Monodelphis_domestica Locus SNX5
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica SNX5
Monodelphis_domestica
SNX5
1
SNORD17
10121..10367
43411
TTCCCCAAGACAACAATAATGACCATAAAATAACATGAGACAGCATTTATAGTGCCCAG
GCCCATAGAGGTAGCTAGAAGGAATCTGGCGCCGAGGGCGCGAATCCCTTGGACGTGCGC
GTTCCCGTGCGCATGCTAGCGGAAGAACGTAGAAAACGTAAGGCAGGGAAAGGAGCCTGG
GCTGGAACTAGGAGGAAATGGGATCTCTGCGTGCACCCTAAGGGTGCAGCCAATTTAATG
CCGTCGCAGGGGATGGGAAACAGAACCCTGTTTGGTACCTTTTGTAGGCCGCAGCTTCTT
GACAGCTATTTGCGGCGTCTTGTGGCGGGCTGCAGATCCCGCGAGACTTCTCGAGAATAG
TAGTTTTATCACTCCGGTCTTTGCAAGTTGGCGGGAAGGAGCGGCGGCATCCGTCATGCA
CTGCGGCTGCCATTCCCCGCTCCTCCCCTCACATGCTTCCGTCTCTGTAGGCAGTGGTCC
TTTAAAATTGTAAGACTGAAGCGAGGCGCGGGAGGGGGGTGGTCATGTGGCCAGTCTCGG
CTCTCGATTCCTTTTCCTTTCACGCGAACCACTCCACCCCACCCCCACGTCGCCATCTTG
AGTTAGGGCTCGGGAACGAATGGTGGATCCCGCTCGGCGGCTCGTCCCGAAAGAAAAGCA
GAATTCTCTTAGGAGAGGGACGGATAGCATCTTTTTTCTCCCCCTCCCCTCCAACCTAGG
CCAGTGCCTAGGACAGGATGCGCAGGAAGGAGCTGAGATTTAGAACGGATTCCTCTGCCC
GGCTCCAAAATGGTGGGCTGGCGGCGGGCCCGTAGTCGGGCCAGGCCTTAGAGACTGCCA
CGTGCGGTTCGCTAGGGCGTTGCTGGGATGGTGGAGGAGTCCAGCGGCGTGGAGAGGCAG
GGGCGGAGCCACGGGCCCTCGGAGTGTAGGTACTTTAGCGGAGGCGGGGGCGAGTGGAGC
AGCAGTCGCAGCTTCTCTTTTCCACTGCAATCTTCTTCATTATGGCCTCCGTTCCTGAGC
TGCTGAAGCAGGAGGACGACCGGAGTAAGGTGAGCACAGGTGGAACGGAGCCGCCCTTTC
CACCTAGATTACCTAGATCACCCACCCTGCCTTTCGGTCTCGGGCAGGGAGTCCCAGAGA
AATCCCCTTATTCCTTTTTTTTTTGCCGCCACATTTCTTCTAGCTCAGTTTTTCCTATCC
TCTTGGGCCTCCCACCAGTCTCCGCGCCCTTTTGGCGTTGCCCTAGGCTTTCTCTTCCTT
CCCCCTCACAACCCCTTTCCTCAGTCTCCGATCCCTTGAAATTGGCACGCTTCCTTTGGT
CTTCCGCTCCTCTTTACAGACACCTTGTAATTGTCCCAAGGGAGGACCTTTTGAAATTAA
CGCCACTGTCTACTCTCTCCCTTCACATTCCCCCTTTCCCCTATGACTCTCTGCATTCCT
CTTGAAAGCTGCTTTTTGGAGCTTCATGAATTCTTTGGTGGTGTGAGTGTAATCATAAGG
CTGGCAGTAGCATGTGGCTGCGTTTGTGTATTCTCTATGGAATAATGATAAAAATAGCAT
TTTTAGGTTATGTATATGTTCTCAGTGAAATGAGGTTTTCTTAAAATTTAGCACTTTAAG
GTTGTGTGTATTTCAAGTGGGATAATAAAGAACAATTCAGCGGTTTAAGGTTTGCCAAGC
GCTATACAGAGATCAGCTCATTTGATACTTAAAAAGTATCCCTGTGAGGTAGGCGATTTT
ATTTTACAAATTTAGGAATTGGCCCAGAGGAACTAAATTACTTGCTTGGCGTTATGCTGG
CTTTATTCAAACGCGAGTCTTGCACTCCACACACTGTGCAATGATGGTGTGTATCTTTCT
AGTAGACGGTAAAATGCATTAGAGCGGACACATTTATCTAATTAAGTGCCTTGTTCGAAG
TAGATGCCTAATATATGTTTTGCCGAACAGAAAAGTGCGGTGGTTTGTGGTGGATTGTAT
TCTGAAAGAGGCTCTCAACCATGCGCATTGTGATGTGTACAGTATTGTTCGAACTGTTCC
CTTGATGGTTTCCCCTAGGTCTATTTAATATTCCCATATAGTATAGGAGAGACGAGAAGC
TATGAAAAATAATAAAATAAAGGGACTATGAAAGATTCAATATGGTCTTTTGAAATTTTA
GCCTTTTGCGGCATTTTCGTGCTAATGAGAATGCTAGGAGCGTTTTTTTTTGTTATGGAA
TGATTGTTGAAAATTTGACAATTTTTAAAAGATCTTATATTTTTTCACTTTAATTTGCCC
CCAATAATTTGTTTTCCCCTGGTAAGTACTGTTTTTTTTTTTTTTTGACCCTCATGCTAG
GAGGATCATTGATTTATTCCAGTAAATCTAAGGAAAATTGGATACGGAATGTGCACATGG
TAAGTGCTCAGATACTTGTTGAGCTGTGCATGGGGCTTATAGCTTCCATGTCGAGGATTA
TGTAAACTCCCTTTTCTGTACTAATGCTGAAAATGATGGAAGAACTTAATCTGGTAATAC
TAGCCAGTTTTTAAATGTATTGAAAGACTTCTGGAATGTGAACTCTACCCATCTTCCTTT
CCAACTCTTACTTCCAGATCAAAGTGTGACTGTTGTACGTGGGTGCAATATGCAAAGTCC
TGGGTATTTTGGATTAAGTATTTTTAGTCAACATGTGCATTCACTGTTCCAGAGGCATAT
GATTCTTTAAGTCTACAATTTAATTAAAAAAATTTTTTTTTCAGTTCCAAATTCTCTTAC
TCTTTACCTCTCCTACCCATTATGAGGGATATACAAGTCTGCTGGCATATAATCGAAACT
GCTCTTCCCCATTCTCTTAATTTGTGATTCTTTGTTGTATCTTCTTAAATTTACATGAAT
ATTAATTCCATACACTGAAGACTATCTCTAAAATACAAGAGGGGAATTTGGGTTGGCATT
TTCCCACTCATTCTTGCTTAATCAGTTTATCTCTTTAAAGTCATGTCTTTGATGATGACT
TTTGTGTTACTTCCATTTGCTGAAGTCTTTCATCTTTTCTATTCATTACCCTTTGGATTA
CCTGCAATTTTGATTTAGTAGAATTTTAAGAATATTTGGTTGTAATCTCACAAACTATTA
AAAGTCTTTTTAATTTTGTTAGGCGAGTATTTGAAAGGGAATCAGAATTGATAAATTCCA
CTAAGTGGAGATTTTCTTTTAATAAGTAGTGACCATATTTTCCATTAGTTCGTATTCTAT
GAATTATTGAGCAAATTTGATCTCATTGGTCAGGTTCCTGCATTTTTAACATGGCTTTTT
GGCCCAGATGAAACAGAGCTTGATTATTTCAACAAGAGGGTCATTGTTTCATGAATGAGT
TAGTGAAATGCTACTTTGTGCAGCAGGGATCTTGGTTTGGGGTACATTTTGCATATGTGT
GTGTGAAGTAGGTGTAATAAACTGGTCTTTTGTATGAGGGTGTGAGAGGAAGGGTTAAAA
TAAATACTTCATTGATTTTTCTTGATATTGCATTAAAATAGGCCATATATAGTCGAGGGC
AGATATTTTGGCACCAACTTGCTTTTTCTGTATTTCCTTTTTTCTTTTCCCTCCTCTCAT
TACTATTCTCTTGAGGCAAAAATTGTTAAGCTCAAAGATTCTAGTAAGGAGATGCTTTTT
AAAATGCCTTATATCGGAAGAAAACTACTTTGTCATTTTTGTGAAAGACTGGGAGGGGAA
GGTTTAGCTGACTGTGCAACATTCCTCGGATTTTCTATTTCCTGTTTATCCTATTCTCCC
TTTTGCTCTTAGAAGTGTTCAGAGTTCTATTCCCTGTTCCCCCCTCCATAACCGCCCCCC
CCCCCCCTTATAAAGAGACTAACTGGCTTTTAGGGAGTGAAAAACTGTTTCACTGTTTTT
GCTTTTCCTAATGGTCTTGGGATATGGGTATAAGATGATCCCAACAACTTTTGTTTCTAT
TTAACTATATCTCCTATACAAGTGTTACCAAGTAGATTGCATAGGGAGAATGGAGCTATC
TTAACTTGAAACTTTTAAGCTAACATCTTATATTTTTTTTTGCTTTCTTGTACTTGCTTC
AAACATTAAGACATGTTGCTGAAATGTTATCCTCATTACAACAAAGAACTAGAAAAAGGA
TCCTACATAATAAACTATTGTATAAAAATGCATCAAATCTATACTGGTCTTTGGGCGGAC
CCCATAGGTTGTATTGTATATTAGTGATTTGTCTCATAAAAATTGGCCCCTACAAGCAAT
TAGAAATTCCAGGATTAAGTGCTATGTTTTAAACTTTCTCCTTGAGGTGAACAAAAAGTT
AATAGTGCTAGATTTGCCATTAGAAACCTGGATTTTGAATCCTCTTTTGGATATTTCCTA
ATCACTTAACTTTAGCTTCAGTTTCCTACTTTCTAAAATGTGGGATAAGACCCATATTCA
CTCATAGTTATTCTTAGGGTTGTTGTGAAGGTAAAACAAGATAAAAGTATATTGGTGCTC
TAGAAACTTTACTAATTTAAACACCAGTTCTTAATAGTAATTTAAATAAATGTTAAAGGT
TATTTTGCAGTAAGAGTTCATTTAAAATTGAAATCTCTAGTCCTTAAGCTCAATCTATAG
TATATAGTATATATTATATTATGTAATATATAATTATATTAAAACTGTAATAGGAAAATA
TATTAAATTGTTTCATATTTTGTTAAAATTCTTTGCTGACATTTCAAGAAAATGTTATGA
AAGAAAATTAAATTACCATGGTAGTCCTATTATAAAGATACCTTATAGACAGTACTACTG
CAGTGAGAAATACTGAGATGTGTACTGTAGGAATCTTACATTTATTTGATTCCCCTGTCC
TGCCCAAGAGGTCTTTTTTTTTTTCTTGTTAACCTCCTTGCATGTCTGGTTTTCCAGGAA
ACTAGACATTTGAAGTAATTTGGAGCAGGTTCTTTTGCTTTGTGGGGCTGCCACTTTAGG
ATTCTATCTTGAGGGATTCCTTAGGTTTCTGGGATTATCTTTGTAGCTCTGTAATCTGCC
CTTAAACTAATTGGGGAAAAAAAATCTAGTTAGCTTTCTTCTACTGGTATCTTTCTTCCC
TCCTCCCCCTAAATAAAAGCCCAATAAACTATGTAAGGGAAAAAATATGAAGACAAGACT
TCAGGACTGAATTCAGAATCTAATTCATAAAAGATGACAGTTTTTCCTCTCAGTGAGAAT
AAGTGGGAAAATGGCTGCTTAAGATCTAGGTGAGTGATGGCAAGCCTTTTAGAACTTTTT
AGGGACCCAGTGTTGTACCTATACTGCCTCAGACACCACTTCCCCTCCTTTCCCCACCCT
TTGCTGATATAGGCTGGTCCTGGGGAAGCTTCCTCCTAGTGCCCTGGGACCCATGTTGAA
TCTAGCCTTACCTGCCTATTGGGCTATGATCCATATGGAGGTGGAGGGAGTGCAGTTAGC
CTTTGAGGGCTGAGGGTGGGGGGAGGAAGGAAGAAAGTGGAGATCTTTTAGGGGGTAGGG
CTGGGCCCATGGAGGGAAAGGTGACCCCCCCCCCCCAGCTGTAGCCCCCAGTCTGAGATT
GGGGAGGGAGAAAAGGAGAGAGTAGCCTGAGTGCTCTGCTCATGGAGGGGTGGAAAGGGG
GAAGGGAGCAGATTTGCTGGTGATGTACCAGAAGAGAGGTCTTTGTTGTCTTCAGCCCAT
GTACCATAGGTTCACCATCACCAGTCTAAGTAATTAGCAGTAGAAAGGGAAGAGGTCAGA
ACAAATTGTTGAGGTATAGCCAAGACTTGACATTCTTCCTTCCTCTCCCCTCCCTTTTTT
TAACCTCTCTTATAATCAGTACTGAATTTGACACTTGAACTATTGCAATTTTTTAGTCAG
TCTCCCTGATTCTACCCTTTCCACTTTCTATTCTGCCATTCATATACTACCAAAATAATC
TTCCTAAAGGATAGGTAGATCTTACTATGTCACTTTCCTGTTCTAGAATCTTTAACAATT
CCCTCTTTGGGATAAAATGCAAATTCCCAGCTTGATTACTTATCAGTCCAATCCAAAGTT
AATTATATAATATATACAACAAGATATTGTATCAAGGGTAAGTGATGAAAAGATAAAACA
TAGTCTAGATCCCCAAGGAGTTAGCTAGCATTCTATAAAAGCTTAGAGGAGCTGGGTTTG
GAAAAAAGCTTGAAGCCTTTTTTCTGTCTGGCTCCAGCCTTCTTTTCCAGGCTTGTTTCA
CTTTAGTACTCCGTATGTTAGGTGTTCCAAGTCCAAATTAACCTATTTTCTGTTCTCCAG
ATTTGATATTCTGCTTCACATGTCCTCTCTTCCTGGAATGTTCTCTCTATCTTTGCTGGC
GAAAACCTCTAGTTTCTTGCCAAACTTAATTCTAGAGACCTTTTCTGAATCTCCTACCTC
CCCTTATTTTTGTTTTTACTGATCTGTGCATATATTTATCTCATGGGTAGAGTATAAATT
TCTTGAGGGTGAGGTTTTTTTTTTTTTGTATACTTAGTGCTGTCATTAGTCAAGAATTTA
AGCACTTCACTATGGCTAGGCACCATCCATAAAAAGTAGATGCATGTTAAATTGTATTGA
ATCTCAATTTTACAGATGAGGAAACTGAGGTATAAAAATGTTATGATTTGCCTAAGGTCA
CTTGTATAGAATAGTGAAGTTGAGATTAAAACCCTTTTCCTCTGATTCCAGATGTTATTT
TTAGACTACCTTGCCAAATCATACATCATTCCTCTTTGTATATATTTGCTTGTATTGCTG
GGCTTTCCCTATCGCTCTCTTTTATTTTTTAAAAAATACTTTATGTATTCCATCCCAAAA
ATTGCATATTAAATGATTTGTCAGATATTTAAAAATTCAGATTATTGATGGAGCCATAGG
CAAATTATATATCAAAAGAACATTCATTATTTTTTGCCTAGGCTTCCAGAATTTCTAATA
TAAGGCTCATTATAGATGTAAAATTAGCACAGAAGATGTTGACTTGAGGTCTGATTTAAA
TTTTTTTTATTATTATATTTTATTGTAATTGTTTTCCTTTGTAATTTTCTCTTGTTTTAT
TTCATGTCTTTATAAACATCATTCTCAGGAATCTGTAGACTTGACTATACTGCCAGAGTC
TATGCCAATAAAGATCCCTGGACTAGCAGTAATAGTTTCTTGTCTTGCAAGTTCTCAGAA
GTTGATAAATGAGTATTGTAATATCTGTTGTTTTTTTTTTTACTAGAAACTTAAATATGC
AATCCTGTGAAATAATGTTTCAAATAAAATAAAGTTTGAAATAATGGAGATGAGCACATC
AATGAAGCAAAATCATCATTGGAGCTTTGTGATGAGTGAAGTGTGTGAGTGTGTATGTGT
GTGGTGTTTTTTTTTTTTTTGTCTAACCTAGAATTTGGTCAAGAAAATGATGGCTTTCTG
TGTAACTAAAAATAATTTTAACATTTTTCCACATTAAGATTGTGGGGGGGGGGGATGGTT
TGTGAATATAGAGCCCAATGAACTACATGAAATTAAATTGAAAGGATGAAAAGTAGGTTA
GAGTTAGAACTGATAGGAACCTTTGGAGTCTTCTGATGAGGAAACTGAGGCTCAGGTGGG
CTAAATGACTCATAGGTAATATTGTAGCACTGCTAGGATTTGAACCATGACAGCATAATT
TTCTCTTAGTAAAAATCTTGCCTGCCAGTTTGTGAATTCTGAAGTTCTTTTGCATGGTTA
GTTTTGCTTAAGAAGTTTTTTTTGGGGGGGGTCTACTTGATTCTACAGAATAAGTGTTTT
CATCAAAAAATTTCTTGCATCAACATCTCTTAATGTGTTAAAATCTTTCCAGTTTTACAA
GGGAATGCTTTCTTGTTTTCCTTTCAAACTCATCACTTTTGGGTTGTCATATTTAGCTAT
TTAGACTAGGAAGATAAGTATAAGAAAACAACTTGCTTTGCTTATCCTTTTAAATAACTT
TAAAGTGGAATCTCTTAAATGTTTATTTTTTAGTGAGTTTAGACTTATAAAATATTAGAG
CTGGAGGGGACCTCTAGTAAAATATTTTACCATTTAACTTTCTAGTTGAAGAAACAAAAT
CCCATAATTTGTGATTTTAAGCAAATTATTTGAGCAGTTAGTTAAGGGGGTTTTAAGACC
TCTCTCTTCCCTGGGGTCAGAACTGTCTCACTATTCTTCCTATGTACTCCACAGCTGCCT
CAGACCAATAATTGAGTTACAGCTTACTGTTGAGACCCACCCTAAATGTCACCCTGGGGA
AATAGTGAAACCAGTTCTGAATTAAATAAAGAGGAAGACAAAAAGGAGCTTATAAATGCA
GAATGTCACACAAGAGTCTTCATTGTTTCAGGAGGGTAGTTAATTCCTTTTGATGAACAT
TGCCAGTCAATTTTTTATTATAGCTGCATAATATGATTTTGGCATCTTTCTTTTTGCATT
TAAGTATGATTACAAATGAAGCCTTTCTGGGTGGAGACCAATACAGGAACCACTTACTTG
TTCCTGATTGCTCCTTTTACTCACCTTTGCTACTAGTATGGTAATCATAGAATTATTGAA
CTACTAAAAGGGGCCTCAGAGATCAAGGGACTTGCTTAAGGTCCAGTTCTGTGGTTGGAA
ACCCAGCTCCTCTAAGCTTTCATAGAATGCTAGCTAACTCCTTGGGGATCTAGACTATGT
TTTATCATTTCATCACTTACCCTTGATACAATATCTTGTTGTATATATTGTATAATTAAC
TTTGGATTGGACTGTATGTGTCCTAGAGGAAATGTGGTAGTCATTTACATGTTTTAAATT
TTAAAGAGAATCTCAAGCCTCCTATTATAGGATGCTATCTGCTGGTCTAGAATTAGAGGG
AGCAGTAATACTAGCTGGCCTTCACGTGGGACTTTTAAGGTTGGCAAAGCACTTTACATA
CATTATCTTATTTGATCCTCACTACTTCTCTATGAATGTCATTTTTTCGATTTTACTGTT
GAGGGAAACTAAGCCTGAAAAGAGGTTAAATGACTTGCCCAGTCTCTTGGCTAGTGTTTC
CCAAACAAATAAACAAAAATTCTTGCATCAACATCTATGTGTTAAAATTCTTCCAGTTTT
AAAAAGGAATGCTTTCTGAGGTAGTATTTGAACTTGTGGACTCCAACACCAGGTCTATTT
ATTGATAAGTAATTATACAAAGAAACAGCTTAAGCAGAGATGGTATTAACATTTTTTTAA
ATTATTCTATTCTGAAGTTAATAAAACATCAGCATGATTCAATATGGATGTAAGTAATTG
GAATTTAGCTATACCTTAGGTACATTAGGGCCAGGGTGGGTAACCAGTTGAAAGTTATAG
TGAGAGACAGCTAGGTAGCTCAGTGGATTGAGAATCAAGTCTCAAGATAGGAGGTTCTCA
AATCTGTCTTGAGACTTCCTTAGCTGTGTGACCCTGGGCAAGGCACATGTAGCCTGGCCC
AGGACACTCTTCTGCCTTGAAACCAATTCACAATATTCTAAGACAGAGGGTGTTTTTTTA
AGACATTAAAGTGAAAATATTTTTGATTAAAGAAGGGAGGAGATAAGTGATAAAATGCTT
TAAGTTCTACAATAACACTTAAACATTCACATTTAGTCATGTAAATAATCCTGTGAATTA
GGTACTATTGGCATTGTTGTTATCCCTTTTCTGTAGATGAAGAAACTGAGACTTAGGTTA
AGTGACTTGACTGTGGGTGGTCATTAAGCTAGTAGATGGTTAGAGGTAGAATCTTCCAGG
AATGACCAGTATTGTGTCCTTTTCTTAGAATAGGGAAAAGAGTGCCTTATTGTGAGTTGA
AAGACATGTGTTCAGATCCCAGCTGTGCTTTTTATTATCTTTATGATGTGGGGTAAGTCA
CTGAAGTTCCCTGGGCATTTAGTTTTCCTTATTTGTAAAATGAAATCATTGGAATAAAAG
ACTGGGCTTTTTGCAGATCTAGCTCTATGATCCTTTAGGAAAGAATTTAAACCAGAATGC
CTTCCATAGCAGGTGAAGTAATTTTTGGCTGAGCACATTCCAGGGCATCTGTTCTTTGAT
CTGTTCTACACCTGAATTTGTGTCCTTGGCTTGCAGCATATGTGAAATGATGATGAAGTT
TATCCATTCTCTGAGTGTGCTGCTCTGCCCTTCCTACAGCTCTGAGTTCCTGTTCTAGGA
ACTCTTGAGTTATGTAACCTCCAGATACCCTCCAGACTTGCAGTGTTCTACTGTGGATGG
CAGGTGTGTGTGGTGGTCTTACTAGTAGGAAGAGATGGAGTTAGCAGAGGTGAAACCCCA
TTATTTGGGGTCCCATCTTACCAAGACGAATGACTGGTGTCTGATCACATGCTGCAGACT
TTGAGCTGTTTCTTTGATAAACTCATCAGTTGCTATGAATGATGGACATATAATGGTCAT
TGTTTTGCTGATGTGGGTTTATAAATCTTGGATCCTTAATGCCCACAACAGGCCTAGGTT
ATACCTATACTGATCCACTGATAGAGCTAAAATGTAAAACTTCCTGAGGGAAGATTTTTA
AAAATGTTTGTATCTATACCTAGACATAGTATGCTCTTTTTTTTTTTAACCCTTACCTTC
TGTCTTGGAGTCAGTACTGTGTATTGGCTAGGTAAGGGCTAGGCAATGGGGGTTAAGTGA
CTTGCCCGGGGTCACACAGCTGGGAAGTGTCTGAAGTCATATTTGAACCCAGGACCTCCT
GTTTCTAGGCCTGGCTCTCAATTCACTCATAGTATGCTCTTAATAATTGCTTGCTGATTA
ATGGAGGGAAAATGGTTAGAGAGTTTGATGAGAGAGTATTGGATTACTAGTCAAGAACAA
CTCAATTCTAGTGCCATCTCTGCTATTAACTCAGTAACTAATTTGGGGCAAGTTTGTACT
TGTAGAGGAATTGTTCTCCATATTTAGAACAATGAGTTTGGAGGAGAGTATCTTTAAGGA
AGGCACTTTCAGCAAATAAAGGGGTCAGAAGATTAAATCATGAGAACATAAACATGCAGT
AGTAGGTTAAGAATGGTTCCTGAAGTACTGCCATAAGTTAGTTCCTTGTTATTCTGCTTT
AGTAAGGTTATAATAAAATTTCCCAACTGCTAAATTTAAAAGTTGTCTTTTAAATTATAA
GTTGTTGTAGAGGGGGTAGTAAAAGGAAAAGCATTATTTTTCTTGGTTTCTAGGGGATTT
TGGTACAGCTATTCAGTTTGGGTATATCTTTAAAAACTAAGTTAAAGTTGATAGTAACAG
TGTAAAATGCAGATCACTTTATGTAGTTTAGGTCTTAACTGAAATTTTGATGTTCTAAGA
ATTAAGGAATATAATTTAATTTAATACATGTCTCTTGATAGTGAAAAACAGAAGCAGTAT
TGACATAAACATTTTTAACTTTTTTTCTCTCTGGCAACCTGGGAAATATAATTTGAGTGT
CTTTGTAGAAACTCTTCAAATTGAGCCTCAGATACTTTCTAGTTGTATGATTCTGGACAA
ATCACTTAGTCTCCGTTTGCCTCAGTTAAAAACACCTATCTCTCAAGGTTGTTGTGAAGA
TATCAAATAAGGTGATAATTATAAGACACATTAGCACGGTGCCTGGCACATTATTATTAA
TTAAAATCTTAGAAATTTGCCTGAGACAGTAAGAGACTGACTTGCCTAGAGTTATATAGC
TATTAAGAATCAGAGGGAGGATGGGAACCCAGGTCATCCTCAATATACTATTCATTCTGA
AATTGTATTGTTAATAATGGAATATTATTTCATTTAAAAAGTATTTTAAGTCTTATAAAA
CTTCTCCCAACCCTTTTAGGGAGGTGTAGTGCAAGTGTTATACCTATTTAACTGAAAAGG
GAAACCAAAGCCCAGAGAGACTGCCTTGCCAGGAAGGCAGGATTAAGATTCCTCAAACCC
AAGTTTTTTCTAAACAAGCTTAGCTTTCTTTTCACAGAACCAAATCATTGTAAAGCAAAT
TTTTTTTTCCCACAGAAACAACTCTAATTGATTTTCCAGGACTCCACATATATGAATCAT
AGATTTAGCAAATAATATGGTAAAGACAAAGAAACAATCATCACAAAGTTCCATCATTTT
CACCTTTAAAATTCTACACTAAGACCTATAAAATGGGTGCAGTACATGCATTCTTAGGGC
CTTCATGTGCTATAAAGTGTATATTAAGCACATAAAATGTGAAATGTGAAAAATGTGAAA
TTAGAAATGGTATACATGTGGTTAGGAATGGAGATGCTGGGGAACATCACTCAGACCTGT
GATTCTGTCAGTGTAGGCCCTCCTTCCACCTGTTTTATCTATAACTGAGTCTCAACTGTT
TGGGACAGAATCAAATGGGTTCAAACATTTGATTATTGTTAGCATCCTCCTGAGGTTACT
CTCCATTTATACTGTGTATATCTTTATGTTAAATTTTTTGCCTGTTATCTCACCAATTAA
AATGTGAGCTCTTTGTCAGAGCTTAGCATGGTGACTTGCCACATAGCAAGCATTTAATCA
AATGCTTGGTGGTGACACAACTAGCATGTATCAGAAATAGGATTTGAACTGAGGGCTTTC
TAAAGGTCTCCGAGGCCATTCCTCTAATCCCTATGCCATGCTATTGATATACATAGGCGT
TAGAGGAGTGACCTTGAAGTTCTTCATCATTTCATTCAAGTCTTCTCAGGTTTGTCTGAA
ACCATCACTTTCATCATTTTTATAGTCCAGTAATACTCCATTTACATTTCCTAATTGCTG
GGCACCTTCTTTGTTTTCCATTCTTTACTAAAGCAAAAAGATTCAGCTACTATAAGTATT
TTTACACATGAGTTCCTTCTTTGAACTCTTTGAGGGGAATAAGCCTATTAGTGTGGATCA
CTGAGTCAAAGGCTATGCACAGTTTAGTAACTTTTGGGACATAGTTCAAAATTGTTTTCA
GAATTTCTGTACCATTTCACAGCTACATCAACAGAGCATTATTATGACTATCTCCCTCCC
CAAACAGTTACTACTACTTTTAATAAAAATCATTTTGGGGGTAGCTCAGTGGATTGAGAG
TCAGGCCTTGAGAGGGGAGGTCCCGGGTTCAAATCTGGCCTCAGACACTTCCCAGCTGTG
TGACCCTGGGCAAGTCACTTAACCCCCATTGCCTAGCCCTTACCACTCTTGTGCCTTAGA
ACCTATACCTAGTATTGATTCTAAGATGGAAGGTGAGGGCTTTGGAAAAAAAATCATTTT
TGTCATATTGATGGCCTGAGATAGAAATTCACAATTGCTTTAACTTGCCTGCTATTGTTA
GTGTTTGTAGCATTATGGTTGATTATTTGAATTTCTTCCTATCCCTTTGACCATTTAACT
TTTGGGCAATGGCTCTTGTACTTTTAAATTAGAGCCAATAACTTATATCTTGTAAATGAG
AGCCTTATTAGAAAAAACTTATTGCAAAGATGTTTTACCAAATTAACTTTTCTTTCTAAT
TTTGACTATTTTTTTGTTAATTTTTAAAATTTCATTTAAGCACAATTATCTTTTATCTTC
TGATCATTTCTATCCCTTGTTTTGGACATGAACTCTGTATGTAGTTGCAAAAGCTATTTT
CTTTCCTTCTCTAACTTTGTGATTTGACCCTCACAGACACCCATATATCCATTTGTTACT
TGGCTTAGTATATAGTATGATGTGTTGGTCTTTACTTTGTTTCTGCCTGGTTGCTTTTTT
TGATAGTTATCCCAGAGTTCTGTTTGAATTGTGAATTCTTAACCCTGATAGTTGTTGAGG
TCTAGGTTTATTGAGCTCTATGCAACTGTAGTGTTTGTGTATCTAATCAGTTCCAGTGAT
TAACTTTTCTATTTTTTAGTCAGTACTAAATAGTTTTAATGATTAATACTGCTTTGAGTA
GTTTGAGATCTGTCATTGTTAATCCTTCTTCCTTTCTACTTTGTCATCATACCTTAAAGG
GAGATGTATTTCACAGAGATTTCCCCCCACCCCCTATCTTCTTCCCATGTCAGATACTAC
TTGCAGATCATGCTTTTTAAAGAACCATAAAATTTTATAAGTGAAAATGCTGTAAGAGAA
CCCTTAGAATTTTCCCTGGCTAGTGGGATGTTGACATACATATCTGTGCTACAGTATGAG
TCAGCCTCCTATGATTTTGGGTCATAAAGTATTCTGATGAAATGTCAGCTTTTTTCCCCC
TTCATTGTTGTAAATATGTTCTCAAAACTAGGGTTGAAGATTTCCCAACTGTGAATTTGC
TGAATTTATTTCAACAGTTTCGAAAACTAGGAAGAGCAGTGAATAGTTATCTTAGAATGT
TACCAGGAATAAAAACCAATTGGGTTCATTAACCTGTAGTGTAGCGACAGGTCAACCAGC
ATTTGTTAAATTATCACCTACTCTGTTCTAATTTCCAATTCCTATTCATAGATCTGGGGA
TACAAAGGAAGGCAAAGAACAAATAGGTCCTGTTCTGTGGGAGATATAACATACAAACAA
ATATGTACAGACAAAATATATATACAGGATAAATTGGAAGGACCAAGGTAGGTTCCTTGC
AGAAGATGTAATTTAAGCTGAGACTTGAAAGAGGCTAGGAAATGGAATTAGAGCATTCAA
TGCATGGGGGATATATAGTGAAAATACTCAAAGTTGGGAGATGGAGTATGTGTTGTAATA
CTTGATGGATTAGGAACCCAGAAGGCTGATGAAATGGCTGATAAAGGAGGGACCTTCCTT
CCTGTTCAAGGCAGCTGGTGTGGAATTGTAGCCAGTTCTGTTCTTTTTAAAAATATTTTT
TATTTAATCTTACTTTTTCCCAGTCTTCTGGCCATTTCTCTACTTCATGATTTTTTAAAA
AAGGTGATCTGATAATGTCTTAAGCCACATTGTCTAGTTTTGTTTTTTTTTATCACACTG
GTTATTGTTTATGCTAGGAACAAATAACCTGACCTCATGAAGGGCAGGTAGGTGCTTCCC
TTACCATCTTTCCCTACTTGGATATCAAAGTTTTTATTAAGGAACAATTTAAATTCTGTC
CTTTATAGCTTAAAGTATTTTCCTTGACAGAAAAAAAAAACAACCCTGAAGCAAAATAGT
TGAACATTTTTCTTCTTTTTCCTTGTCTCTTTATCATTTCAGTTGCCTTGAACAATGCTC
TTATCCTTTTTGTAATTCTCCTTTTGCCTCATTCAGTTTTTTCCCTGAAAACCTCATTTT
TGTTCTTGCATTTTCTTGCCATTTTGTGCTTCAATGTGTTGGACACCTTATAGTCTTGTT
CTATTTTTTTTTTTTAACCATTACCTTCTGTCTTGGAACCAATACTATGACACAATCCAC
TGTGCAACCCAGCTGCCCCCTTGTTCTATATTTTTTGTTCATCTCATGTTACCTGCTCTT
AAAGCTTTTAAAATTTTGATTTCTCTGTGCATCCACATTGGTCTCTTGACTAATTTACCT
TTTTCCTCAACCTATTTATTTGTCTTTTAATGTCTTCAGAATTTCATTTAATGTCTTCTC
ATTTCTCCTCATCTTCCTTCCACTTTAGGATTTTAGGCCATTTAGGGTTCATTTTTTCTT
TTTTCTTTTTTTTCCTAATTTTTTCTTTTAAGATTCTAAGATTCTACAGTCATTTCAAAC
CTCTCTCCCCAAAAGAGAACGCATTTAGTCCTTCATTGTTTAGACTTTTCCCATATTTAG
TATTTTTACCTTTTGAAGGATGAAATTATCATTAAGATATTAGCCATTCTACTTTTGGTG
GAGTTCCTTCAGATATATGATTAATAGAGGTATCCCATCACTAACATGTCATGCATGCCT
TTGTGTCTGACTTGTGATTAAGAGTCTGTTTAGTTTTTTTGTTTTTTTTTTTAAGATGCC
CAAGATGGAATCAAGGAAATATAACTAAAAAGATATTATAACCCAGGGGGGGAAAGTCTT
TGTCATAATAGTTTTATATTTTTAGGTTTATTCTTGTAAGAAGATCTAGAGTAAATTAGA
GGATTTTCTAGAGTGAAAAGGTGATGGTTCCCTTGCATTGTGGCTAGATCACATCCCATT
TAGAAGATTATGCATTTTTAATTCTAGAAGATACATTTTAGGAAGACCTGCTGTTATTTT
CAGTGTCAAGGAAAGAGAATTGGAATGGGTCCAGAAGAACTTTAGGATTACAAAATGAAG
AAGGGTTGAAATAGCTAGATATAATTTAGCTTGGAAAAGAGAAAATTTGATGACAGGCTA
AGTAGTTACAGAGCTGTCGAAATACTAGACTTGCTCTGCTTGGCTTTAGAAGGCAGAGCT
GGGAACAAGGGCCAGTAATTGCATCGAGGCAGATTTCAGTTCCACCTAAACTTCCTTTAA
GAAATGCTGGTGTCAAGGGTGTGACTTGAATGTTTGGCCTTAGACATCTCTTCTAATTGA
GGACTTCTGAGATTGTGATTCTGAGGTAGAAAATCTGGGCCTGCATTCAAAATTTCTTGC
TAATAATTAACTTTTCTATGTTGACATAATCTAATGTAAATCACTTATGTCTCTGAGCCT
CAGTTTTCTTTCCTATAAAGTGGAGGTAGGTCATAATATTTGTTTGCATTACTTAATTTG
ACAGGATTGTTTTGAGAAAAGAACTTTATAAACAAAATTTAAAGTGCTACATAAATATGA
AGTTGTTAGTGTTCTGTTGCTTGGTGTAGATGGTTTAAGAGACCATCTGAAGAGCAAAAT
TGTTCTACTTCCAAAAGATTTGGAGTCGGAAGGGATCTTGATCATCTAGGTAGACCACCT
CATTTTTATAGAAGAGGAAACTGAAGTCAGAGTAGCTAAGTGAAATTTAGTAACAACATA
GGCAGTAAGTAGCAGGGTCTGGATTTTGTGTTCAGTTATTTCAGTCATGTCTGACTCTTT
GACCTCATTTGGGGTTTTGTTGGCAAAGATACTGAGTTGTTTGCCATTTCTTTCTCCATC
TCATTTTACAGATGAGGAAATTAAGAGAAGCAAAATTAAGTGACATGACCTTGTTCATCT
GAGACCTGGATTTGAACTCAAGTCTTCCTGACTGCAAGTCTGGTCCTCTATTTACTGCAC
CATCTAGCTGACCTGGGACTTGAATTTCACCTCCAACTCCTTTTCACCATCATACAATCT
TTTGTTCAAGTGTCAGTGAATCTTATTAGCAATCTTTGAGCCTTTGAGAGTAGAATTTGG
TGAGGTGAAAGTATAGGCCAATCCTGAGACCTTATGAAAGGACATTTGAAGACTTAGATT
TTGAGTTGGGTTGTATTGAATTATAGTTTTTGACCTTTTGTAGTATGACCACAGTAGCCT
TTTTACCCAGGTAAAAGGAAGAATCGTACAGTAAGCTCTAAACCCTGAGTCACCCATCCT
AGACTTGGGACCAACAGTATTTGGTCTCCAAGCTCCAGGGAGTCCTCTCCTTGAATAGTT
CCCAGATCTAGTCTTCTCTCTCCTTTCTCCCAAGTGCTTATCCCTGACCAGGTAAGAACA
CTATAAATCCTCCAGATTTCACTGGTTTAAGGAGATTCCCTTGGGATTCCCTAGGGGTTA
AGGGGCACTTAACTCCTGGACCCCAACAGGCAGGACTTCCCTATTTCATCTTCCTGGACT
GCTCCTTTGTTTATCTCCCCTTAATAAAGCTGACTTGCATTACTGTCTTGTGGGCTCCAT
GTTTCCTTGTATTGAGCTTTTGGCATTTGAACTTGAATCTGTATTAAGACAGATGTAGAT
CAGTAATTCTCTGACTTTGACTCTGACTTCAAATTTAGCCTGCTTCATCTTGTAACATAG
CTTGCTTGATAGTTCAGCTATATTTTTTTTAAAACCCAATTAATCAGCACATAACATAAT
AGGTCAGTAGGCCTAACCTCACTATCCTGTAACTTATTCCTATTTGGTATAATGTAGAAG
GTTTGAATCTGAATAATTTGATTCTAAATCATTTCGTTTATATTTTCAAGATAAATTTTT
GTTTATATCTTGTTTTTATATTACCTGCAATTCCTACCATATGACCCGTCACCCCCTCCC
AGAGAACTGTTCTTCACAATTTTTTTTTTTTGCAAAACTAACCAACACATCAAAAAAGTA
TCACGTAATAAGCAGTGTTCCACACCCTTGATTTCTGGCCTCTACAAATAGGCAATGGAT
AGTGTCATCTCAGCTTTTTTGGGGGGCCAAACTTAGTCATTAATTTTGTGGTACTCACTT
CCAGCAAGAATATTTGTTGTCTCTTAACTATTTGCCTCAGTTTCTTTAAGCTATCAGGAA
ACATAGATACCTCAGTCCCCTATGCTGAAGTAAAAAGCTTCGTGTAGCATAGTCCTTCCT
TGAAATTTGAACATTCTGTGTATATGTGCTGACTTGAATTTTTTTGAATAATGCACTTCC
ATAAACAGCCATTCCTCTTAAAGAGGAAGGAAGTGTTATTCAAAGAATGCCTATGCTAGA
ATCAGCTGTGACAAATGAAAAGATCTCTGACCTCTTTAGCTTTATCTTCATTCCTCAGGA
AGTTACTATCAAAAATCAGGTGACCATATGACAGAGTCATATGATGGCAATGAAATTTAT
GCCAAACCTGTGAAATAGCTAGGAGTAAACCAGAATTCATCCCAAAATAAAGGAAACCAG
AGGAGACATATCCAGGACTGTTATTTCTAATCCTGAAGTTGGTTGTTGAAGTTTTTGTTA
AAAATTAGGGTACTAGAGCAAATATTGATTAAGGAAATTTGGCAGTATTAGAATAAGATA
TCTGCTGTAAATTGTAACTAAGTAAGCTTCCTTGCCAGAAAAACTTGTTAGATGCATTAA
GATATGTTCCTTAGTTTTTAGGTCATCTAAAAGAATTGCTTAATAAAGATTTACTTCGTT
TACTCTCATACCTTATATATGTATGTATATATTTTTCTGTCTCACTAAACCACTGAATTA
GAAATTAGAATAGTGAAGGGGAGAGAGATGAATAGATTATGACATCTGAATTAGAAGGGA
TTTCAAATCATATGACATTCCCTCTATGGCATATCCCACAAGCAATTATCAGGTCACCCT
TTACCTCCAAAGATGAGATACTCAGTATTTGTTGAGGCAGCCCATTCAACTTTTAGACAG
CTATAATTATTAGGAAGTTTTTTTCTTATTTTGAGCCAAAATTTGCCTCTTCAATGTTCA
CCCACTGCTCTTAGTTTCTGCCATTTGGGGCCAGATGGAACTGGTATAATCTCTTGTCTA
CATGATTGCTTTTGTTATTTAGTGATTCCAGGCATGCCCACTTCACAACCCCATTTTGGG
TTTTCTTGGTAAAGATACTGAAGTAGTTTGCTATTTCCTTCTCCAACTCATTTTACAGAT
GAGAAAACTGAGGCAAACAGTTAATTAACTTACCAAAGTTCATACAGCTAAGAAGTGGCT
GGGGCCAAATTTGAATTTAGGAAGATAAGCCTTCCTGACTTCAGGCCCAGCACTCTTAAC
TCACTGAACCACCTAGCTTTCCTTTAGGAATTTATAAATGGACAGATAATATTTCTCATT
TCTCATAAATACAACAGAATAAAGGTACTCTCATAATTTCATTTACTTAATAAGCTGTTG
TTATTTGATGTGTTCTAGGTACTATGTTAGGTGCTGGAGATATTGACAAAAATGAAATGG
CACCTACTTTCATACTCTGAAATAGCTTAGCTTCTAGATTCAAAATATAGACAAGGCAAT
TTCCAGGGGAAGGGCATGAGCAACTACCGTACCAGAAGAGGCCTCATAAAGATGATGCTT
GAGTTGAGATTTGAAGGAAGTTAGACATTTTTGAAGGTAGAAGTGAGGGAGGGAGTACAT
TTCAGGGACTGGGTACAGTGCCGCCTGGGTGACACTAGATTTGGAAGATGGGATGTCATG
TACTAAGAATTAGGGAGGCCATTTGGAATGTAGACTGTGAGAATAATGTGCAGCAAGCCT
GGAAGGCAGGCTGGAGCCAGATTGGAAAAGCCCTTAAAAACCATACAGAGAAAAACAACT
ATACAGAGGTGTTTATATTTTTATCTTGTAGACAACAGGAAACCATTAGAGCTGGAACTT
TTTAAGTGGGGAGTAACTTGGTTGAGTCTCTGCTTTTAGGAATATTAATTTGTTAGCTGT
ATGAAGGATGACTTGGAAAAGAGACGAGAGCAAAGAGGAAGTTATTGTGAGGGTGTGATG
TCAGTGGAGGAGCGGGATGTGAGTGAGAATGCAGAGAGAGAAATAACAAGACTTCACAAC
TGTTTGGACACAGGACATGAGGAGTCAAGGGAAGCTCAGGGAACCTGAGTGGAAGAATGG
TAATTTAGACACAGGAAATTTAAGAAGGGGGAAAGTAGTTTTGGGGAAAAGATGAGTTCA
ATTTCAAACATGGAATTTGAAATGGCTGTTAGTCACTCCACTGGAGTTTAGTGGTCAGTT
GGTGATCTTGTTCTGGAGCTTGAGAACAGGTTCTGGATCTATCTATCTCTGTGTAGATCT
GGGAATCATCTGCAAAGAAGTGATAGCTGCACCCATGGGAGCTTATGAGTTCCATTGAGT
GAAGAGAAAGAAAATGATGAGAGTGCCTGGGACATACCTCTCTGGAGTACAAAATCAAGG
AGGATGATCCAACAAAGGACACTGAGAAGAATCTTGATAGGTCAGAGAACAGTATAAGGA
AAACTGGAGGAGAGAGCAAGATAAGATAAGGAGAGGAAAGACTATCAAATTTGACAACTA
ATGGATCATTGGTTTCAGTTGATGAATTTATTTATTTTTTGAGCCCTTACCTACCGTCTT
GGAGTCAATACTGTGCATTGGCTCCAAGGCAGACGAGTGGTAAGGGCTGGCAATGAGGGT
TAAGTGACTTGTCCAGGGTCACACAGCTGGGGAGTGTCTGAGGTCAGATTTGAACCCAGG
ACCTACTGTTTCTAGGCCTGGCTCTCAATCCACTGAGCTACCTAGCTACCCCCTCAGTTG
ATGAATTTAGAAGGCAAAAATGAATCTGAGATGAGAAAGTGAAGGCAGTGAGTATAAACC
ATATTTTTCTAGAAGTTTGACTATGAAGGGGAGAAGAGATAATTCAGTAGAATTTGGAGA
GAGAATTGTACCTGGACAAGACAGGAATAGATAGGAGCTGCTTTTTTTCCCTTTCTTCCT
AAAGGGACTAGAACTAAGGAAAGAAAGATGGATAGATTGAGAGAAGAGTGAGATGTAGAA
TACTTTCTGAGTGGAGTGATCATCTTCCCTCTTTTAAGACTGTTTCGGAATTTACTCTTG
TACTTTTTTCTTATGGTGTCACATTCTGTGATTATCAGATCTCTGTTCTTTGTTTTTGTT
TTTAATTTCCATATTCATTTTTGTAAGTGAATAATCTCATAAAACCAAATCCCCAAAACA
TACCCAAATAAACTAGTGATAAATCATGCTTTTATCTGCATTCCTACTCTCAACAATTCT
TTCTCTGGAGGTGGATAGCTTTCTTTTTCTTAACGTCCTTCAGAATTGTTCTGAATCATT
GCATTGCTGTTAGTAGCAAAGTCTTATCACATTTGATCATTCCACAGTATTGCAGTTACT
GTGTATAATGATCTCCTGGTTCTGCTTAATTCACTCCATATCAGTTCACATAGGTCTTTC
TAGCTCTTTCTGAAATCATTCTGTTCATGATTCCTTAGAGCACAATAGTTTTCCTTCACC
ATCATATACAGTAGTTTGTTCAGCCATTCTCCAGTTGGTGGACATCCCTTTAGTTTCTAA
TTCTTTACCACCACAAAAAGAGGAGCTATAAATCTTTTTGTACAAACAGTCCCTTTCCCA
TTTAAAAAAAAAATCTCTGAGATACACACTTAATAGTGGTATTTCTGGATCAAAGGGTAT
GCATTCTTTTATAGCCCTTTGGGCCTTATTCCAAATTGTCCTCCAGAATTGTTGCATCAC
TTCACAACTCCACCAGCAATGCATTAGTGTCCCAATTTTGCCACATCCCCTCCAACATTT
ATCATATTTCTTTACTGTCATATTGGCCAGTCTAATAGGTATGAGGTGTTACCTCAGAGT
TATTTTAATTTGCATTTCTCTAATCAAAAAGATTTAGAACATTTTTTCATATGATTATTG
CTAGTTTTGATTTCTTCCCAGATCTTGATTCTTTTTTTTTTTTAAACCCTTACCTTCCAT
CTTGGAGTCAATACTGTGTATTGGTTCCAAGGCAGAAGAGTGGTAAGGGCTAGGCAATGG
GGGTCAAGTGACTTGCCCAGGGTCACACAACTGGGAAGTGTCTGGGGCCAGATTTGAACC
TAGGACCTCCCATCTCTAGGCCTGGCTCTCAATCCACTGAGCTACCCAGCTGTCCCCAGA
TCTTGATTCTTAAGCCTTTTTAAATTTTTTTTTAAACCCTTACCTTCTGTCTTGAAGTCA
ATACTGTGTATTGGCTCCAAGGCAGAAGAGTGGTAAGGGTTAGGCAATGGGGGTCAAGTG
ACTTGCCCAGGGTCACACAACTGGGAAGTATCTGAGGCCAGATTTGAACCTAGGACCTCC
CATCTCTAGGCCTGGCTCTCAATTCACTGAGCTACCCAGCTGCCCCCTTCTTAAGCCTTT
TATAGATCCTCATTGATCTCTTTATCAAGAAGTTCCTGAGAACTCCCCCAACTTGCTACT
TTCTAGTCTCCTTCATCCAAAGCCAACTTTCTCATCTAGTGTTTCTAGTTTTCTTAATCA
GAATGCCAATAGGCTACTTGCTTCCTATAACTAGAATTCTGCAAAAGTTGACTCAATCCT
ATCCTTGCTTTCCCCTTTTCAAAGATAGACTCCTTTTCTTACTATATATATATATACACT
TAATAGTTTGCATTCCATACCTATACTTAGCTCTTACTTTGTATGTCACTTAGTCTTTGG
TTTCTGCCACTTCAAAGCTAAATTGACTTAGTAGAAAAGAGAAGTATCACAAAGCATTTA
AAGTGGTAAGCTTCTAGAGTTGAAATTAAGATTTTGATTTTCAGTTATAAAAATTATGTA
TATATAGCCCTTTAAAATTTTAACTAAAGAAACTTCATGTTATTCAGTGTTTATATCTTT
TTCCATTAGGCTTTAGGTCAGTGGTTCTCAACCTCTCAATTTGTAGCAATGAGAATACAC
AATACATATCAGGTATTTACATTCTGAATCATAACTGTAGCAAAATTACAGTTTTGAAGT
AGCCACCAAGATAATTTTTTGGGTTGGGGTCACTGCAACATGAGGAACTATATTGCGGAG
TCACGGCATTAGAAAGGTTGAGAACCACCGCTTTAGGTTGTTCAAAGATACTTTTACTTT
ATACTCTGGTATCTAAAATCTGTGACTTGTAAACTCAGTGTCATGTAGAATTGGGTGTGA
CATAACCTGCACTGTATTTTTTCCATGTGGTTTGGCTGTTGTGCTCCAGTTCACATAAGA
AAAACAAACTCTGGAACAGGAAGTAGCCTATATCCTCTGGGGTCTTACAAAGACTGTGTA
ACTGCTTCTTCTCTGCCTCCTTTGCTGAATTTTCATTCACCTGCTGCTTGTGTTCCCCAC
ATTTCTGTTCTGGACCCTCTTTTCTTACCTAGGCTATTCAGCTAGCCTCTCTGCAGATGA
CTGCTTACCAAGGTAACCTTTTTTTCTGATGAGTTTCTGTTGATATGTTTTAGTTTCACA
TTACCGTAATTTCCTCCATTTTCTTTTCTCATACCTCTCAGGGAGCCATCCCATATACTG
AAAAGCATTTCTTTAAGACCAAAAAAAGTTTATTTGAAGTTTAGTTTCTTTTTAGTGATT
CTTTTATGCCATTGTCATTGTGCATATTGTTCTACAGTTTACAAGAATTTGTCTTTCCAT
ATTTTTAGGAATTCCTTACATTCCTATTATCACCCTTTTTTGAGCCATCCCCCAGTCAGT
GAACACCCACTTTGCTCTCATTTCTTTGCTGCTTGAATATTTTAGTACAGTTTTGACTTT
TCTTTGTTTTTTTTTAACTTGTTTAAATTTGCTTATCTTCCCACAGTTCTTAAAAATGGC
ATATGTTTAAAAAATATGTTCCAAATCGAGGATAACAGAAATGCATATTAAATAACTGCA
GTTTTGCCATTGTACAGTAGAGAAGAAGTTAGAGGGTATAAACATTTTTCAAGAGAACTT
AAAGCAATTAACAGCTTTGTGAAAGAATTTCCCAAATCACTAATAAGAGAACTCAAAAAT
CAAAATAGTTTGATGTTCCATCCCACATCCAACAACTTGGCAAAGAAAACAAAAGTAATT
GGGAGATCAACATTGCGGTGACATGATTTAGTGCAATCATTATGGAAAGTTATTTGGAAT
AAAGACAGCTCCATTTGCAACAATATGTCTTAGAAATGATTAATTCTTTGTTTTCTAGCT
GAGATCTGTATCTGTGGACCTGAATGTCGATCCTTCTCTCCAGATTGACATCCCTGATGC
CCTGAGTGAAAGAGATAAAGTCAAGTTCACAGTGCATACAAAGGTAATTTTATATATAGA
AGTGGGGGGGGGGGTGAAAAGAAAAATTATAGTGCTAGATTATATTCGTTTTGTCCTTTT
TTGATAGGGAAAGATGCATGAATTTTATTGCATTATTGGTAAAGGAAAGATGGCACACTA
TAGTTGATGGTCTATATTTACTTTAAATTGATCGTTACCTCTCAACTCCTTTTCTTCCTT
TATAGACTACCCTCTCCGTTTTTCAGAGTCCAGAGTTTTCTGTTACAAGACAGCATGAAG
ACTTTGTGTGGCTACATGATACACTTATTGAAACCGAAGAATATGCAGGACTCATCGTAA
GAGCCTTGGCTTTAAAGAGGCAAATTGTTCTACTAAGAGCTTTCCTTTTTCAATTATTGC
TTGCTTTGCTTAAAATGACATTTTCTTTAATTCAGCTACATTTTATTTTGCCTTTTTATA
ACTAAATGATTATTTTTCCATTTAACTATGTATGAGATACTACTGACAAAACCATTCAGA
TGTTTGTGATTTTGCAAAATGCCACCAAAGTTATAAAATAAGCATTATTTCTTCCCTTGG
CCTTTGACTTTACTTAATGTACAATTGGTTACAGACTGAAAGTAGTTCAGTAATGTTGTT
TATCTGAAGTTTGTTTTGTTTTGTTCCTTAGCCTTTGTTTAGCATGAACCCATTAGATTA
AGGATTTTTACAACCCAAGCCAGCCACAAATATTGGTCTTTAGTTTTATTATTATAATAG
AATGGGAAAGATTCTTCATAACATTTATTGTAGCAGTCTCTGCTCAAGTAAAAATTTAGG
CCTGAGCTATAGTCTCTGTTCTACTTAACTTTTGTTATTTGAATCTATGAATTGTGGCTT
TGATGTTTAAAAGGATACTTAACCTCAGCCTAAAAATCCTAATAGACAATTTAATCCTAG
CTGGCAGTTAAACCTTGAACATGGATTGTCCACTTAGCTGAAGCTTAAATGTTCTTTAAA
AAACAAAACAAAACATTCCCATGAAGTCCCTTTGTTTGAAGACTAGAAACCAATCCTGGT
TTTAATGCTGATTCAGTGATAGCTACAGTTTTGGAAATATTGAACCCTAGGAGTTTTAAA
TGCCTATTTAAGCTGATGTTAAAGCAGCATATACATTGCTGATGGGTCTGTGGGGGCCCA
TCTTCTATTACTGTCAATAATCTGCCAGCTGGCTTCAATATTCAAGTGAATAAAGACAGA
TAGATTTTCTTTTTAATTAAAGTTTGAAGGACTAAAGTAAGTAAATCTTAGTGCTGGTCT
AGAACAGAAATTCTCCCATCTCACTTTCCTTCATACACACTGAAAAAGTGTTACAGTTAA
ATATTAATGGTATTGGGGGGGGGAAAGAGGAGTCATATGTGGTAGGAAGATCCCATAGAC
TTTTGTCCAAGTTACTCATGGAAAAGAGGGATACAGTGATTCTTTTTTTTATATATATAT
ATATTTTATTTGATCATTTGATCATTTCCAAGCATTATTCGTTAAAGACATAGATCATTT
TCTTTTCCTCCCCCCCACCCCCCATAGCCGACGCGTAAGTCCACTGGGCATTAGATGTTT
TCTTGATTTGAACCCATTGCTTTGTTGATAGTATTTGCATTAGAGTGTTCATTTAGAGTC
TATCCTCTGTCATGTCCCCTCAACCTCTTTATTCAGGCAGTTGCTTTTTCTCGGTGTTTC
CACTCCCATAGTTTATCCTTTGCTTATGAATGGTGTTTTTTTCTCCTGGGTCCCTGCAAG
TTGTTCAGGGACATTACACCACCACTAATGGAGAAGTCCATTACGTTCGATGATACCACA
GTGATACAGTGATTCTTGCCTGGCTATTGGCATGCCATCATCCCATTGGGAGCTACTGCT
GCTTTTCTTCTGCTTCTAAATATTGCCCATTCTTGTTCTAGAACCGACTGACAGTAAAAT
ACAGAAAGGAAAATTGAATCTTTAAATATGACCTAAAATAGCATTTCTTAAAAGATCTTC
TTTAATACCATAGTCAAGAGTCTTTATGAATATTGTGTTGAATATAGATACCACCTGCTC
CTACAAAGCCTGACTTTGATGGCCCCAGAGAGAAAATGCAGAAACTGGGAGAAGGTGAAG
GCTCTATGACAAAAGAGGAATTTGCAAAAATGAAGCAAGAACTAGAAGCGTAAGTGTAGT
ATTTGGGAGGGTGGTTTCTGGTTTATTGAGAGGCCTGGTAATAGGTACAGAGAATATAAC
CAGTGACTACTGGCTATACAGGAATGTTGTTTATTGTTATTTATTCATTGATAGAATCAT
TAAAAAGTTACTGGTGGAGAGGATGAGCTCATCTCATCTAATTCCTTCACTTCATAGAGT
AGAAATCTTTCATAGAGGAGAAAACTTTCTGGGGTGTGTGTGGGTGAATTATCTGGTGTC
ACAAAGGAGCATAGCTAAGATATGAATACAGCCTTATCTGGAGAGACCACCTTTCATCTC
ATAAGCTAAAGGAGTGCTTTCTTTGTTCTGTCCTTGTTAATTGAGGCAGTCACGTATAAG
AGCTTTTGCCCTGTCATTAAGTGGCATAATTATTCTATAACTACTTTTTTTCACTGTATT
GTACAAAACCCACCAAAAGTTCTAAATGAAAATAAGGACTATGGGAGGGGCAGAGGGCCA
AGGACAGAGCTTCAGGAAACACTTTGGTGTTCTTCATCTTTCCTTCTCCATATTTAATAC
TTTATCATCCCTTCCATTTCTAGTCTCTTTTTGTTGGCTTCATATATAATATTCTCCTTT
CCTAGTTCTCTTCCTACATTTGATCTTTCTCTGATTCCTCTATTTTTCTCCGTATCTTAC
ATAAATATATCATCTCAGTTCTGACCAGCTTTCTTAGTTTCACATATATACTTCGAACTG
CCTACTGGAAATCACTGCCTTGATGTCTTCTAGCAATTCACTTAACATGTAACCACTGAT
TGCCATCCCCCAAATTTACTCTTTGTGACTTTTCCATTTCTGTGAATGTCTGTGTCATAT
TTAAAACTTTTTAGTCATTTTTTTGTTTCTTCCTTCATCTTCACATTATTGCTAAGTCCT
GTTTTACTTTAGTGTCTCTTAAAACTGCCCCTCCCTGTTGTTATAACTCTATACTTTATA
CCTGGACTGTAATTAGAATCCCATTTTTAGACTCTCTTATCCAAGCTATCTTACTTACTA
GTGATAGAACAGTTTTCTTGATGCACAGTTCTGATTGTGGTTTCCCATTGCTTGCCAGAT
AAAAATCCAGACTCCTATAAGCCTAGCAATTAGAGCTGTACTAGTCTGGCTTCAGTCTAC
CTGTTTAATCTTCTCTCACTATACCTATTCACAGACCACATATACCAATACAGCTGGACT
ATTTATTCATTGTTCCACAATCATCTCATACTTTTTTGCTTTTTGGCCTTTTCTTATGCC
ATTCCCTAAACATGGGATGTCCTACTTGTCCTACTTTGGGATATTCACTTATTAAATTGC
TAAGTAAACACTCAAAACTCATGAAGTTTTCCCCTCATCATACCTTCCACTCATTTGGAA
GTGATCTTTCTTTCCGCTGAACCTTCATAGCATTTTTTCATATCATCGATCACTCAGGTT
TTGTATTCTTATATTTGCGTATATGTCTTATCTCCCCAGATTATGTCCTTATAAGCAGGT
ACCATGTCCTGTTCATCTTTGAATCTCTCTGTCCAAATGCTTTCTTGAACCATTATAGCC
ATTCATTAGATGATGATGATAGAGTGAATTTAGTTAGGTTTGGAAAACTGAAAATAAGAT
TAAGAATAACTATATAATAACTATTGTATAAATTTTATTTGTAAGTATGTTAGACCTGGA
CCAATTATTTCAAATTTATTTTGCCATGGTAGAAATGCAGTTGGCTGTAACCATTGAATT
AGACTGTAAGCTTAAAAATTAGGGCCACATTTGCTACAATTTAAAAACTAATTCCAAATC
TCCTCTTCCCTATATACCCACAGTATACTGCTTACATGTTAATGTGTGCCCAAATATTGG
TAAAAAATTTTTAAACTCTTATTTTCTGTCTTAGAATTAATACTAAGTGTTGGTTCCAAG
ACAGAAAAGCAGTAAAGACTAGGTATTTGGGGTTAAGTGACTTGCCCACAGTCACATAGC
TAGGAAGTAGCTGAGACCAGATTTGAACCCAGGACCTACTTCCTGTCTAATAGTCCTGGC
TCTATCCATTGAACCACCTAGCTACTACCCAAAGAAGTTTGTGGGATAGTTAAAAAAAAT
TAATAGACTCAAGGAGTTGGGGACACAATTCCCGGAGGGCCCCTGCTTACCTCAGATTTT
GTGTTTGTGTTAATTGTGCAGCTGCTCTCAGAACTATCTAGCTGTTTTTGACTAGAGATT
TGACTTGTCTCTTGAACTAATAAATTGTAGTAATAGATTAGTATGATTCTTGCTAATGAG
ATCTGAACAATAGGAGATAAACATGAAGTTATTTGATATTGATTTGATGTTTGATTGTCT
CTGCTAATGCTAGAAAGTTCTTTACCAATCTGCTGCCTACCTAAGTAAAGGTAAAGATAT
CAGAATAATCAAATGCCATTTGTCAGTAATTCCAGGGTCAAAATTTAATAGGCCAGTAGT
TAATCAGTACTGGGGATCATTAGGATGATCAAAGAATTGAGCATAGGTCTCAATACTGTA
CATTTATTTCAGGGAATATCTAGCTGTCTTTAAGAAGACTGTATCATCCCATGAAGTTTT
TCTTCAGCGACTTTCTTCTCATCCTGTCCTCAGCAAAGATCGCAACTTTCATGTTTTCCT
GGAATATGATCAGGATGTAAGGCACTTACATCTCTTTTATAGGGTCTGTTAAGATTATTG
TACACCCCAAAACTCATTGAGAAAGTTCTAAGCTTGTCACTAAGTTGTATAAACTAGCGA
CACAGTGTTATCAAGAATAGTTTTCAGATTTCAAGTGGAACCATTGTAGAAAGCATTTTG
CAGCTCATTATCTTTCCTAACCAGGATAAGTCATTTTTCTTTTTTCTTGCAAAGCACTCA
TCCCTGCCTTCTCTATACCTCCTACAAATAGACAGAAAGCCGTAAGCCGTAAGGTAGAGT
GTAGTAACAAGTACATACTCATTTGTTTTAGGGATAAGTCCTTGGCCACATTCATTCTGC
TTCTTGAAGTTTTTGTGACCAGGGACTGCATAGATTTTTTCACGTTTGGGTTCCTTGTCT
CTTGCCTAATGCATGGGTGTTAGACTCCCATAATATTAGGGAATTCGATTTTTAAGCTAT
ATGTTCATTAAATTAGATTTTTTTTTGTTTTCTAAATAAAGGTTGCATATTAAAATGCAA
TCAATTGAATAATTTTTCTTTCACTGTTTTTGTAGGCAAACTAAACAAAGGTTTTAAATT
TATGTGCATAAATCTCCATGCCATATCTTTTGAGGTTTCAGGATATAGACCTTTGTTTAG
GCTTAACAATTATCTTCCAGCTTAGTTGGAGTAATGTTCAACACATCATTAAATAAAATG
AAGTATCTTCTGAAAGTGATCACCTTTGGGAAATAAATGGCTTAGAATTTATTCATAATT
CTTCTTAGGTCATAATATTTAGCGTGCACTTCATGAATGATCATTTTGAAAACTTTTTAC
TCTTTTTTTACCCCTCTTCTCACCCTTAATTTCAGCTAAGTGTTAGGAGGAAAAACACCA
AGGAGATGTTTGGCGGCTTCTTTAAAAGTGTAGTGAAAAGTGCTGATGAAGTCCTTTTTT
CTGGAGTTAAGGTAAATGTTTTTGAACCTTTTTTTCCTGGGGAGGAGGGTGTCTATTTTC
TGGGTATTAAGCTGGCAGTTTTATTTTTCTAAAGGAAGAGAAAGCCAATATTACACTATA
ACATAGTCAATGATAAAAATGTTTCCCAATAAAAACATAGTTTAAAAACAATTTGATTTT
CTCTTTTATACCCACATTTTTCCTAAATGCTTTGTATATAACTCAGTAGCAACTGCATTA
GGCAAGGGAAAAAGAACATTCAAAAAGATCTGTAATATATCCTGTTTGTTTCAGTGACCT
ACTTCAAGCTACAGCAAGAATAATCTTGGGAGAAGAAAATAGGTTTCAAGTAGAAGCTGG
AGGGAGAGCTCTCATAACGTAGATAGTGCTTCCTTCTCAGGAAGGAAGAAGCAGGTCATG
ATAATAGAAGGCAGTAAGGATATGGATAGAAAAGCAACAACCCAAAAGGGGTGAACAAAA
AGGCAGCTAAAAGAGAGCTGAGAGGTAAAACTTGGGGTATATATAGAAGAGAGTCCAATT
AGCAGAGAATCAATTTTAACTTTTCTACACTCGAATGGCAAGGATTCTTTTCCCTTGGGG
TAGAGATGGCTTTACATATGCCTTAGACCTCTTAAGTGGGCATACTGATCTTAACAATAA
GAATAGATTAAAACATACCAGCTACTTTTGAAAAATGTCATCATGAGAAAACTGAGCTCA
AGGAATGTCTCTAGTAAATTTTAGTTGTGTGAAATTGTCATGGCAAGGAAACATCTAGGT
AACTTAGTGGATGTGGATAGAAAGCCAGGCCTGGAGATGGGAGGCCCTAGGTTCCAATTT
TGCCTCAAACAATTCCTAGACCTGGGCAAGTCATTGTCTAGCTCTTTCTGTTCTGCCTGG
AAACCAATTCTTAGTATAAATTTTAAGACAGAAAATAAGGGTTTAAAAAAAAAGAAAAGA
AATTGTCACAGCATTATACTCCATTATTATGAGCTAGAAAAATCTATAAACAAAAATGGA
AAACTTGAACCATGGCTTTTTCCATTTTGGCCGTGTTAGATCTTATTCAAATTTATCCTA
GCACTTCCATTTATATATGCTGTTTAAAATAAGCTGATACTTCATTATCAAATGCACAGA
GTATAATTTCTTCGCATACTTTCAAAGTTACAGAATGAATCCTTTATTTCCACCATCATC
TTTACCAGTCAAATAATGCATTATTCTTGGCCAAACCAGGCAGTGTGCCTATTGATTAGA
TTTACCCTCCTGGTTGTGATGCACAGATTGAGTAGCTTCTATTCAGCCACAAAAGCTTTT
ATGCCTCAGCTGATTTTAGTACTGAGAGATCACAGTGCTGAGATAGAACAGGAAAAGAGA
TGTTTCCAGTTGGGCATTCCTTGGATGAACATTTTGAACAGTCTTCCTGTGTTGAACCAG
CTTCCTAAACTCCTGAGGTGCCATCACAGCTTAAGAACTCCTTTATTAGCCTTTAATGGG
AAATGCAATCTCTTCTGTCCTCACAAAATATTCTCATTTTCAATTGTTTCCTCTCCATAT
TATCCTTCAAAAATGGGGCAACCAACTCAAATATAAAATGCTTATGTTCTCTCTTATTTC
CTTTTTCCCTACCATCTTGTCCCAGATCAAAAACAAAAAATGCACCCCACCATTAACATA
GAAATTTTTTAAAATATAAATTAAGGAATACTGGCAGATTGGTTTATATATAGGTACTTA
AATTGCTCCTGAATTTTTCAATTCAAATTTAAGCTTTTATTAAATTCTTACTATGTACAA
GGCACTATGTCAAATGCAGTAGATGGCCGGGGGTGGGTGGTGGGTGGGGTGACTGAATTC
CAAGATTTGTCTCTCAAGTCCCTCCTTTGATAGGTTTATATAGCTGCTACTTGTTACTCT
GAATGTTCCCTTTTTTGGGAGAAAGGAAAAGAACTAGAGAGTTGGCTGTTAAGCTCAGCT
GAGCCTTTCACAGCGGTTGCTTTACTCTTTCTTACTGATGCCCACATCTTAACGTGTTCC
TCCATTTTCATTTTTCTTTGAATAATACAAATAAACATTTTATGGGAGAGCTTTAAAATA
GGTGAAGCCATTTTAGAATCTATTCCCTAATTGGAATATCTGAATTCTGGAATTGCCACA
GCGAACTTTGGATTTTACAGCTATAATTATTCTATAGAAATATCCCAATGTATAATTGAA
AATCATTAATAAATCCCTTAAAATATAACATTTTTATTATTGACATTAATTTTTACACCA
ACTATTCCAGATTTTCTTTCTTGGTTTAGTCAACTTAATACTTTTTTAAAAAACATTTTT
TTTCTTTCCCTCTTTGTAGGAGGTAGATGACTTCTTTGACCAAGAGAAGAATTTCCTCAT
TAACTATTACAATAGGATCAAGGATTCATGTGCAAAAGCCGATAGAATGACCAGATCTCA
TAAAAGTACATACCATAGATTTACTGGGTTAATAACAAAGAAAATTGCTAACATTTTCAG
CTTTGTTCCCATAGAACTGAAAGCTCTACCCTTTTTTCTGCAGATGTTGCAGATGATTAC
ATTCATACTTCAGCCTCCTTGAATAGTCTAGCTTTAGAAGAGCCAACTGTCATCAAAAAG
TAAGACAAGTTTTTGGAGGGTGGGGATGAAAAGGGGAAGATATGCACAAAAAGTTCAGGC
TTACCTTAAAATCAAGTTATAAATTTGAGTAAGTGCTTAGTTGACTGTACTATAGAAGTC
ATTTTGGGCACTAAATTGTTCTTCTTTTTTGTTACTGATAAGACTATTCTTCTTGTCCAT
GGTTCTTTCCTTCCCTCTGTAGAGAACTTTCATTAATAGTAAAGAAAAGAAAGTTCTGTA
AAACTAATTAAAGGATCAGAAAAACCTAGATCCCTGGTCTACCCCTTAAACAGAGAAGTG
GGAGGAAGTGTCTCAAATCTTTTCATTTGGGACTGAATTTGGAGATTTAATTTTGCATCC
AGTTTTGATTGTTTCACAGTTTTTATTGCAGTTGTGTAGTCATTGCAAAATTTTTTTCCT
TAGTTTTGCTTGCTTTAGCTTGTATAGTTTCATATAAGTTTCTTTAGTGTTCATATTCCA
TTTCCTTTATGTGTCACAATTTGTTTAGCTATTTCCTAATAAGCGGGCATCTTCTGTTTC
CAGTTGTTTGTTACTACAAAAAAATGTTGTGAATAATTATATATGATTCTTCTTTTATTT
CTGCTGGTGGAAATGAAAGGGTATGGATATCTTGGTCACTTTTTGAATTTCCGAAATTGT
TTTCTAGAATGGTTGGATAAAGGCTGATAATTTTAAAGTGCCAGAAACCTTTTTACTTTG
TGTATGATTTTTGTGGGGTTTGTTTTGTTTTTTTGGAAGGTGTGGAGGAACCATTTCAAG
GCTGAAATTACATCTTCGAATTTATAGTAGAGCAAATTTAAATGAATACTTTTAGTGTTT
GCTGAATGCAGAGAATAGTTATGCTCATAATATAATTAGTAGTCACCTTTCAAATGATAA
AGATTTATTCAGGTTTCATAAATAAGTTAAATATTTTGTTAAAAACCAATGTAATTTCCA
TTTTATGTCTTTTTCCCTCCAGATATTTACTGAAAGTTGCTGAGCTATTTGAAAAGCTAC
GGGTAGGAGCCTGTATATTAAATACCACCCCACACCCCAAAATTGGTTTTCTTATTGGAC
AAATTGTAAGTTTTTTAAAGTTTATTTTTGTTCTTCTTTAGAAAGTGGAAGGTCGAGTAT
CATCAGATGAAGATCTAAAACTGACAGAACTCCTCAGGTATTATATGCTCAACATAGAAG
CTGCTAAGGTAAGAATTGGAATCTTTTTAGGAGTAACCAAGATTGATACAAATTCATCTA
AATAATACTAAAAATTTAGTCACTTTGTGAATCTTCTGGGGTCAGAGAAGTTAATTTCTC
TATAGTGTATAGCATAAATTAAGACATTTTGCTGAAACTCAAACTATTTGGTTGTTTTTT
TCTCTTTTTGATAAATCCATGTCTATATATCATTTTAAGGACCAGTTCAGTCAGTCAGCA
TTATTCCTTACATTCTAAGCATTGGAGAGACAAAAGACAAGGACAATGAGTATTTCTAGA
ACAAACACAAGGTGGGTGGGGGTGGAGCAGGGGGTAGTATTTGCTTTAGGGAGTAGGAAA
GTGGTAGTAGTACCACTTGAGCGAAGTCTGAAAGAAAGTGATGGGTTCTTGACAGTGGTG
GTACATAGGAGAGCATGGGTGAAGGGATTGCTAGTGCAGAAGGTTAAGAGAAGAAATGAG
GCATCATGTGTAAAGAATAACAAAAAAAAGGCCAAATTGTGTAGAATGTAAGTGAGGAAA
TCAGCTTGACTTACTGAGACTCCTTGCAGGAAGGCTCAGAACAAGTAAAAGATCATCCAG
GAAGGCTCAGGGAAGAAGAGTAGTGATGTTTGAGAATACCAAGGAAATGTTTTTTTTGCT
CTGATTAGAATTGTCTTGCTGGGGTATATAGTCAGACATAATAGAAAATCTTCTGGGACT
TTTCAGGGTTTGGATGTGGCTTACTTTTTTGATAATTTATATGAGTCTATGCCCTAAAAT
ATAGGGGAGATTAAGATCTTTGGTGAGGATTGGATCTCACCTAACAAAGGCTGGTAAAAA
TGTACTTGGTTGTTTGAGGGTCTTAAAAATCTCTGTAAAAAGGGCTTTCAATAAAAAATG
ATGAGGCAGAGAAAAAAAAGCTCTAGGTATCCCTAAAGAATAGTTTAGAGTGAAAGAAAA
AATGTAGCAGTTGAGGCATCTATACATTCACAGTAGACAAACCTATGCTCTTAAAATGTA
AGAAGCAAGATGAAGTAGAGGTCCAGTGCATTAAGGCAAACTTGACCTAATAGATATTAC
CAGGAGTTGAAGGGTAAAGACTTAAGCCTAGAATACAACCAACTGTAGCAGGATGTGCAT
ATCTTCAAAAGAAATAGGATTAGTAAAATGGTGGTAATGAATAAGATGGCTTATACTATT
AAATTCATAAAGAACTCAAGAAAACCAAAGAAAAAGACTGGTGGAAACCATTTAGCTTAA
GCTTAATGTAGGTAGGAATTAGATAGGATTTGTGTCTTGGGAATACCTGGACTTTTTGGA
CCGTAAGAGGAAACTGAGTGGTTTGAAAAAACAATTCACATGCCTGGCACAGAAACATAA
TGTCATAGTGATGGGAGACATTAATTATCCAGACATTTGCTGTGTGCTCTCTCTTTGTCA
AAACTAGAGCAGTTAATACCTTCTTGCTTTAATGATAATTTCAGTCTTCAGAAGTTGGAG
CAACCAGCCAAGAACCTGATTTTTACTAACAGGGAGGAATTAGGTTTCTGGATGGAAATT
ATTATAATTTGATACCAAAGAAAGTAAGAAGACAATAGGATAACACCAAGTTGACCTTGA
TAAATTGAAGTTAACTCCATTGAATTACATTTTCAGGTTCTGAAGTTTCTGGTCCATTGT
GAAAGATCCTGGAGCCCCTGAGTCACTGACAGTTAGAAAAATGCAAATTAATATAACGCT
TGAGATTTCACTTCTCACCATGCAGATAGACTATTCTTAGGTTTTGTTATCTTTGCCGAG
GTTGGAAGGGCTGAAGAAGACAGGTGTGTTAGCGTGTCATGAAATGACCCTAACATTCTG
TATATCAACTTAGTGGTATTAAAAGAAAAATGACTAAACAGTCCATATTCTTTGACCCAG
AAATCTCATGACTGAATATATAACCCCAATGAAGTAAAAAAACTGAAACAAAGGTAAAAT
ACATACAGTATTCATAGTAGCTCTATTTGTGTTAGCAAGGAAATAGAAACAAAATGGGGG
CTCATTGTTGACAGTTGGCTGGAAAAAGAGTGGTATATGAATGTTATAAAATGTTGTGAT
ATAAATATGCAGAATTCAAAGAAACATTGGAAGATATGCTTGAACAAATGCTAAAAACTA
TTCATAGTCACTTTAGAAACCAATCCATAAAAGAATCCAATCCATAAAAGCAAGTCAAAT
TCTTTGAGTAATTGGAAAAACCAATAAAGCATAATAAAATCCCCCCTCCTCCCAAGTGAG
GAACTAGTAGGAAAGGATACTAAATGTATTGTAGTTGTCACCAGGGAGGGTTCAATCTGA
AAAGGTTGTTGAAAGTTTGCTCATAACCCTGACACAAACCACTTATCAATTATACTTTTT
AAAAAACTTTTTTAAAAAGTTTGCATGCTACTGGCTGATCAGCTTAAATTAGTCTAAAAT
TTGGAATTGGATGTTGTGAATTTCTAGAAATGGAAGTAGTGATCACAAAGAGCCCATAAC
TTCATTAACAATATACAATGACTGACTAACATTTCTTTTTTCTTTTTGATAGAATAATAA
TTAGTAAAAAATTTTTGGCAGAATGTCATTGTAGAAAAGATGATGGAACATAAGCTAGCT
AATAGTCTATTTAGATTGATTTGGAGTGGGTTGAATGGCAAAACTCAAAAGTCAGTGGTT
TGGTATCAGTTTGTAGGAGAGTTCAATGGAATGGCTTAAACATCTATATCTGTTGTTTAA
TGTTCCCTTTAGGAAAGAAAGGGAAGGAAACATGTATTTAAATTATCACCAAGTACCAGG
AACTGCCATGTGATTTACAGATATCTTATTTGACCAAACAACTGTGGGAGGGTAGGTGCT
ATTATTATCCCCCTTTGAAGAATTGAGAAGTTGAGGTAGTCTTTAGTTCAGTGATTTGCC
CAGGGTTACATAGATAATTTGTGTCTGAGGCTAGTTTGAATTCTTGGTTCTGTATTCTAT
CCACTGCCCTGCCCAGTTGCCAGTGACTTGGATAAAGGCTTATGTGCTGTGCTTATCAGA
TTATCAGATAACAAAGCTGGAAAGGTTAGCATGTGAGATTAGTCAGGATTCAAAAAGATC
TTGACCAGCTAAAGGATTAGACTGAATCTCATTAGATGGCATTTAATAAAGACCAATATA
AAATCCTACTTAAGCTCAAATCTACTTCAAGTACTAGACAAGCCAGCATGTTTAGGTGTT
TTTTTTTTTTAATCTGAAAAAAGATCTGGCAGGGAATGCTAGTTAGAGGATTACAAGCTG
AGAATGAGTCAGCATTATGATCTTGGGCTAAGGGAGGCGTAACTTTGAGGAAGAAAGGCC
TAAGCAATTCCTCCATATTCTTTTTTTTTTTAAATTTTTTAATTTATTTTAATCCTTACT
TTCTGTCTTAGAATGAATACTGTGTGTTGTTTCCAAGGCAGAAGAGCCGTAAGGGCTAGG
TAATGGTTAAGTGACTTGCCCAGGGTCACATAGCTAGGACATATCTGAGTCCAGATTTGA
ATATAGAACCTCCTGTCTCTGGGCTTGGCTCCACTGAGCCACCCAGCTACCCTGTCCATA
CTCTTACCTTAGATTGACCATGTGTGGGCTACAGGGTTCAAAATCTGCTGCCACAGTTTG
GGATGGACACTTATAAGCTAGAGTCTTCTTGGAGGGTAATCAGAATAATAAAGCACACAG
AGTCTATTCAATATGAAGATAAGCAGAAGGGACTGGGGATGCTTAATCTGGAGAAGGGAA
GACTGGGGGCACATAGTAATTATACAAGCATTTAGAAAGCTGTCATGTGAAAGAAGGACT
AGACTTCACTCAGTTTGGCCTCAAGAGCATAGTGAGATTTGGGGGAACTTCCTAAGTATT
ATAGTTATCCAAAAGTGACATGGACTGCCTCAGAAGCTGTTCTGGGTTCTCAAGCAGAGG
CTCACTGACCAATGGACTGGGCATTCTTTTGAGATATGACATGGACTAGGTGGTGGCAGA
GACCTTTCTAACTAAAATTCTGACTAAAGTTTTGTTAGTTACAACATTTTTTCATGATTT
CCACCTGGTATATTGAGCTTGGAGACCTTTTATCTCTAGGAGGTAGTAAATAACTTCTAA
GTCTTTTTAGGGTTTGTTTCCATCTGCATGTTCTCTTCTTATCTTCCTTCCCTGCATATG
TTTTCTGTCAAGTAGTGACTGATGTTTGCTAGCTTTGACCTTTGGCAAAACACTGAGCTT
CTGTTTCTTCATCTGTAAAATCAGCAGATTGGACTAGGTGACCCTGCAGGTGCCATCTGG
TTTTAACATTCTATAGTTCTTGTTGATCTTTAAAGCAGAAATATGAAGGCATGAGAGTTC
TTTGAGGGATTTATTCAACAGATACATTACACACTTGACATTTGAAGGGCACGAAAAGGG
GCATGGAGGAACCAGCTGGCCTTGGACACAGCTCTGTGACCGTGGGCACAGCATGACTTC
TGAGGGCTCCTCAGGAACAGACTTAAGTTTGAGGCCAGTTTCTCATTTTCATCGATAGAA
GGAGTTTCCATATCTGGAATTCCTCATGCTAAGGAAATCATCCCTGTAAAAGAGAGCAGA
GATTGCTGTGTGACCTGGGGTTTTGGGGTTGAAAGTCTCTGCCTGCCCTCAGGGTTCTTC
CTGGTCTATTGGGAGCAACTCACAGCAGGTGCTCAGAGAAGGGAAGGCCCCATGCACGGC
GGACAAGTTAGGGGTGGGATGGGGAAGAACCCTGTGAAAGAGGGGATGTCTAAGTTGTGT
TCTGGGGTGAGGGATTCTGAAAGGCAGAGGTGAGGGGGGAAAGGAGACCGGCATGTGTGG
AGATGGGGTGTCGGGAGGAAGAGAAGTAGGTCAGCTTAACCAAAACAGATGGTGAAGAGA
ACTTCAAATGCCAGACCAAGAAGTTTGTATTCAAGATATTTCTATTAGAGGGGAGCTTTG
GGCAGATCACTGTTGTAGGAATGACACTGTGGTGCCTAGGGTAAATTGAAGAAATGAGGA
AACTGGTGAGGAGGCTATTGCAATACTGTAGTGGTCCAGGCTGTAGTTGAGAAGAACCTA
AGAGAGGAGTGTGTGAGCACATGTACCTGTGTGTACATACAGAATGGGGATGGATGTGTG
AGAGATGAGGCAAAATCAATGAGACCTAGATGGGGGAAGGCAGCGGCAATGAGGAAAAAG
CCAAGGGGTGAACTGGAGCAGCTAGAAGGAGAGTGGTGCCATTGAGAGAAATAGGGTATT
TGGGAGGGTGAATGGATTTGGAGGGAAATAAAATTAGTTCTGTTTTAGACAGTTTTAAAG
GTCATGCAGGTAAAGTAGGCTAGCGGGTATATACTAACATTGGCTTTAGATACCAATCAT
TCACAAAATCAGATCAATTCTAAAAGATACAGAGTATATCTTATATATTTTAAAAATCTA
TACCTACAATCAAGCCATTTTACTTCTGAAGTACTAATACCATAAACTTTCATTTTATGT
CATTATAGTATGGCTAGTTTGGAATAGTTATAGATACTTAAAACCAATGTCATGTTTTGA
TTCTTGCCCTCCATATATGTGTTTGGAATTTTTAAGGAAAGCTTAATTGTCCTACGTGTC
TTCTTTCCAGGACCTCTTATACAGGCGTACAAAAGCCCTCATTGACTATGAAAACTCAAA
CAAAGCTCTGGACAAAGCCCGGTTAAAAAGCAAAGATGTCAAGCTGGCTGAGACTCACCA
GCAAGAATGCTGTCAAAAATTTGAACAGCTTTCTGAATCTGCAAAAGAAGGTAGAATGGC
ATTTATCTGTTAACAGATCTCCTTGGTGTAGTTCAGTTATGGACCTGTTAGAAGAGCATG
TAAGAGAGTCTTAATGGTTTAATGTTTGCTACAGAATGGATTAATCTGAGCCTCAGGTTG
AAAAAGAAACATGGAAAATTCTACTGTATATATACACTGAACATCAAATGTGATTACAGA
CACAGGTGTGTGATGGGTGTGGGAAGGGAAGCTTACAGAGTAGATCCTGTCTAAAGTTTT
CTTAATGTGTTTTCCTTAAACATTTTTGAGTTGAATTCTGTGAGAAATTCTAAGCCATTG
GAGATGTACATATATATGTCTGGGAATTAAATGCTAAGTGAAATGTAACATACACCAAAT
TGCTCAGCTTTTCTGTTTAGCAATGTGGTAGAAGCTAACTTAATTTTCTTTATGGACTGA
GATAGCATTTTCTTGTACAGCACAAATTATCAACTAGTCCTGTGAATGAACATGCTAAGT
ACAAAATTTGTCTTTACTCTCTACCTGTAGGCATACACTTTTATTTGTGTTTTTCTTGTG
TTTTCCCTGAAATTTGTTTTTCTTTACCCCATTTTTTTAAAAAGATTCTTTCTAAAGACT
TAATTTTAAAAAAAACATGTAAACTAAATTTGGATCTTAGACAGTGATTAGGAGACTGTT
TAAAAGTTAGGAAGCAACGTTTTATACTGGGAGAAATCACAGTTGTGCTTAACACTTGAC
TAAGAAGTATTAAAGAATTGAATGTAGTTACACTATAAATGGTGGTGTTTCAGATTTATT
CTTTCCAGTTAGTGGAATTGCCTCCTATCCCATCATCTTAGCTATAAATATGGGCTTTTC
TTTACATCAGTACTTCCACAATAAAGATACTACAGGACCTTAAAATTCATGATTTGTAAA
ACAGATGGGCTTGCGTCTTTTATCTAGAAATACCAGCTTTATTCATCAGTGAGATAGCTT
TGGGATGATCCTGATTCAGTTCTGAATGGAGACAAGATACTCTTTTTTTTTAACATCCTA
ATTTTCTATTTTCAGTTCCCCATTGCTTTGATATAACATTGTTGTGAATGATTAGCATTT
CCTTAGGGTAAAGAGAATGAAAAATTTTCAGTTTTCCAAGTTGAACGTTTGTCTTTTTCT
GTAGAACTGATCAGTTTTAAACGGAAAAGAGTGGCAGCATTTAGAAAAAACCTAATTGAA
ATGTCTGAACTGGAAATAAAGCACGCAAAAGTAAGTTTTATCTTTATGTTGAATTACTAT
TTGGTGCCAATTCTTATTCCATAGATTGAGAAGCAGTATACTTCTCTTATTTTACTGACA
AAACTTTGTGCTAGCTGTCTCAGCAGATGTAATGTTATTTGGCTTCATCAGAAATATCAT
TGGGGAAAATAGCTGTAATGGGACTCTTCTGGAGGTGTCTAAGCTGCCCTAGTCCCGTCA
GTTTGTCAGGAGAAGAGGAGAAACTCCTCAAATGGAAATTGGGTTGGAGAAAAGAACTCC
TAAGAATGTTAGATTGGGTTTGGAGATCTTTTTACAATGGACTTTAGCTTTAACATGTTA
AAGAGCTAATCATCATCTATCATTTTACAGTGATATACAGTAGTAGGGCTCTTCCCTAAC
CACAGAGGATTGTTCCAAGTCCTATTAGGGATGGCTGAGACAAAGATTTAAATGTATACC
TGCTGACCTCCATATATATATGTGCTCTCTTTCCCTGCTCCTGCCCCATACCTCTGTGCT
CCTGGCCTCCCAAACCACCCCCATTCCTATCCCAATTACCACCCCAAAAAAACAAAACCT
TAACAAGGGGGGGGAGACTGCCCCCACAGGTGAACTTCCAACTCTTCTAGTTGAGTATAG
ATAACTGAAACCATGGATAAGGGGGCTCCTTTTGGAAACAATATTGTGAAAAGTCATGAC
ATTAATTTATGTTCACATATTCTAACACCATGATTCTCATACTTATTTGATAATTTAAAC
TAATTGAAGACAGATTTAGTTGACCATCTGTTTGTACTCTTTGTACATAGAAGTTCTCTA
TGAAAATTAAACCATTCTCTTGTAAAATAAGAAATAAAGTTGTTTTTGAGGGAGCAACTA
TAGCTGTAGGTATTTATATTTAATTCATGCCAAGAAATAAGGTTAAACTATCAGAAAACC
TAGGGCTTTGTTTCAGGATGTGAAGAAAAGCAACACAAATTAGAAAGGAATAGCTATCTG
AAATTTGGCATATCATTGGATAAAAGTATTCACAACCAGCTCTGTATCTGACTTTGAATT
TGTCTCATGGAAACGTCAATCCAAGTGGATTTTAATTATTTATTAGAGCATATTCATCTT
AAAGATAATTGATGAAGTGATTTATTAGACTGCCTCACAGCTATTTCTCCCTTCCTTCCA
GAATAATGTCTCCCTCTTGCAAAGCTGCATTGACCTTTTCAAGAACAACTAAGTTGCCTT
CACTCTGAATGAACCTGAACTGAAGATGAATGTGAAAACCAGCATTAATTGCACTCAATT
TCATTAGCCATGGAAGATTTATTTTTACTTTTGACTAAAACTTTAGTTCGAAAAATTTAT
ATGAATAAATATTTTACTTTCTGAGAAACGTGACTAATGCATAACCATGTTTAAATTTTT
AGAAATTTCTTTTTGAGGTAAATTGCATGGATATAGCTAACCTTTCTGTCAAATACTTTT
AATACCTCAAGGTGGGCAGGATAGAAGTCCTAGATTCTAAATCATTCTTTTAAATAGTAA
GGAAAGGAACCTGAAAATGTGCTTGTTGGAGAGCTTGGTACAAGAGTGTCCCATTATTTC
TCACACTCCCATTCAGTTGTAAATTAAAAATTGGAATTAGGAGTTAATTATGTACAACAA
AACCTTCTTCAGCTCAAGAGTTGAATGAGAAATATCCAAACATTCCATTCTTTTATCAGA
TTTTTTTCTCCTATTATTTCCATAGTTTTTTAACCACCTCAAGTATTTATATTGTATTGG
GAGATCAAGGATATTTCATTAGATTTATTTTTGTAAGTAATCTTATACAGTACAGCTTTT
GTAGTTAGAATATAAGTACATTTGGGGAAAAGAAATTTTCTCCTATTTAGTGTCATCAAC
TTAGGAGGGAGAAGAAAATGCCTTAAAGGTATGGAAATAATATAGTGGCCTAGTATAATA
TAATTGGCCACATTGATTTTTTTTTTCCTTAACTACTCCTACTGCCTGGTATGGGGGAAC
CTAAAAATCCATTTGTGAGAGGGCTTGTGTATGTCTGTTTTTTCTTTCTTTTTTCTTTTT
TTTTTACACAAAATGGTTTATTGCAAAATGTGTAATAAAACATAAAGAGAATACTTCTTG
GAATTTGCTGTTGTTTTTTTTTAATTATGTGTTAATATATGTCAAGACTTTTGAATTTGT
GATTTGAAAGTATGTTAATTACAGTTGGGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1048, 24418..24522, 24725..24835, 26567..26688, 29232..29355, 30215..30310, 32659..32764, 32863..32938, 33922..33961, 34061..34147, 39790..39949, 41104..41189, 42361..42411
1001..1048, 24418..24522, 24725..24835, 26567..26688, 29232..29355, 30215..30310, 32659..32764, 32863..32938, 33922..33961, 34061..34147, 39790..39949, 41104..41189, 42361..42408
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved