTGGAGGACTTTGCCATTTTTAGAGGATCCAATTCTTCAT
ATATGTACATGTATGAAATGAAATTTAAATACCATTGATTTTGTTATTTTTCCTTTAGAC
TTTTAATTCTAGTGGTTCAGAAGTAGTAGGATTTCTAAGGGTTTCAAAGCAATATTGTGA
AATACTTAATTTTCCAAGATCTTTAATCTGTACCTAACTTTTTCTTTTCAGGTATTAGCC
ATAAATATCCTGGGTCGTTTCTTATTGAACAATGACAAAAATATTAGGTAAGTCAAATTT
CTCAGGTACTAGGCTCATCCTTTATAATTTTGTTTTGATAATTTTGTTCTTCCTTTAAGA
GGATATCAAGAACATTTAGGTTTTACCACCCATCTGCAGTATAGATTACAATAGGAAATA
ACCTTCAGGAAACAGCTTTTAAGAAGTGATCTTTTTGAATGATTATTTTAAAAGTTGGTG
AATCTATTGCTTTTGTTTTTTATTACTTTTCCGTATATATTTTGGCTTAGTTAATGTTCT
TATACTGAAGTTTCATTTGACTCTTACTCTGTGGTGTTAAGGCCTTGTAAAAAGGCTAGC
TAGAATCTTTTTCACATGAACTATGTTTTGCAGTGTGGTAGAATTTGAGAGATTTTAAAG
ACCTGAATCATAACTGTAAACCCAAGGTAACTGAGTCATAATCAGGCTTCTACTAGCTGC
TTTTATTGCATAATACAGTAAAATATCTCTGGTATTAATTTTTGGCAACCATTCTTCCCT
AATTCTGTAAACTTTCCTTTTCTGTAAACTTTCACTTAGCTTGATAGCACCTTCAGACAG
ATCCAGTGCCATGATGTGAACAGAGGAAAATCAGTCCCAACACTTGGATTTCAAAGCAGT
TTGTCAGATTTGTTTTGTTCATTCTTCTTAGATACGTAGCTCTGACATCTTTGTTGAAGA
CTGTGCAGACAGATCATAATGCAGTACAGAGGCATCGAAGCACCATTGTGGACTGCCTGA
AGGATCTTGATGTCTCAATTAAACGGTAATGAATGGAGAATCTTTTTTTTTTTCCATTTG
TTTCTGGTCTAAATTATACAGATATACAGTGATTACTATTATATAGTGGGGTTTGGGAAA
GAGTGGGTAGTGATGCATAGTATGATATTTCCTCCTTAGGAAGAAATTATCAATGCTATT
CAGATAGCTTTTTGCATTGATGACTTCTGATTTCTCTTATGAAATCTTCATTAGTAATGA
GGACTTCCTTTCACATGTTGCTTTAAGTCTTGCAGCAATCTTCAGTTGATTCTAGATGTT
TGATTATCCCCATTTTATAACTAAGAAAACTGAGGCATAGGCAAAATGGCTAAATTATCC
AACTCGTATAACAACTGAGTGTTGGAGATGAAATTTCAACCTAGGGTTTTCTGCTTCTCA
AATCTGGAACTCTACCCATTACTCTACATAAAGGTCAGAGCATCAGATTGATCCTTTTTT
AAAGGACAGACTAGGAATAGAGAGGGTAGGAACGACAGGGAGATATTAGTTTAGTAAAAT
ATTAATATTATAATAATATTATATATATAATATAATAATAGTAAACAAGAACGTGAATAT
TCTTGTTCAGATTTGGCCAAGTGGCAAGAGTTGGTGAAAAGTAGATTATGGTACGGTGGA
AAGAGTGCTGGTTCTGGAGTCAGGAAGACCTGGGCTCAGATTCAGACTTAGATGCCTGAA
TGTGACTTGAGCAAGTCACTTCCCCTGTTTGCCTGTTTCCTCATTTGTAAAATGAGAATA
ATAGCTCTTATCTCACAGAATTGTTGTGAGGATCAAATGAGATAATATTTATAAAATGCT
TAGTACACACAGGTGCTATAGAAATGCTTATTCCCTTCCTCCCTCACTTAGGGCACAGGG
CTATAAAATATAAAAATAACTAGAGATGATGCTAGTTATGGCTTAAGATTCATTGGATTC
TGTTATGCTTTGTGTGTTGGAGGATGAAAACTTTGAGTGATCCATCGGCTGAGTGATTTG
TCACAATGCTGAGACTCAAGTTGCTGACAGCACACATTTATTATGGTAGATCAGGCACAC
ATGTCCTGGAAACAGCTGTGTTTCTGAGAAGGGGGCCAAGTGGAATTCATGTTGAAAGTA
CTGACTCAAAGCAAATCACTGTCATGTCAACTTAAGTACTTTTTGAAAAAGGATTGAATT
CTGCTGTAATCTGCAGTGACTCCACTAATTTTTCTTGGTAAATATGCTGATTATCTGCAC
TTAGAAATAATTTTGGGACAAAAACCGAATTTTTTGAAGAGCCTTCATTGTGTGAAGGAG
ACTCATGCTGATCAGCTACAATTTGGCTTGGAAATAGATTTTTCCATGTATTTCTTCGTG
TATATTTAAAGTTCAAATGTAGTAACTAATAAGTATATCTACTTTCTTTAAGAAGTTCTT
TTCAGAATAGAGAGCCTATTTGTTACTGACTACAGAACAGACTAGGGAGATCTTTCCCTT
GTGGGACACTGGACACAGATGTGGAAGTACATGCCTATTAAGGACTGTTTGAAGTGAATC
CTGTTGTCTTAATTTCTAAAAAAAGGAAGAAATCAAATTTATTTTGCATTTCCGGTCATG
TGTTTTTATGACAAATAATTCATAAGAATGAATCCACTTATCTAAATTTGGGATTTACAA
TCAATAAAAAATGAAATAAAAACCATGATATCTCAGCATTTGTTAACCCATTTTTTTTCC
TCTAAGGCGTGCAATGGAATTAAGCTTTGCTCTGGTAAATGGAAATAATATCCGTGGTAT
GATGAAGGAATTGCTATATTTTTTGGATTCTTGTGAGCCAGAATTTAAGGCAGACTGTGC
ATCTGGAATCTTCCTTGCTGCAGAAAAGTAGGTTCAGTTTTTATAATGCTGACTTAGGTA
AAACAGATACAATAATCTGCCCCTTTAATGACTTTCATATTTATTCTTTTATTCAGTTTT
ATGCTTTTCGGAGATTATTTTGTTCCTTACTTTCCAGATTGACATATTATTCCTTCTTTC
TTATTCCATGTTCTGAGCAAAGTGGCTTACTTGCTGTTTGTTGTCTGTAGTTGACATTTT
ATCATCCATTTCTCTGCATTTGAACAGGCTGACCCCTATCCCTAAAATGTTCTCCCTCCT
CACTTCCTCTTCTTGGATTCCTAAGTTCCTTTCATGGTTCTGTTCAAGTGCCACTTCTTA
CAGGAGAGGTTACTTTTCCCTTCCTACTTCTTAGTTTATACCTTACTCCACCAAATTATT
TTGTATGCGTACTATTTTTGTATGTGTATTATGTGTGTGTATGATTACCTTCCACCCCAA
CAATAGAAAGTAATCTGCTTATGGACAGCAACTGTTAGATTCTTGTCTCTGAATTCAATA
GGGTTATTACATAGTAGGTGCTTAATAGCCACTAGTTGAATTGTAGAATTTTGCATTTTA
AAAATATTTTTTTGGGAAAACCTGTGCTATAAACTCATCTTGAATTTTATTTTTTGGTTG
GTAAAGAAAAGAAAGGTTAACAGGCTTAAGTTTCTTGCCTTCAAAATTCAGGGACTAGTA
TTCAGGATTTGCAGAGTATTATTATTCTTTCCTTTCCATTCTCTATTGAATGAGTTTCTA
CTCTTAACTCCTAGGTATAGGTATAATCCCTTCTTTCCTGTGGACTTGTTTTTTTTTTTT
AACTCATGGCCAGATACCAGAGTTTTTTCTTGGGAAGTTGAAGAGAGGGGAGTTCCATTT
TTGAGTGACTGGCTCACACTGCAATAATATGTGAGCTGGACAAATTCAGATAAACCTCTT
CCTCTTTTTTCATCTTTTGAGGTAAGACTAGCTGCCAGGCTTAGAAATGAAATGATTCAG
GAAATATTTCCAACAGGGGGATCCCAAGAAGACTGGAAATTTATTATGACTTAGTTATTC
ACTTTATATATCATTGTTTTCTTAGATATGCACCTTCCAAACGATGGCACATAGACACAA
TTATGCGTGTTCTAACAACGGTAAGTAACATCTCTAAAAATTTAGGTAAATTTGATTTGG
TTATAATTAATCTTTTTAGTACGAATTTTGTTTTGTGGCATTTTGCAGAGATTCTGGATG
TTTATCTTGTTCATTTTTAAGAAGAAAGATTCAGTCTATGCCTGCTATATGATTGCATTT
GCTTTGAACCTAAAAGGAAGATTTTTTTAAAGGTTCTTCTTGCTTGAGGGTGTGGGGAAT
GGGATGTTGAATAGGGAGGTACTGTCGTTTCTCAGTCTCCACTAAGTAGCTTATCTATGG
AGAAAAACAGTGCATTATGGCAATTAGGTTCATCCAGTCTCAGTTTCAATAAAAACTATG
GTTTCTAGTAAAACAAGTAATAAAAAAATATCCTTAGCAATAACGAGGCAAAAATCCTGA
TATTTCTAATGCCCCCAAAGAAGAAAATACTAGAGTTGTTTATTTGAAGTAACCCATTAG
GTATGTGACATAACTTTAATGTAATGGTCACTTGCTTCATTTTTGTTGTTGTTGTTGTTT
TTTAAATATACATGCCTCATACTTCCTAACTTTTTCCTATCCTTTATTTATAGTAATCCT
TAGTATTTTCAGGACACTTTTCTTCATTTAAGGGGCTCTGAATAATCACCTACTCTAGGC
TTCATCTCAAACTCTGTTCTTAACCTTTTTCCTTTCCTTTTTCACCACTGCAACCTAGCC
TTTTTTCTTACTTTCTTTTGGTTATTCTGAGCTATCTCTTATTTCAAAATATGCCTAAAT
TTGGATAATCTATCCAGAACTCTTTATGTTCTGTCTAGTTAATTTGGTAAAGCTATGACC
TCAACATGACTAAGGACTTGGATTTGGTTGTTGAATCAACTAATTAGCTAGCTATAAGCT
TTTCTATGATACATGATTCTTTTGATTCTAGCAAGTGCATGCCATTGGTCAAAAAGCTGA
CTGAATAGATATGTGGATACTATTAAGTATAAGTCTGTGACTTCTGAAGTACCTATAGAA
ATATGATTAGATATCAGTACATTAGTCTCAGTCCACCTAAGGTCCCCAATAAATATTAAA
TTATTTAAGAGTCCTGATTAGTCAAAATGTTAATAATTTTATAACATTATAATTCTTATG
CTTTTCTCACTCTTGTATAATTTTTTGGTAATGTTCATTGTAGCAAATGTTAATTGTAGT
ACTGTAATTTAGCCCACAAAAGAATTTTTTCCCATTTTTGAAATTCTCTCCCATGTTTTT
AGAAAAGATTTATTTTAAAATCTTAATTTCTTCTTTTTTAATTCTTTCTAAAAGAGGAGG
TCATACTTTTTTTCTTTTTGATAAGAAATGAGTGACTTAGATTTGAAATAAGACTTTGAA
AGTAGTGGGACAAAATGACTATAACGTTTATATACAGAGTGTTGGTCTGAATTAGGCTTT
TCTCCTGTATGAGATAGATAACTCAAAAGGGCCTTCATCATATGCTTAATGTATTTGTCT
AGGGTAAAATACCTGGGTTTTCTTTTAGGCAGGGAGTTATGTCCGTGATGATGCTGTCCC
AAACTTGATTCAGCTGATAACTAATAGTGTAGAGATGCATGCCTACACTGTTCAACGCCT
CTACAAAGCCATTCTTGGTGATTATTCCCAAGTAAGTGTCTCATTTGCCTTTCTTAGTTA
ATTGGATTTTACTACCAAGGGAAAACCATTTTAAAAAAAAATTTAAGTTATTCTGTTTAT
TCCTGAGGAATCATTTTAATGTACCCTCTATTAGAGTTGCCTTTCACCTTTTGTTTTTCA
TTATATACCAATACGTTTCATTAACAAACTAGTGCTTTTACATTAAATCTTATTTTAAGG
AATCAAATACACTGATAAATTCAACTTCCTTTTGTCAGCAACCCTTGGTGCAAGTAGCTG
CCTGGTGTATAGGTGAATATGGAGACCTGCTAGTATCTGGTCAATGTGAAGAGGAGGAAC
CCATTCAGGTACTGTTGATCCTACAAAAGGGATAAAAAGTCTTTGATAATATGAGGTGGA
GAAGAGAGACATGATGCCCTTGGTGCTGGTTTGGGAAGAAGTTAAGTGAAGGCATCAACT
TTATCATTTAGAGGCTTGAGAGAAGAGACTAGTATTTATTATGGATCCTTTGTGGTGCTG
CTATATATTATTAGATATGGAATTTTTTAAGAATTGAAGTTAAGAGGGGGCAGCTGGGTA
GCTCAGTGGATTGAGAAGGCCTAGAGACGGGAGGTCCTAGGTTCAAATCCGGCCTCAGCC
ACTTTCTAGCTGTGTGACCCTGGGCAAGTCACTTGACCCCCATTGCCTAGCCCTTACCAC
TCTTCTGCCTTGGAGCCAATATACAGTATTGACTCCAAGACAGAAGGTAAGGGTTTAAAA
AAAAAATTGAAGTTAAGAATCCCTGTTTTCAGACTGGCACAGACTTGCTACCTTTTTAGA
TGTTGAGTATTTGTCTCTAGGGGAGCTGTGCCTGAACAAAAGCCCTCCAGTTCTGCATTC
AGATAGTTTGCCTTTTGACTAATTATTATGGTCTGCTCCAAGGGAGATGTTGGGGATTGT
GTCCTCCTGTAATCTCCTTCTAGAGGTTCCCTCCACCATTGATAGCCCCTCAACCTCCCC
AAATTAGTAGATCGCTTCCTTTGGAATTTGTTTGGTTTCATCAACAGCAGAAAATTATTA
CAGAAGCGTTGGCTTTGTGAGGCACTTTTCATAATTGACCTGATCTTGATTTTAGGCATT
TTTAACCTGTCTACGTTTTGTCCAGGTTACAGAGGATGAAGTGCTGGATATCTTGGAAAG
TGTTCTCATCTCTAACATGTCTACATCTGTTACCCGGGGTTATGCCCTCACTGCCATCAT
GAAGCTCTCAACAAGATTCAGCTGTACTGTTAAGTGAGTGTTTAGGGAAGAGAAGATCAG
TAGGCTAGTAGAATGTTTCTGATTGATGTACTTGTACTTTTTTTGAGCCAACACCAAATA
CAGATTTAGTGAAAGGGAAGGAACCTTACTTTTAAGTAAAATTTCTGACTTCATCTATTT
GAAATGCCTTGATAAAGATTTCCTTCTTTGATAGCTAGATAAAAACCATGTTTCTGTTGG
ATGTGTTTTGGACCAAATTGGATCTTTTGTATTTTTTCTCTTTGTTTTTTATATTTAGGA
TATGTGCTAAAAATAAGACTTTTTTTTTTTCCATTTTTGTTTTAGTGATTTAAGTTTAGG
CACCCAGTATACTGATGGCTGATATAGTTTTGAAAGTAAACTTTTTTTGTGTAATATATA
TTTCAGTTATATAAATCCTAGTTTTTTTGAAACTTCATTTGCTGAAAACACTAAGTGGTC
CTTTTGAGCAAGGTGTAGACTGGGATCTTTTCCAAAGAAAGTTATTCCTGATGGAGATAA
CCAGCCTTTTTCTGAATATGGTATTATAGTGAATGATGAGTCAAGTGGTTACTGAACTTA
TGAAAATGAAGAGAACAAAGTGACATTTTAAATAATTTGGGACTTTTACTATTGTTTGAG
TTGTAAATAATATGAAAAAATTTTATTTAATTTTTTTAATCTACCATTTATACAGAAAAC
TCAGTTTATATTTTGTATCGCATTCATAATAGAGACAATCTGAAAGTGCATTTCTGCTGT
GTATTTCATTAACCCATTTGTTCCTTTATTCTGTAGTCGAATTAAGAAAGTGGTTTCCAT
CTATGGAAGCAGTATTGATGTGGAACTCCAGCAGAGGGCAGTAGAGTACAATGCACTTTT
CAAAAAATATGACCATATGAGGTGAGTTGATGCATGTGTGTAATTCTAAAAAATTTTCTC
AATCACATGTAATAATTTTAAACATACATTTTCTGAAATTATAAGATCCAAATTGTCTCC
CTCCCTCCTTTACTCCCTCCCCTGAGATAATAAGCAATTTCACCTGAGATCAAATTCAAG
TGTTTTGAACAAATCTGGCCAAATCATTTGGCCAGACTTTTTGACCTTCCACAAGTCACT
AAACCTTTCTATCTGTAGGCCTTGGATGGCCTCTAAGATTTCTTCCAGTTAAAAATCTAT
GGTCCTTTGTATACATTTATTAAGTTGTATTTATATATGTTAATATAGCTATAGATATTT
ATAGATACAATAGAGTCTTAAAACTCTTAATGCTTATGTATCTGTTTCCTATTCCTAACT
CGTCTGCTAATAAAGTACAGATTCTAGGTTTCAGATGGATAGTTTGTTTAGCTGAAACAA
ACTAGATTTTTTTTCAAATTCTTAAACTACTTTATGATAATACTTGAGTTTAGTAAAGGA
TTGATGTGTCACCTTATTTGTGCTTTGCTTCAGATTAATTGTCCTAGGTACTTTGGATTG
AAAATCCACAATGTTCCATACTTTAACTACTTCTGATTCTTTCAGGTCAGCCCTGCTTGA
AAGAATGCCTGTCATGGAAAAGGTGACTACAAATGGCCCCACTGATATTGTACAAACAAA
TGGAGAGACAGAACCAGCACCACTGGAGACAAAACCACCACCTTCTGGGCCCCAGCCAAC
AAACCAGGTAATAGGGAAAGTTGTCTTGGGATAATATTGTCATAGCTCCTAAAAAGGCCC
ATCTTATTATTCTTAGAATATATTTCAGTGTTTCTGAATTGGTTGTTGGTTCAATCTTTT
AGTGTTACTATTCCCAAAGAGTTTTGTCTTAGACCGGACCATCTGAATTTATTTTCCATA
GTCTCAGTTGCACCTGTGATCAGAAATCCATATGTGTGTAGCTAGACAAACTTTAACTCT
TACATTCAGCTTTAGCTAGTATCAAACATGGTGGGAGTATGTTATATAGTAACATTGTCA
GGCAGGATATTAGGCACTAATGACCTCTTGGGGTGTGTGTGTGTGTGTGTGTGCGGGCGT
GCGTGCGTGCGCGCAAGGAAACAAGTGCTAAATAGGTGTTTTTAGTAGGCAATGGGACAG
CAAAGAATATAGGGAAGATACATGGTGATGTTCAGGATTCTAGCTATATAGATATGGATT
AGTTTAACTGACTTGAACTGTGGTATTACTTCCTTTTTTAGGCTAATGATTTATTAGATT
TGTTGGGAGGAAATGATATAACACCCATTATTCCAACTGTACCTACAAGCAAGCCAGCTT
CTGCTGGGGGAGAGCTTCTTGACTTGCTGGGAGACCTCAATCTGGCAGGTAAGGCTGTTC
TAGAGCTACTTATGAAGAAGCAATATTTGGGATATTGAGAACATCTAAGGTGTTAACAGG
CTAGTCCTTTTCCAAGTCAGTCCTTGGAAGATGATGCTTACATGAGACTGTCCAGTTCTA
AATTTTGAAGAATTACGATTTGAAAATCTTGATGAGGTTATTTAGTGTCACCTTTGTTTT
TACGTTAAGTTCATGACTTTAAAACACCCTAGTTCTGTATGGTTGGTTTTCTCCAACTGG
GTATGTGATTTTATTTGGGGTAGGAACATCTTTTCCAAGGCAGATCTTGGTACTTTCTCC
ACATGTTAGAGACTTAAGAGAAGTTATCTGGGAAAACTGAGGGATTTCATAGCCTGGATG
CTGCTATGAAGAGAAACTAAAGCCCAGGTCTTCCTGAGGCCAGCCTCTGTAATGTCTTTA
GAGAAGTCTTTTTCTTTATCTACCTAATTCATGAAAGCTTTCCTTTCCACTGGTGACTTG
TTCCTTGTTCTGGTCCACTTTGTGCTTTGAAGATAGCACCTTTTTTTTACCTTTTTTAAT
GCCCTTGTATTGTCTAATAATTTTAGAAAAGGGCCAAATGTTCCCCTTTTGTTCTTTAAA
AGATTTTGTCTTTAAAAATTTTCCTGTCCATTTTTGTAAGTTGACTCATTTGTTCCTCTG
GTTTTCCTGCCAGTGTTATAATTGTTACTAGAGGTATGCTTCAGTGATTTAACTCATTGG
AAATTTGTTATAATGGAGTTGGGAAAAAATAAGGAATAAACTTCATCTTTTGGAAAAAAT
TAATGTAATAGATTTCTGCTTGATCTTCTTCTCTAAGCACATTCTAGAAATGTAGATTAA
TATGATTTGTTTATTGGGTACTTCTGTAGAAAGGACCTGAGACCCGAGGGGTTTATGTAA
GATTAGTGTGTTTGGCTGCATGCTGGACTTCAATTTTTCCCCCTTTTTTAGTACACGTAC
TTCTAAAATAATAATTGAAGCCATTTAGCACACGTACTCCTAAAATAATAATTAAAGCCA
AAAGAGCATGTTATTAGGGTTAAGATTCGCTTCCTAGTCATTTTTTAAGGAATTTGCATT
TTATAGAAAGTGAACCTTTGTTACTTGGTGTCTTTCTTTATAAGGTAGCTGGCGATGCCA
TAGTGCAGAACATAGGAATTGGAGTCTGTGAGGCCAGAGCTCAGTATGTCTCAGACATTT
TCTTAGCTGTGTGACCCACGGCAAGTCACTTAACCTTTCTGGGCCTCAGTTTCCTCATCT
ATAAAATGGGAACAATAATAATAACATGGAAAGCACTTGCAATCCTGAAAATTCATCCTG
CTAGCCACTGGTTATCATCATTATTTTTAATTTGTTTAGATTTGGACCTAGTCTTTTTAT
CTGTGACCTTTGTATGGATCTTTGCTTATCTAACTGTATGTCTTTTTGCACTTTTGGGGG
TGTGTGTGAAGATAGTTGTTTTTCTTTAAGTCCTTAGTTTTATTTTCATATGTTGTCCTC
TGCTTTTTATACTTTTCTGTGTGTAATATTTAAAATTATGAGGCTTTTTGTAGCTTAACA
ACTTTTTTAAATCATGTAGTATAAGTAGTAAAGAGAGGGAAAAGTAGGAGAGAGGTAGAG
ATACTTAGTTTTCTAATCTGTTGGCTACCATAATGGGCCTGTAGCTAAACTCTGACAAGG
GTCCTCTCAGCTCCTCTACCCACAGACCAAGAGACCTCTACATTCTCCTGGGTCTCCCTT
TATAAGCTCTTTTCTCCACCCACTAACTCTCACATGTTACATCTCAGGAGCCAATCATAG
TTTCTTAATTTTCCTGAGCCACCCAGGGGGAAGTGCCTTTGGAATCATTTTCCTGTCTTA
TTGGTTCCTTGGTTCTTCAACTTTCTTTCTCTGAGGGCTTGTCTATACCTGAATTTATGC
AGTGGCATTTGACTTCTAGGTCATTGAGAGATGACCTTAAAAAAAAAAAAGGTGATACTG
GAGAAAGAGAAATTTGCTTCCAATACACGGAAGTGTTTCTATTAATTTAAAGATTTTTGA
TATCTACTTCCTTAAAGTATATTGAAAAAAATTTTTTTGACTAGGTCTTTTTTATTTGTG
AAGAAACTCCTATCCATGTAGGTTGACAGCTGCTGTATAGTCCCCAAATAGTGACATTTT
TGAAGGTAAAGAGCTTGGTTAGGGTCCTACTCTCAGTAGGTATAATAGGTTTGGCTAATT
CTGGGGCCATTTCTCTAGTTACTATACCATACTTCCTCTCTCTGTTTTCTGAATTCTGTT
GACATATCTCCTTGTTAGAATTATAAACTATATGACTATACATAGATATACAGATTTAGT
TTGTTTTTTTTCTTATTAGAATCTTGGTTAATTTTTTTAGATATAAAAATCAGATTAGAG
AGTTTCTAACTGTAGGAACTGTGGATCCTGGTTAAGCTTTACTTTTCATTGGAATATATT
TCTTTTAGGTGCTCCACCTTCTGCTCCTGCCTCAGTTCCACAGCTGTCACAGCCTCCTTT
CCTCTTAGATGGGCTTTCATCACAGCCTCTCTTTAATGATATTGCTTCAGGTAAGATTCC
AAACACCACTGGAGCCACATAAAGGCATTGAGCCAGTAGCAGAGAGAAAGACTAAAGAAA
TCAGGCAGGCTACTCTTAGGCTGATCTTTCTGTACTTTCTTAGGTATCCCTTCCATCACA
GCATACAGTAAGAATGGTTTAAAGATAGAATTCACCTTCGAAAGGTCCAACACTAACCCC
AGTGTCACAGTGATCACGATACAGGCCTCCAACAGCACAGAATTGGACATGACAGACTTT
GTTTTCCAAGCTGCAGTACCAAAGGTATTTAGAATTTTTTTGTCTTTTTGACTAAAGGTT
GGTGGTGAAATTTGTCAATGGATTCAGGTTTACAAGGAAGCAGAAACACCTGGAAGTGCT
GACCAGTACAATGATTGATTAGCATTGCAAGAGAACCATAGTGGTGGGAATGACTGGGCA
GTCCAGGGCAGTGGTACATCTCTCTCTGTCTCTCTTTCTCTCTCCTTACCCCTTCCTCCC
AACACATATTTCACCACCCAATATAGAGGAAAGGATGAAAAGGGATTGTACATAAGGGGA
GAAGAGGGCAGTACTTACCCCTACCAGTGTTGGGCTTTTTCCACGTGGAAAATGGCCCTG
TGTTGGCTATTTTATTCCCTCATAGGGTCTTACTGGGAGAGGGCTGGCCTCGAATCTCCT
GCCAGTGGGTTTTTCAAATGATGTCAGCATTCCCACTGGGCCCCTTATCTCCAGGGGTGA
GAATCTGGACCATTAGTCTAAAGTTTGCTTCCTGTTCAAGTGGATAAAATTAAGACTTAT
TTTACCTGGGTTACTTGTTAAGGTGTTGGTTTCTATTTTGTATCCAAATAAACATTGTAT
ATTAAATTTAACATCATGGATTTATAACCCAGTTAAGTTATATGAATACTTTCTTAGATC
GCTCATTCTTATCACTTCAAGTTTTCTTCAACCATTAACATTTAGAGATGAAGACATGTT
CTTTATTGGCATTTTGAAATATTATATATATACATGAGGGACAAAGAAATTACATTGCAT
GAACTTTTGTAGTAATTTTCAGTAAAAATTTAAAATAGAGTACTTTTTACATGAATATCA
TTAATGTGTTCTGCAATATCATTAATGTGTTCTGCTTTGAGCTAGAGAATACGTAGTTTT
TATAATAGTTCTTTACTTCTTCGTCCTCTCCTGCCTCACTTTCCCAATTTAAATCTGTTT
TTCTAATACTTTGCTTTGTAGTGTAGATTATACATCATAGACTAAAAGACTAGAGTTCAA
TATATGAACATTGTATACCTGACACAGAGGTCCTTGGATGTCAATTCACTAGTTTCCTCT
ACCATATGATACCTCACTTGGGGAGCAGAATTGGAGATACTATTTTATATAATAGCTCTT
TCATACTCATAACCTAATCTTAGCCAACCCATACATATAAACTTGTGCTATATTATATTT
GATTATTTCAGAGCTCAAAATACTGACATAGCGTTTTGGGAAGCTTTTATATATGAAGTG
GCTGATGGCACAGTGAATAGAGTACTGGGCCTAGAGTCAGAAAGACTTGATCCAGATAAA
TCATTTCCCCTCTGCCTATTTCCTTACCTGTCAAATGAGGATCATAATAGCACCTTCCTA
GCAGGGTTATAATGAAGATCAAATGAGGTATTATTTAAGTGCTTAATCCAGTGCATGGCA
CATGGTAGATGTTATAGCAATATATCATTATTGTTATTAAACATGTTAGTTTTTGGCTAG
CTTTCATTTAGTCACTGTCTTGTTTCATATAAATTTTTTCAGATGTTTAGTTTAACAGAA
TTCTCATGAGGACTTAAAAAAAAACAACAAACCATGGTTAACCATGGTGTCTCTGGGCTC
CTTCTGCTCTATTACCTTTAGAAGGGGGATATTGGCCATTATTGGTAGAAGGGAGAAGAA
GGTTTTGTATTCTAATTGCTAATTTGTGGCAGATTGCCTTTGATGGTTCATGGGTTTGTG
GAGTATGGCTTGGGGAGTTGACTCCCAGAGGTTATTCCTATATGGAATTAGAGTTTAAAA
CATAGGAATAAGCAAACAGGAATCATCAGCTGACTTTCCTGCATATATGGCTGTATGAGA
CTGATTAATCATGGAGATAGACCTAAGGATAAAGTTTGTATTGTATGTATTATTGAATGA
TTTGCTGTTTCTAAAGAATACCATTCCTATTTGCAGACATTCCAGCTGCAGCTTTTATCT
CCTAGCAGCAGCATTGTCCCAGCATTTAATACTGGGACCATCACACAAGTCATTAAAGTT
CTGAACCCACAGAAGGTAAGCATCCCATTAGGGGAGAATTTTTGAGCTAGATTGAAGTTG
TTTCCTAAATTAAATGTCTACTTCAACAAATTCTAGAGCAACAAGGAGCCTCAAAGTTTG
TCACCTCAAACCCTGTGTTTTTATAGATCAAGAAACTATATCCCACAGAAATGAAGTGAT
CCTAAACTTTGAAAGATATCTTTGGAATCTTAATGGTGTAACTTAAAAAAATATATTGAT
GCATTATTTTTTGCATCAATTATACTTGATAGAGTACCTCCTATGCTGAAAAAGAGTTAA
AGGGGTGGATTGGTGGTTCGGTGAATAGAGAACCAGGCCTAGAGATGAGAAGTGTTGAGT
TCAAATGTGGCCGCAGACACTTCCTAGCTTTAGGATCCTGGGCAAAACACTTAACCCCAA
TTGCCAGGCCATTACTGCTCTTCTGTCTTGGAACCCATTCTTAGTATCAATTTTAAGATA
GAAAGTTCAGGTTAAAAAACAACAACAACAACAACAAAAGGTTAGGCAAAACTAACTGAC
ATAGTAGCTTTGTCTGATCTGACAATGCATACAATATTTTGCATGTGTATGCAATCACTT
TTGAGAGGATGGTCATATTTTCCATGTTCTCTTCTCTGGGACCAAGGTTGGTCATTATCA
TTTCTCCAAATAACAGTTTGCAAAGTGTTTTATAATTATTATCTTAGTTAATCCTCAAAA
CAGTCCTGTAAGGAAGTAGCTGTTTTTATAGATAAAGAAAATGAGGCATACAAAGGTTAA
ATGACTTGCCTAGGAAAGTGTCTGAGGTAGGATTTGAATTTATATCTTCCTGGCTCTAAG
GTTATCATTCTATTTCAACACTTAGATATTCTAATTTGGCTTCCTTTTCATGTTCATTTG
ATTTACATTATTGCATCAATTACATATGTTCTCCTGTGTCTACTTTTTTCACTGTTTTAG
TTTTTATGAATCTTGTCATGATTCTCTGAATTTGTTATATTTAGTAGAATAGTATTCTGT
TATATTCAGCAATTTTTAAAGTCTGTATTCCAATTAACCCTTTGCAATAATGGTTGATTT
TGATAAAAGTGTGGCATCATTCATTTTTATGGATCATGATTTTTAGGTAGAGTTGGAGGG
AAAGGATGCTTTGTGAAATAGTAATCAATTTAGACTTACTGAGAAACCTGCTTTCTTACA
GAGGAAAGAAGGCTGATGTTTACATATAGCTTTACAAAATTTCATAAAATGTAAATTACA
AATAACTTATTAAGCTTGCAAAATCTACCAGTGTAACTTTAATACATTTATTAAGTGCCT
TTTGTGGACAAGAGCAGTGTTAATAGTTAGTTTTCCCATTTATTTATTGGTGCCATTGCT
TCCTCTTTTGGGGGGCCTTTTCTTCTATAGTTCATCTGCTTGCAGCATACATACTTTAAA
ATTTTCCAGCCACACAAATTATCATCAAAAATCTAGTGAACATGGAGAAAAGACTATTGA
GAAAAGGAAGAGTTCCTGGCTTTGGAAACTCAGTATTCAAAACTTTAAACTTTAAAGAGA
TGAAAGTGGTGGTTCCCAGTATAGAAATTGTGCCATATAGACAGACTTGGTTTAGAAGAC
CTGAGTCCTGCTGCATATACTAGCTCTTTGACTTGGGTAAAGTCATTGGAAATCTCTGGG
TCTGTTTTCTTATATGCAGAATGAAGGGGCTTAGACTCTTTAGTGCAAAATGTACTCTAT
AACTCTAAATGTATGATCTTATAATTTTTCTTCTTTCTATTACCCTTACCTTCTGTCTTA
GAATCAATATCAAGTATCAATTCTAAGACAGAAAAGTAGTAAGCAGTGGGGGGTTACTTA
AGTAACATGACTCACCCAGTCAGCTAGGGAATGTCTGGTGTCTGATTTGAAACCAGGACC
TCTCATCTCCAGACCTTGAATTCTATCCAGTGAGCCACCTACCTGCCCCCAAAACAGTTT
TCATCAGTGCTTCTTTTTCTACACAAGAACAAATTCTAAAATTGTACAGATCCCTTTGAA
TTAAGTATAGTTGTGTTTATTAAGCATTGTTTGTGTTTAGGGAAGTGTTTTATGAAAGAT
CCTGATGGTTTTTTTTCCCTTCTCCTCACCCCTTCCTGTACCTTTGCAGCAGCAGCTCCG
AATGAGGATCAAGCTTACTTATAATCACAAAGGCTCTGCGATGCAGGATCTAGCTGAAGT
GAACAACTTTCCACCTCAGTCCTGGCAGTGAGGCTTTGGCACCATTCTTACTCTCGTCCT
ACCCAATCAAAGGAACTCTGGGAAGGAGGTTGTGATCCCTGGCAAGCCCCCCTTCCCACC
CTCCCCTCCCAAACTGCACTGTGGGCACGAGGAGCCGAGGAGAGCTACTGAGGAGGATTT
CCCTAAAGTTACTGCTGACCTCAAAGCATAGCTTGTTAAAGACTAATCTCCTCTCCTCCT
CAGTTGAGGCTGGCTGCTTCAGGAGGCTACTGTGCACTCTTCCTCTTCTTCCCTTTTTTT
CTCCCTTCCCCCCCTCCCCCCCAGCCCTCCCACATTCACAGCCAGAAAGAATATTCCCTG
GGCCCCTAAGGAAATATGCAGCTTGTCTGGAGGAGAAGACTGGAATTCACGGCAAGAAAA
CACTCGCTCTCTCTCTCTGAAGCAAATGGTTGCCCCTTCTTTCTGCTGTTTCTCTGTGGG
GTAGGGGAAGTGAGGATATTTGTTCCTCACTCTCTGGGTTACCATCTTCAGGCACTTTTG
ACATCTGGCATTCAGGATGGAAATCTATCAAAAGGACATTAGGGAGCCCTGCCTTTTTCT
TTTGGTTCCCCCAATGTTTGAAAGAGGCGTTAGGTTCCTAGTAGCCTTTTCTGTGCATTG
CTGTATACACACAGACACACACACATGTATGTTCGTTAGCTGTATGATAACCAAGAGCAG
GTCAGGCCTTGAGAGGTTATTTGTAAACACTGGACAGATGCAGTAAAAAATTTCTGATGA
GATTTGGTTTGAAGGTCATGGTGCTCTATTTGTGATAGAATTTTCCAAGGCTCTTCCAGC
TCCCCTTGTTCACCACTCCTTGGCTATAGTCATGTATACTTAAACAGTTTTCAAAATCTC
TTCCCCTAAAATACAAAGTAGACAACTTATAAAGATACGCTACAAGCTATCGTACCTCTA
CCTCCCCAAGAATTTTAACCTTCCCCAGCCAGTAACTTGGCTGCTTAGACATGGTAGATA
GGTAAGAAAAGAGGCGGCACCAGTTGTACGGTTCAGACTAATGGACATGAAGCCCCTTTG
CCCATATGAAGAGTGAATATTTGACTCATCCTAGAGCACATTGGAGAGTCTTTTTTTCCC
CATTACTTCAAACCTCCCTTTTATTTCCTGAGCCTGGCTTGGACCTTGGCATTCCGTTTG
AATTCCTTCTTCTAACTGGAACATTTGTGTTGTATCTGTAACACTGGCACTGAAATAAAG
ACCATACAGTTAAAGAAATCTTTCCTATATTGTACTTAATGGTGTTGGAATGAAGCCTTG
TAGCTTCCTCGCCCCCTGTGTCAGTGAGAGTCATTTAGAGAATGTAGGATAGGATTAACA
TCCTGAGTTTCACAAATAATTTACTGTTCTCTCTATGGAGAAAATTTTTCATGAACATGT
GGGCCAAAGACCCAAGGTCTGAGCTCTTTTGAGTGGGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1136, 14918..15121, 30186..30310, 34306..34447, 38825..38921, 41122..41198, 42011..42019, 46422..46517, 47619..47699, 47855..47953, 50871..50926, 51571..51684, 53406..53546, 54625..54679, 56188..56310, 56558..56647, 57445..57572, 58356..58460, 59085..59226, 59741..59867, 62348..62449, 62563..62723, 64656..64754, 66889..67060, 67096..67438
14921..15121, 30186..30310, 34306..34447, 38825..38921, 41122..41198, 42011..42019, 46422..46517, 47619..47699, 47855..47953, 50871..50926, 51571..51684, 53406..53546, 54625..54679, 56188..56310, 56558..56647, 57445..57572, 58356..58460, 59085..59226, 59741..59867, 62348..62449, 62563..62723, 64656..64754, 66889..66987
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved