Monodelphis_domestica Locus WDR43
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica WDR43
Monodelphis_domestica
WDR43
1
SNORD92, SNORD92, SNORD53, SNORD53
19053..19138, 20180..20264, 34895..34972, 35693..35763
50337
GAAGTGACTGAGGTCACATTTGAACCTAAGACCTCCCATCTCTAAGCCTGGCTCTCAAT
CCACTGAGCTACCCAGCTGCCCTCAATACTTTTTGATTTATTGATAGACTATGCCAAATT
AAAAAAACAAACAAACAGGCAGGCAGGCAAATTTAATGATGGAGCTTGATTCCAAAGAAG
AAATGAGACAGCATTTCTTTTCTTTTCAGGGTGGAAGACTATGTGTGTGGAACACTGCTT
ATGCCAATCAATCCATCAATAAATAAATATTAAGTGCCCATTATAAGAGAACTAGGTGTT
ATTCTGAATATACTAAAAGAGTCAAAAGACAGTCATTGCCCTTAAGGAGCTTCCTACCTA
CTGGAGGAAACATGTAAACAAATCTATACAAAGCAAGGTATATAAAGGATAAATAGAAGA
CCAATAGAGAGAAGGCACTAGGACTGAGGAGTTGAGTAAGATTTCCAGGAAATGGGATTT
TAGATAGGAATTATGGGAAGCCAAGGTGGGTTGTGTTAGTTCCCCTCAAGAGCATTTAAA
AAAAATTCTTTGTTATCCAAGTGAAAAGATATACTGGGAAATGAAGGGGATATCAAAACA
AAATGTAAGTGTTTTAAAAAGCCACAGGTACCTGTGCAAAATTATACTTTTGGGTCCTAA
TGCTAGCTGTCTTCCATAAGCGATGAAGAGTGGATACAGGGAAATAGAGGAAAATCTCCC
GAGTGGAAGTCAAACGAAAGGGTTTCAAATTCCTTTTCCACTTAATTAGGTAACTTTGGA
TAAAGAGGACCACCACCCACCAACCACGCCAGGGCCGGCTACAGGACCACGGTTCCCTCA
TCAGCAAAACAAGAGAAAGTCTTAACTGTCCCAAGTCCCTCCCAGTTGGAAGTCCATAAA
CCAGAAGGAGTTGGGGCTGCAGCGCGCAGGCGCCCGGATCGACGCTGAAGCCCCACCCCT
CCGCCCCGGTCTAGTCCGGGGCAGTTTCCTTTCCACACACCCCGCCCAGGCCGGCTGCGC
AAGCGCGTGGCCGAACACGTGGCTGCTGCGGGGCCAGAAGAGCAATGGCGGCGAGTGGCG
GAGGCCGTCGCGACCCTCTGGCCCCCTCCGGGATTCCCTGTGCATTCTCTCCGCGGGGCC
AGCACTACTTCTCGTTAGCCGGTCCGGATGGTCATTTGCGGGTGTGGGAGACAGCCAGCA
GCCGCCTGCATCAGGACTTCGTTCCTTCCGCTCACCTCAGCGCCACCTGCACCTGCCTGG
CCTGGGCCCCGCCGCGGTCGCCTGCCAAGGTAAAGCTGGAGGCGCGGGAGCACAGCTGGG
AGGGCAGGAGGCGCGCGGGACCTAGAGGAAGGGAGGGGAGAGGAAGGGGCGCGAGGCCAA
CCCTCGCTGGGATCCACGCGGGGGGCTGGCAGCTGCCGGAAGGAGCGGGGCCGCGTGGCC
TTCCGTAGGGCAGCTCCTGTCTGCCCCAGGAGGGCCTCCGGAGCGAACAGGCCCATCCAC
TTACTGTTACTCAGTACACGCGGGCCACCCGCTACCTACCGTGGGCCGTAGTTCCCTCTA
AGCTACGCGTCTTGCTGTGCCCTCGGTTTCCCGGCTTCTCTTCCCCATCAGGGTCTCTGG
ACTTAGTACATCAACATGAACTTCCTTGGGAAATCCTGGTTAACCATCCGCCTCCCTCCC
GGTCCCTTCCCCATCTCCCCCCTTCCCCTCCTCTGTCCCTATATTCCTTTTCCACAGTTC
CTGTCAATCCAGCACCCAGTAGCCGTGCTACTGTACCCACCACGCTGGAACCATGCTGCT
CGCCCCTCCCCCCAAGGATTGGGCCCTTGCCTTGGGTTTCCCCTTCTTGCTAATCGCCAA
GTTTTCGTCTCTGCTGTTAAATAAGGACTAGATTAAGTGTAAATCTGGCAGTGGAAAGGG
GAAAAAACTGGGAAAGAAAGTGCCCCAAATCTACCTCTGCTGAAAGACCTTCACTTGTGG
AGGGCCCATCTCAGGTAGGAGATATCTTTTGGTGATGTTTGAGTCATCTGGTTGCATCTG
CTGTAATTCTCAAACCCACGTGGTACACAATAGATACAGTAAGACTGCACTATTACAGTA
TTTTTGGGAGAGTAAGACTTATTATAACTATTACAATCAAGTCAAAGCATATTTCTTCAG
ATCTTGCTGTGTACCAGAGAGACAAAAACATCTTTCACTCCTACCTTCCCCTCAAAAGCT
GCTTGATAGAGGGTAAACAGCATTGGCCCTGGAGTGAGAGGATCCGGGTTTAAATCTTTC
TGTTCTATTTAGGGTGATCTTGGGCAAGCCACTTAATTTGCCCCATCCAATTTATAATTC
CCTCTTCTTTAAAGGGGGAGGGAAGGTGGTCCTTGAAGTTTCCTCTAGGAGCTGACATTT
TCTTGGCAGTGGGGAGAGATGTGTTTAAACAAACGTGATGCAGGGAAAGTGAAGGCAGAA
TTCACTAAAACGACTGAGAAGATCAGAAAAGGCCATGCAGAGGGATGATTCCTGAGCTAA
ACTTTGAAGGAAGTTAATTCTGAAATGGAGATGATGATGAGGGACTACATATCCGGCATA
TGGGATGATTTCTCCTTAAGTAGTGATGGAATGTCAAAGTTGTTAAGTTCAGGAAACAGT
TAATAGTCTAATTTGACTGGATTGTATAGTTCATGAAGAGGATTAGTATGGCATAAGGCT
GGACCAGTAGGCCTTAAATAACAGGCTGAGGAGTTTGCATTTTATCTCACAGGCATTGTA
GAGCCACTGGTGATTTTGGATTTCATTAGTATGGTTCCACTCAAGATTATTTTGGCAGAT
TTGTGGTGGATGAAGGAGAGACTAGAAGCATGGAGACTAGTTAAGAAAGAGGCTGTTACA
TAATGCAGCATAGAATGACCTGAACTAAATTAAATTGGTGGATGTTTGAGAGGAGAATGG
GATCGAATGCATAGTTGTTTTCTAGAGATAAAATTGACTAGATTTGGTAATTTGTTGATT
TGGGAAGTGAGGAAGAGGATTGACCAGGATTAAATTTATGAGCCTGGTTACATGAGCTGG
GGTGGGGGTGGGAGGGGTCCCTTGGGTGGTCCCCTTAATAGAAATTTACAAATTTGGAGC
ATAGGTAGGTTTAGGAAGTGAGATGTTTTTGTTTGTGTGTGTGTTTTGTTGTTTTATTTT
TGTTAAGCTCAGTACAGTAAGACATAACAAAGAATTTCACCAGTTCTCATTTTGTCATAA
GGACTCTATGAGGTGGGCAGAAAGCTTTATTTTACAGATGAGGGCAAGTAATTTGTCCAA
GGTCTCCAAGCCAATGGCAAAGTTGGTATTGAAATGGTTTGGAGTTGCCTTTTAAATGAA
AGGCATTGTAGAAGTAGGAAGAACACTGGGTTTGGAGTTGAACATTTTAACTGTTAACCC
TTCCCAATTAATTCAGAGCAGCTATTTTGTAAATAAAACATTAATCTGTACAACAGAAAT
ATAAAAATTATAGGATTTAAAAGTGAATCAGATTAAAATTTGGAAATGTTTAATAAAATA
CAATACAACACAGATAATGTCAGTTTAATATGTGGCCAGCAGGGATCCATTTCTATTTGA
GTTTGAGTGATCTTAAACCTTGGAGGGTAGGTTGGACATTTTACAAATAAGGAATTGAGG
CTCCTCCAAATTTGTAGATTTCTATTGAGGGGACCTCCTCAAGAGATCCCTCCATCCCCA
GCCTAGGTCATTTATCCAGACTCATAAGTCTAATCCTGGTCAATCCTCTTATTCACTTCC
CAAATTAATAAATTACCAAATCTTTGGCTTACTGGTGTTATACAACTATTAAATGGTGAT
TCCAGGATTTGAGGTCATATCTGCCTTATTCTAATTTGAGTCTTTCCTAAAAACTAAAAA
CAGACTTTACGATTTAGAAGTAAAGATACAAAATAGATGAGGTGATTATATTCTCTTCAA
CTGAAAAGAACAGTACAGTATAAAAGGTTTAGTTAACTTCTTGGGGAAGGAGCTCAAGTT
TTTTCTTTTAAAAAGAAATTATGTGGCAGCTAGGTATCTTAGTGGATTAAGAGCCAGGAC
TAGAGATGGGATGTCCTGGGTTCAAATATGGAATCAGACACTTCCAAGCTGTGTGCCCCC
TGGCTAAGTCACTTAACCTCATTTGTATAGCCCTTACAGCTCTTCTGCCTTAGGAATACA
TAGAAGGTAAGGGTTGTTTTTGTTTTGTTTGTTTTTAAGGACAGCATTGAATTGGGATGT
TATTCTTTCCACTAAGCTTAATGCTACATTCTTCTCACTTTAAAATTTTTCTTTCTTAAA
TATACTTATATATGATTAAGACAGTTTTGATGCTTTTTGCTTCTTAACTTTCCTATATGT
TTTTAGATTTTTCTCTTCAACATTGCAAAGGAAGGAGTGTGGTTAATTCTCTGTTAAAAA
ACAAATATTTCACCAGGCTGATTTATTACCCATTTACCTACATGACCCTTGGCTGTTTAG
TCTACACTTTGCCAATTAGTGTGTGTTCCCTCTTTACTTTTTAATTTTTTTGAAAAACCT
TTATCTTCTGTCTTAGAATCAGTACTGTGTATTGGTTCTAAAGCAGTATAGTGGTGAGGG
GTGAGGCAGTGGGGTTAAACAACTTTCCCAGAGTCACTACTAGGAAGTATCTGAGGTCAG
ATTTGAACCCATATCTGTCTATCCATTGAACCATCTACACAGACATCCTCTTCCCTTCTT
TCTACTCACATTGACACAATCCTATTTCAAGCCCTCATTGCCCCTTACCTGAACTATTGC
AATAACTTCCATCTCACTTCAGAACACTAGTTTGGACATAGAAGATTATGGTTAGAATTT
GACAGACATTAGCAAGTATGCTTTTGTGTTTGAGGATTGAAATAGTCTTGAATTAGCAGC
ATGTGGTGCATGTACAAAGTTGGATAATATTGGTAGAGTTAATTGTTCTTAGTTAAGATG
GACTTTTGAGTTAGGAGGAACTTAGAGAACACCTGGTTTAATTCCCTCATTTTTTTACCA
TTGAGGAAACCATAGGGGGACATTAAGTGGCATGTCTACAGTTACACAGGTATTAAGTAA
TAGCTAAGATTTGAACCCAGGTCTTCTGACTCCATATTTGTATTCTTTCCATTGTATAAT
ACAAAAACAGTACCACCTTAGGTTTGTATCTTTTTGTACTTTTCAGGTGGCAATTTATGT
TCATTCCTTTCTCTGCCATTGGGGGTGGGTGTGAGTTTGGATAGGAGCAGAGAGGCCAGA
AACTGTTTAGTTTAAGGAGGATAAGATTGATGAGTTTGATTATTTCCTGGGCCCCAAATA
AGTGGGGCATAGAGGCCCCTAGAAATAGATCTTACTTCCATCCTATGGGAAATCTGTTTC
CAGATGTTTTCTTCTTCCTTTAAAAATTTCTCTATCTTTTCCCTAACTATTTTGTAGTGT
AGACATTGTAGGGCCTGGGGTCCCAAAACTATTAGCCCCTTGGAGAAGATGGTTTCTCTG
CTTCTGGTGAGGAAGAACAAGGTATAGCATTAAGAAGGCAGTTATCAGGAGAAATTTGAG
GACAGTATTCTCACCCTAGTACCCCAACCTTGCTGAGGGACCATTGTCAGCCAGAAGCAG
GTATTGCTTTCCCCTCAGTCCTCTGTTCTAATGTACAGTGGTAGATATGGAACATCTTGT
CATTACTCATACTTGAGAAGAAAAAGCTAGACACCCCATATCTGTGTAGTGGCTTTCTTC
CTTTTGGTTCCCCTGCCCAGGAATAATAATTATTATATAAGTGGAATGGCTTTTGTCTTT
GGTAATGTCTACCCACATCTTGCAACCTCAGAATTTTTATATTATAGTTAGAATCATCTA
GTTTAGATTTCATAACAATTGAACTTTTCTTCTCTCCATTTCTGCTCAATCCTAACTTAG
TTTTACTGTTTAGAACCAATATAATACTGACCTGTATATGCTGCAAATTTCTCTTTTTGT
AAGTTACCATTCACATTCCATTCAAGTCATGGAACTTTGGTATTTAATCTAATAGGTCCA
GCAAATCAGGTGCTAATCCTGGACTGTGAGATTCCTACAAAACACAATTGTTATATAAAA
ACTCTTAAATATTCTTATATTTTTATTTGTACTGTCCAGGCAATTTTCTCATCTTTTATC
TCATCACCCTCCATATTAAAAATCTGATGAATCTGATCTCTTGAAGAAACCTAATATGTC
ACTTTTGAATCTGCTGTCTAACCTAGCCCATTATCCTCTAAACTATTGATATAATTGTTA
TATTGAATGTAACCTATGCTATTTCTTGACAATATGTTCGTGTGCTATCTTGTTATTATA
GATATCAGGGACTCCTATCCATCGCTTATCTCATGGACATTGGTGAATATTTTTGATATT
GGTAATGCTTGGCTAGAGAGATGGTAAAAACATTTAACCTTTAACGGTTGAGAAAACTTA
AACATAGTTGAGATAAATTGTGAGTGGACATGAAGACCTTATTGCTTTGGATACTTGTAA
AACAGGAAGCAACCTGAAGAGCCTTGTTAAACTGAGTCCACAAATTGAAAATGAGCTACA
TCATTATTTTTGTGTGTGAGCCAGTGGTTCTGAAATATTTTCAGGTCCTGAACTTATTTT
GAAATGTTTTTCTTTTTCATGTTTTATTGAAGTTAGTATAATGGCTTAAGAACCTTGGAG
TTATAAAGAATTGGATTCAAATATTGATCCTGGCATGTCATTTAACCATAGAGTGCTCTC
GACAACTTTCTGAAGACCATGAATTTTTTTGATGAACTGTTTTATTTAAAAGGGATTGAG
GAGAAGCATATGTTAAATGCCAGGAAAGTCTTTTTTCTTCAAGTATTTTGTTTTGTTAAT
AATCTATTCCTTCTATTTACTCCTGCCCCCTTTTTGGATTAGGAAATTAAAAGAAACAGA
ACAAAAAACAAAGCCCTCAATACATTGTGGTAGTGTCCAGCAAAACAAATTTGCACATTA
GCTTTATCTGAAAATGTATGTCACTTTTCTGCATTTTAAATTCATCACTTCTGTTAGCAG
GTGAGTTGTATGTTTCATCCTCATTCTTTTGGACTTGAGGTTTGTCATTGTATTGATCAG
AGTTCCAAAGTCTTTCATCAGAATTGTTTTTCTTTAAAATAGTATTGAATAAATTGTTCT
CCTACCTCTGTTCACTTTGCTCAGTATCAGTTCATATAGGTCTTATCAGTTCTGTCCATT
TCATCATTGCTTCTATTGCAGCAATACTCCATTACACTGCTGTACCCCAATTTCTTTACC
TATTTCCCATTAGAAGAGCAGCTCCCTAATTTCCAGTTTGTGTCTTAAGAGCTACTAAAA
AGCTTTTTTTGTGGTGGCAAAGAATTGAAAATTAAGGAGACACCCATCAATTAGGGAATG
GTTAAACATTTTGATTGTGATCAAATACTGTTATGCTAATAAGAAACATCAGGGAGAATG
GTTTCAGAAAAACTTGGGAAGACTTCTATGAACTGATGCAAAGTGACATGAGTAGAACCA
GGAGAATATTGTATAAAGAATCAGCAATATTGTGTGATGATCAGATTTGAATGTTTTAGC
TACTCTGATCAAGGTAGTGATCCAGAATAATTCCAAAAGACCCATGATGAAAAGTACTAT
CCCCCTCCACAGAGAGAACTGGTGAACTCTCTCCTCTCTCTCTTTTTAAAGCCTTACCTT
CAGTTCTATGTATTGGTTCCAAAGTAGAAGAATGGTTTAGTTAAGGTAATGGTGGTTTAA
TTGATTTGCCCAGGATCACAGAGCTAGGACGTATCTGTTGTCACATTTGAACTCAAGACC
TATCTCTAGGCCTGGCTCTCAACCCACTGAGCCACCTAACTGTCCCCTAACCCCCATCAA
CTCTTTGAGTACAGATTGAAACATACTTTTTTCACTTTATTTTTCTTGCTTTTTTTTTCA
TCATGGCTAATATGGAAATATATTTTCCATAACCTCATATGTCTAATTGACAATGTATTG
CTTGCTCTAGTGGGTGGGGGAATGACTAGTGAGAGAGAATTTAAAAAGGAATGCCATAAA
TAAGCAGACAGGATAGTAAGCAGATTAATAAAAAAGCTGCTATAAATATTTACTGTACAT
GTAGATGCTTTTTTCTCTTTAATTTCTTTAGATTATAAGCCTAATAGCATGATGGGGTCA
TAAGGCGGTGACATTTCAATAACTTCATGTACATAGTTCCAAATTTATTTCCAGAATGGC
TGGACCAATTCACAGGTCCATTAAGAATGCAGTAATGTAGATAAAACATTTTTAATATCA
TTATTGATAGCTTGGATTTTTTTCCTTTGAAAAGTGCATGCTTACATTCTTTGACTATTG
GGGAACAACTCTTTGTTTTATGAATTTTAATCAGTTTTTCCTATATTTTAGAAACGAGAA
CCTTTTTCAGAGAAACTTGTCATAACGATTTTTCCCCCAGTTATCTTTCTCTAATCCACA
TTAGACTTGTTTGTAGAAAATCTTTTTTTATTTCATTTAATCAAAATTATTTTATCTTGA
GTGATTGTGTCTTGTTTAGTCACAAACTAGCCATAGATCAATAAGGGAATTTTTTTATTT
GCTCTCCTGTAATTTGTTTGATATGACCTTTTATATCTAGGTCACATCCATTCAGTGCTG
TCTTGATAATGGCATCATGTGTTGATCTTGGAAATTGAATGCTGTCCAGTTTTCCCAGCA
GTTTTTGTCAAATGTCTTTCCCAGTAACTAGGATTTGGGGGTTTATTGCTGTCTATTTTT
TTCTGTATATTGTGTACCTAATCTAATCTATCAAGCTATGTCTGTGTATTTTTTTTACTG
TATATTGTGTACTTAATCTTTTCCACTGATGAGCCTCTATTTTTCTTAAACTGGTACCAA
ATTATTTTTGTGAGAACTACTTTTTCTCCAGCCTGACACCTGGTACTGGTAAGATTCCCT
TCCCGTTTTTTTCCTCATTTCTTTGAGATTCTTGACCTTTGTTTCTCCATGTGAATTTCA
TTATTTTTTCTGGCCCTATAAAATGTTATTTTGGAAATTTGGTGTGGCATTAAAATAAGT
AAATTAATTTAGAAGTACTGTCATTTTTCTTATGATTTCAATTGTAGAGCAGGTGATAGC
TTACATTGATAATGGGAGTTTCCGTTATCAATGTCTGGGATTTCCCCTCCTTAAAAAAAA
AAATTATTCTCTTTCTCTTTTTGTAAACATTACTTTCTCTTCATTCACAATGACTTTCTT
CTACTCTTTTAAGAATTACTTTGTAACAAATTTGTACAGTTAAACAGGAGTCCCTATGTC
TCATGTCCCTGTGGTGCACAGCCTTTGGGAGACTTTGCCATCATGGTGGATCACTGCATT
GTTCAAAATCTGGAAGTCCTTCACTGTTGGTTTTCTCTGTGGTCATCTTGTAAATTATCC
TTTTGGTTCTGCCTACTTTGTTTCATTTTATTCATATCTACTCAAATTTTTCTGACTTCA
TAATCATCCTTTCTTATTAGGTAGGAAGTTCAAGGATTGTTATCTTGGAGGATCTGGGGG
AAATCATCCATGCTTCATACATTCTTTCATGCCCATGATTGCAAATCATGCAAACAATAA
TGATCTTTAAGCATTTTTATTGATTTAAATGAAGTATCTTGTAGTTTGCTTGTATAACTT
TTTGCTTCTACTTACCTTAACCCTTGAGATTTTGAAAGAGAAGTGCTCATTCTTTTTGTC
TATGCCTTTACAGGCACAAAATGTTTATATAACCCCTTTGTTAAACCAACTTGCCTCAGG
AGCTTTGGCTTCAAGTAAAGCCCATACCTACCAATTTACCCAACAACTTGTATGTACAAT
TATTAGAAACATTTATTAGTTATTTAAATGGTTGCATTTTTCTGTGTGTTTAATGATTCT
TGTCTCTTTGGATTTGGCTTTTCATGGGCAGCAACTATATGATTCTTAGTGAGTTGTATT
TTATTGACTTTGTATTGAACAGTCAAGTAATACTACTGTGTTATTCATTTCTCTTTATAT
AAAATAGACAATTCATGACTTATTCATATTTAAGCGAAATGTAAGTTTTGTGGTATTATA
AACATGTGACTAGATATCTAATGAAGTTACTTGCCCATCCTTTTCTCCCTTTATCCTTCT
ACCCGAGTACCTGGCATTTAAGTAGTAGACACTTAAATGTTTGTTGAATTCCTCTCTAGA
AAAGAAATAAACGTCTGTGGTGTGGTTGTATGTATTCTTTAATTCCAGAGATTTAAAGTA
TAATTTAATCCTCCTTTGTTTAGGGAAGTTCCTTTGGCTTCTCTATGGGAATAGAATACT
TCCTTTTGAATGCTTTTAATTTGATTTTTCTAGACTAAGGTTGTGGTATGGTGAAAATAA
TGTTGGATTTGGCGACCACCTGGCATGAATCCTTTCTTTTCCACTTACTACCTGTGTGGG
CTTAGGCAAGTCATTTAACCATATTAGTTACCTCATTAATAAAGGAGCAGAAATAGATGG
CCTCTGAGGTCCCCTTTATTTATAAGAATTTTTTTTTCTAAAATTTAGACTAACTCTTCA
ACATCTTGGTCCTTTCCCATTTTCTTCTGTGAGTAATGAGAGCAGTAATGAAGAAACCAC
CTCTAAAGGAAAATAAGTAAAATGGAGTAAGACCGAACTAAGAAAAGGGCAAATAATTGG
GGGTTTTGTTTCCGTGAAATTGGTGGCAGCAGGGAATCAACATGGCACAATAGGAAGTGG
AGCTTTCTGTAGAATGAGAGGATCTGATTTTAAGTGATACAGTGTACCACTTATTGTCTG
CCTGACCTTGGAAAAATCGCTTTATTTTTTTAGCCTCATTTTCATAATTTGTAAATGAGA
GGGTTAGGGTCTGCCCTTTCAATTTCTAAGTCTATCATCCAGTAAGTCTGGATTCAGATT
TCAGAAATCCTAGGTTTGAGTTCTGGTTTTTGTTACCTAGTAACTTGCTGTGTGCCCATA
GGAAAGTCACATGTTTTGGAGCCTTCGTTTTCTTAACTAACTATATTTAACTACATTTCT
GTTTCTCTTATTAGAGCCTCCATGTAAGGTAGGCAGATGTAAACAATTTTAAAGGTTTGG
AAAAGTAGTTATTACCTTGCCCACATTAGAAATATTATCTCATCTTATGTTATTTATGTT
TATTATCTGTCAGCCTTCAATAAGATTCTTAAGAGTATAACTTCCCATTAAAATTTTTCA
TTTTTCTCCCTTGACTACTGTTTATTCCATGATATTATAGTTGCCAGAGTATATTTAAAC
ACTTTTCTTTAGATCAGTATTGCTAGATCAAAACTTTGTGATCTTCATTTATGGATATTT
AAATACAGAATATTCTAAAAGTCTTTAATCTGTATATGTAATGCAATGCTATCCCTGGAT
TTTCAATAAGTAAATTTTTACATTAAAAAAAACCAAAAGGTAACTGTTTTACATCTTGAA
AATTCAAAACTGTTTGAAATAATATTAAAAATGGTGGGATTTAAAATTTTTGTTTTCTAG
GAAGGTCCCCAGAGGAAAAAAAGGAAATCTGAAGCTGTAGGAACCAGTGATCAAGTTGAC
CTATTGGCCATTGGTACAGCGGTTGGCAGCATTTTATTATACAACACAGTAAAAGGAGAG
TTACAGAGCAAACTAGTAGTAAGTATACTTTTTTGAAACTTAGTATAATAAACTCTCATG
GCTTTATTTTTGTTCTCTTTCCAAACTATTATTGGAGTAACAATTTTGTTCATCAGAGGG
AATGAGGAAATAGTATTCTCTACTAAACTTTAATAAAAATCAGAAGGGATGAAAGCTTGG
AGTGTTTTAAGCAAGAATAACAATTTACAAATTATATGATGGGATAAATATGGTTTTCAA
CCACAATTTCTTACTCCTTATGTATTTGAAACATAATTACCATTCCTTAAATCTTACAAT
TTTCTTCAGAATTCTGAGTTAGTCTTTGAAAATTGATAATCCCCATATGTAATTAAAATC
CCATTAGAATGACTTCTGGAAGGAAGCTTTTTGGTTAATGAAGCTGTTTCCCATGTCAGT
TTGGATAACATTTGGAAATAGTATTTTGCTCATCCAAGTATACCAAATTCATTACAATGA
ATCGTCCTACACATTTGCTATCTCTGGTCTGTGGGATAACTGAATGATACTTGAGCTCTT
AGCATTTTCTTTGATTCTGTCTTCTAGAGACAATTACTAGGACATCTTTGATAATACTTT
ACACTTTATAAATAATCCTATATACTTTTCAACTCTTGGCATCTCTTAATATTTCAGTCA
TTTGATGAATCTACCCAGAATCACTAACAAAATGAAACACCTAAAAATGTCCAGGGAATA
AGAAGATGAAAAGAATGGAAATATAAAGTTTTCCTTCTTTTGCTAGATTAAAAAAAAACC
AAAAACCTTTCTCTCTTTTACTTTATTGAGAAGCTGGAAATGAAGATTATTTCATCTTTG
TTGTCTTAAAGAATAGAAATGAAATTTCATCGATATTTATTTTATAAAAATTCTCTTATG
CAAAGTATTTTGGATATTCTTTATGTGGTAACTCTTAACTGGCAATGAGATAACATTTCT
ACTTTGGGTAAGTAGGAATTCCTTATTTAAAAAAACACCTGATAAACTTTTTTTTAACCC
TTCCCTTCCCTATTGGAATCAATACTGGGTATTGGTTCCAAGGCAGAAGAGCAGTAAAGG
CCAGGCAATGGGGGTTAAGTGACTTGGCCAGGGTTACACAACTGGGAAGTGTCTTGAGAC
CAGATTTGAACCTAGGACCTCCCATCTCTAGACTTGACTCTCAATCCACTGAGCTACCCA
GCTGGCCCCTGGGTAAGAGTAAACTCTTTGAATAATGAGTTTGTCATATAGCTTATTTAA
CATAAAAGAAATTAAAACAGTAACTTAATGCCAGAGTTCTATAGTCATATTTAATTCTGA
AGTATTTCTTTATTCAAGGGGTTATGAGACTCTTGGGATGACAATTAATATTTAGTTATT
TGTAAATTTTGTCTAATGGGTTGTTCTAGTAATTTGTATCATGGAATCTGTTGATGAAAA
AAATACATTCTGTTGTTAAAAAACATTATCAAAGATAAAAGTAGATATTATAGTAAACAG
AGATGTTTGATGTTTTTGAGAAAGAGAAGAGTGACTCCTGATAAGGGAAGACAGGAGATA
GACTAGGAGGAGACCAAAGAAGATAGAGAAGGAACAACAAGAAAGTAGAGGCAGGAGAAT
GAGATAGTAGCCATCTCTCCATCCCTACTGCTTCCCTTTAGCTCTCTTTTTCTGAGTCTG
GGGAGCATTGAGGTACTTCTACTGGTTATGGAGTTAGTGTCCATTGGCACTCTGGACTTA
AGTTTTCTAAGCCAGCATCACATTCTTTTCTTCAGCCTCTAGCCACAGAATCATGAGAAC
TATGAAAACTTTACTTTCTTTACATTGTAATAGTTGGGCCACTCTTGTTGTTGTAGAGAG
AGGAATATTCCAAAATATGGGCAAATATAAAGGACCATCCTACTTATTGTTAAGCATTGC
TGACCCTCCTTTTATTGATATCCATTAAAAGTGGAAGCCTGATGTGTAGATCTCCCCCCC
CCCCCAACAATGTGTAATCCATTGAAACCACTGATAAGACTAAAAATATAATTTATTAAT
GGCAAGTGGGTATCCATAATTTTCAAGTTTTTGTTAAGGTTTAAAAAATATATATCTCAA
GATGAATTGTTTTGAGATTTTGTGGGTCAGGGGTAGTAATTGTGTATGTTTGTTTTTTAC
ATGTAGAGCACAGGAAAAATAACTAAAAAGTTAGAAAATAACTAAAAAGATAGAAAAAGA
AATTGAGACTTTGCTAGAATGTGCTTATTCTACTTTTTTTTATCACATCAATGATTTCTG
GGATATAATTCTGCTTTCCTGCACTCCTACCCCAACAACTGATGCAACAAACAATATTAT
TTTAAAGTTTATGAAATAAGGTAGTTTTAAGTTTTGCTTCTCTGCAGTATATGTATTTAC
TCAATATATTGGTATATTTTAATTTGGAAATTATTTTGGAAATTAGGATGGCATAAATTA
AATTTTTAGTTAGGGGAGAAAATTATTATTTAATTTTTTGCTTGTCGGTAAATTAGTTTT
CAGTTGTCTAATGTAAATGATGAAGTTATTATGAATGACATCACTTAAGTAAATATTGTC
TTTAATATTTTGCTTCTGTTTAATATTTTTTTCCTTCTATAGAGTGGTGGACACGACAAT
AAAGTAAATTGCATACAATGGCACCAAGATAATGATTGTTTATATAGCTGTTCAGATGAT
AAATATATTGTGGAATGGAATACACAGACGTGCAGAGTAAAGTGGTAAGTAAGATGGTTC
TTTTTAAAAAGAAAGCTGCCAAGATTCTTAGAATTGAACAGAACAACAAATAATGCATGC
CATTGTAGCTTTACCTAATTTGGACCTATTTGTTGAGTATTATAGGGATATTCCTTCTCC
CAAAGAACTTAACATTTATCTTTCTTAAAGTTTCATAATAGATCAAAAAGCAAAAGATGG
ATTAGAAAAAGCCATGAGTGATAATATGCAGTAAAAACTGAATTTAGAGAACAGAGAGGT
CTGGGAAGGATTTATTATAGGATGAAATGATATGAAATAAGTCAAAGGATAATTAGGATT
TGAGAAATTATATATGAATGGAGTACCTCAGTGTTACAGGATGATAATTGGAGAGCAATA
AGGAGACTTTTTTGGAGCATTTCTGATTTGGGAGATAAGATTAGTGAGGTAAGTGGGAGC
CAAATTGTGGAAAGTCTGAAATGCAACCTCAGATGTTTGTATCCTCCTGTTGTAGGCATT
AGGAAGCTACTAAAAAGTTTTGACTTGGGTAGTGATAGTAAAGTAGAATAAATAAACTGG
CAGGATAGATTAAAGAAAAGAGAAGCCAGAGGGAAATTAATTTTAAAAGACGGTCACTGA
AATCCAAGACTTTGAACTTGATCCAAGTTAAAGCAGTTGCAATGGGAATGGAAATGGATA
AATATGAGAGACGTTTTAAGGAAAACTTAAGAGGACTTGATGACTGAAAGAGAGCTTTTA
CGGGTGAGAAAAATATCAAGATGACTAAGTTTCAACCCTGGGACACCAGGAGAGTGATAG
TACTATTGAAATGGGAAAGTCAGAGAGTGCCTGTTTGGAGAGCAATTTGATGAATTTGGT
TAATAACAATTGCCCACTTTGATCTAGTCCTTTATTGTTTACTAAGTACTTTCTTTCCTC
ATGACTATTTTAAGATAGATGGTGTACACATTGTTAATCCTCATTTTTACATGGAAACAG
CCTTAGAAAAGGGAAGTGAACTCCTTGTGTTATGCACCTAGGATATGAACCCATGCTTCC
TTGATCCAAATTAAGTACCTTTGGGGGAGTGGGTTCCAAACCTGTGGTTTCATTAGCAAA
AATGAATTCCTAACAAGAAAACTCCCTCTGCTAAAGCAAATCTAGCTGATAGACAACATC
TAGCCCTGTAAGCCTGGGACACTGAGAAATTCAGTAATTTTGCCTAAGGACACACATCCA
GTATATGTTAAAGGTGGATCTTGAATCAGATCTGCCTAACTTAGAGATCCTTGTTGCTCA
CCCTACCCGCACTACTGCTGTCTCTTGGTTTTAGGTGTGGCATTTGATAGACTGGGGGTA
GGGAGATTGGGAATTATTTGTGTGGAAATATAAATTGGTTCTGTGGGAATAAGATCCCTG
GGAATAGGAATAGTATAGGAGGAAAAAGAAGAGTACAGAAGAGGGTAGAGTCTTTGGTAA
AGCCATGGGAGAAAGAAATAGGCAAGAAAGAGGTACAAGGGAATACCAAGATGGTATTCT
CATAGCAGCCAGATTGAGGTGTGAGAGACAAATCAATAGTATCAAAAACAAGTGAGGAAC
ACATGGCCTGAAGAAAAAAAAAGACTATTTAATTTGCTGATTTGGAAAGTATTTGTTGGA
GTTATTATAGTTTCTAGTTTCTTGGAGAATGAGGATGAGAGAAGCAAGATTGCAAGGATT
TAAACAACAGTGAAATTGTAAAAGAATTAGAGGTTCAAATGATGTATAAAACTCTAGGCA
ATGAAAGAATCACTATTGTACAGACAAGATGAAAGAACAGCTGTTTTCTGGATGCATTTT
GACATTCTATAATTTTTTAAAGCAATTTTAGGTATTGAATTAAAGACTTCTGGCACAGAT
TGAAGTATAAATTAGTTCTATTCAAAGCACATTATTTTTTACTTCTAGCTTTGCTTTTAC
ATCACTTCAATTTCTAAAAAAAAATTTTTTTCTTCTCACCTCCCCAAAGGGTCATCCCTT
TTAAAAGGATAAAAAAGAGAAGAAAAAAGCAGATCCACAAACCTAATCTACACATTAACT
AGCTGAGTCTGAGCAGTAAATATAATATTCCTTGCCCATAGTCCTCCACTTCCTGCAAAG
AAGAGAGGATGGCTATTTTCCAAGAATTTGGGAATTATAATTACATGGAATTCTATTTCA
TTGTAAGATATCTTCAGAATGATTTTTTAAAGACTACTACAGTCTTTGTGAAGTTATTTT
TGCATGTGGGGAAATATTCTCACAAATAGGTTCATTATTTCTGATAAAGAAATAGCACCA
ACTGCTCCTAGATGTAGAGACGATGTAGCTTGAATGGGAGTCAGGTTGTCCCTCTCATTC
TTTCTGTGCATTGTACCAGTGTATTGTCACTTTCAGCTGTTCCATCTGAGTTGCTTGCTA
TTCAATGTGCTAATAACAGTTCTATGATAACTGAGATTTAAAGATATTTAAACATTTTTA
ATAACTTGAAATTTGGGAGATTATTATTGAAGTAAAGGTTGCATTTGTTTTCCCAAACAA
ATTTCCCTTTTTTCTTTTTCTGTTAAGAGTAAAAAAATACTTAGTTTTGTTTGCTCATTT
CTTAATTTTTTTGGGTTTTCCTTCTCAGATTCTGAGTAGTTTGGGTAAGATCTTTCGGTT
TGATTTGTTTATCATGATGGCTAATACATTTTGCAATTTTCTAAGAAGAAAGAAAACCTG
ATGGTTGACTTTCTGTCCAATCATTCCTTGAGAAAGTCAAAAAGAAGTTCTGCATAATTG
TTGAGGATGCATAAAAACTACTTACACATATTATATAGACTATGTGTGTGTACACACACT
GAGCTCAGTTCATAAACATTGAGAGATATATAAGTGGGCATTCTGAAAAGTAAGATAGAG
AATCAATTAGTAGTAGGATTTTCTTGTAGTGACTAATCAGTGAGACATTTTTAAGATGCT
CTTTGGGAGGGTGGTGATGATACTGGACAGTGTGTAAAATTGTTCTAAGGTCCAGATGGG
TCAACTGGACAATAGGAACTTCTTAAGTCCTATGGGACCAAATCCATAAATATCTTCTGT
AAGACATAGGATTTGAAAACAAGGTCAGAATGCTCTGAAAAGAAGAGGAAACATAGAAAC
ACAGATCTGAAAAGTATCTTCTACTTAAACCCCCTTGTTCAACAGAAAAGAAAATGGAAG
TCTAGAGAAGCCAACCTTGTACATGCTCAAGGTTACAGAGCTGGGATGAGGCCCTGGTCT
CTAGGCTCCTAGTCCCATGCTTTTGCACTACCCCCTGATGCTTTCCTCCAGCAGGGGCCT
ACATCTGGAAATAAGATTAGGAAACATGTTTTCTAAGGAGATGAGAATGCTAGCAGCCAC
ACCAACATGAATCTACCTGGGGCTGAAAGACTGAAAGCAGCTCAGGTTAGTGTGTGACCC
AGATGTGATTGGGGTGGGGTCAATGCCAGGGACAAGGAAGAGAACTAGATTGTAGACCAC
CTGCCAAGGGACAGATCTTGTTGGAGTCATCTGCCTGCCCACCTTCTTTAAGTCCTCAAC
TGCCTAAAGGAGCTGATTCTAGAAGGATCTAACAGGAGCCAGCCTGGTTCTTTCAGGGCC
CTGGGCCTGGCCTCTGTGGGACAGGATGACTATCCTGGATCAATTCTGCTTGTCCACAGC
TGAAGAAAGTTTGAATTTCAAGGAACCTAGTCTGGTATGAAGCCTTTGATGGTAACTTTC
ATTGTTTCTGCTGCAAAGGAACAAAAGTGATAATTTTCTCTCAATGTTTTTCTGTAATAC
AGCAAATGGAAAGGTGACATCAGCAGTGTCAGTGCTTTGTGCATCAGTCCTGATGGGAAG
ATGCTGCTTTCAGCTGGTCGAACTATCAAACTATGGGATTTGGAGACTAAAGAAGTCTAT
AGAGTGAGTGAGTCAAACTAGGTTCAGGTATAGTAAAAGCACAATAATTCAGACTAATTT
GGGAGGGATGCCATTTTGAATTAGGGGAAATAGGAATTATTTTTATTAATAAAAATATTT
TTCATGTTTCAAGTGCATTGAGTTACCATAATTAGTCACCAAGGAAATGTTTCCAAATAA
GTTTTGATAGTGATAGAATCAATTAGAATTGACAGTGTTGTTTACACACTGGAGTAAGAG
AGTGGCCTGGGTTTTATTATATTGCTGGCTTACTCTTTGTGGTCTTGGGTGAGTGCTTTT
CTGACCCGTTTCCTCATTTGTAAAAATGAGAGGATTGGACAATATGACTTCCTTGAGTTT
TCTTCTAGCTCTGAAACTTCTGAATCATTTCACTATGAAATTGCTCAGGACCGTTAGATA
TAGTTTGTTAAATTAAATAGAACAAATATATACTCAGAAGTCTTGTTTATATTTTAATTT
GCTTGGTGTTTTTTTTTTTTTTTTACAAAACTAAGGAAAAGGACAAGATAAATTACTATA
GGTTTTGATTTAGGTTAGTTTGAATTAATGAGCTTTTACTGTACTGCTAACCATAATTGT
TCTGTTTTACAGACTGAAAACTATACTGTTAAATCAAATATAGATTTCATACTATGTTGC
TGGAAGAAAAAGTTCTTTGGGGTTACTGAGATTTAGTGCTGTGATGATACTAAATTGTGG
TTTCAACTTAACTGATAGTTGAATGAGGACATCTAATTCCTTGGCTGTGTCTGAGCATAT
CCAGTACCCCTTTTGATTTTGTGGTAGAATTAAGGAATTGACTTTATGCAATGAAATGTA
AGAAAACATGGGTTATGGGGAGGACATGTGGGTTATTAAGAAGGAATACTGTGTAGTTTT
TTATAATTTAGGCAGATGCCCTATTTCCTAAGAACTCTAAAGAGTGCAGCATAAATGCCT
TCAGTTGCTTGCTTGAGCTATCAAACTATGGGACTTGGAGAACAAAGAAGTCTATAGAGT
GAGTAAATTAAAATAGTTCCAAGTATAGTAATAATTCAGTAATTCAGAATAACTTATTGT
CTTCATTTAGTTGTGATCACCTGTCCTCATTGTTTATTACAATTTGTAGTTGAAAGAAAT
ATCTAGACTCTGGCATAATTGCTTTAGAATTGCCTTTTTTCCTTTAGCATTTCACAGGTC
ATGCCACAGCTGTTTCATCACTCATTTTCACAACTATAAGACCTCTTAATGAAAGTCAGC
CCTTTGATGGAATTACTGGCCTTTATTTCTTGTCTGGAGCAGTACATGACCGGTTACTTA
ATGTGTGGTATGTATGTCTATTCATTTGGAAGAAAATGTGTCTTGAAATATTTCACTTAT
AGATTGAGAAAAAAATGTAATTGACTTTATTCTGTTTTGGGAATTTTGTTGAATCTCTTA
ACTTTTTTAAGGACCTTCCAACTTGTGTGTGTAAGTGATGAAAGAATAGTTGGCAAGTTT
TATATTATCTTTGACAAGGACAAACTTGTTTTCCCTCATCCTCAGGTCTATTTTTGTTTC
TCTTAATTTGTAAGAGGTTGTCTAATAATAAATAATTCTCAAAAGATTTTTATAATTCTG
TAAACAGCTATCTCCCAATGAATACAAATGATGATTCCTGGGAAGTGATTACATGTATTT
GGCACTATTTGAAGCTGTAATTATATAAAATGTAATTGTTCTGGCCAAATGGAATTATGC
TGTGTAAATCTGAATAATGCAACCACATATCCAAATTCATTTGTATATTAATAGGGACCT
AACTGTAGGTCATTTTGGATTTGTGCTATGATGACATTCCATAGTGGTTTCATCAAACTG
ATAATTTAATGAGAACACTAAATTCCTTGGCTGTATCTGAGCACATTCATCAATCCTTAA
TTATAGCAGTATTATAAACTATATATTTTGATTAACCTTTAAATCAACTTTTTTTAAAGC
CAGAATTTCTCTCATTAAAATTCTGTGACTTAGTCCCTAGTTCTTAAATTAGAAGTTGTT
TAATATTTTTTATAAATTAATACTGACTCCGTGTATTTTGATAATTTTGGATTTTACATT
TTCTACATATTTTAGGAAGAATATCACTAGACCATAGAAATCATTGTGAAATGATCTAGA
TATTTCATAGGTGCTAGATAATTTTACTTATTTCTCCCAAGTTGGGAAGGTAAATTGCAG
AAATTCTGAAGGATGATGAGTTGTTTAGCAATGTAGATTGTATGTATAAAATAACAATAG
TTTCACATAAAGTACTTATTTCATAGAGCATATTATCTTGGGGGTGGGGGGAGGGGTAGT
TTATTTATTTAAAATCCTTGCTTCCTATCCTAGAATCATTGGTTCCAAGACAGAAAGTGG
TATGGGCTAGGCAATATGGGTTAAGTAACTTGTCCAGGGTCACACAGTTAGGAAGTATGA
GGCTAGATTTTGAACCCTGGACCTGTCTCTAGGTGATTATTGATTGATCTGCCTAACTGT
CCCAAGGTATGTAGTTTAAATCTTATCCCTATTTTACACATTAAGCAGGCTTAGGTTGTG
ATCTGTTGATGGTCACTAATGTATAGATCTCAAAACATGCCTCCTCACTTCTATAAATTG
TCTGCTCCTTGAAAAAGGGAGCTTTTTTTTGGGGGGGGGGGTGTCTGCCATGTAGTGCCT
GACTTAGGAGTAGGGATTTGTTTATTCTTTGTGCTTGTATCTCTAAGACCTAGCACAATT
CATACTTGATGAATATTGTTCATTAATTAAAAAATGCTCTGATAAATTGCAAATGACAGT
TCTACATCAGTATTATTGGAACTGTAGTTCTAGAACCTTGTCCTTGAATTGAAATTTTTT
CCCTTCTAGATCTTTTTTACATTCTAGTTCCTATGCTCTAGTCTTAATACATTTGTTTAG
AATCATTGGGTTGAATTGTGACAGTCTTTGCTGTTTTTTAAAAAAACAACTATATTTTGA
ACTTTGGGTTGATTCTGTAAACACTTAACCTTCTGTCTTAGAATCAGTATGAAGTTATCA
GTCCCAAAACATAGGAATAGGAACAGTAAGGGCTAGGCAATTGAAGGACACACAACAACA
ACAGGGACACACAGCTAGGAAGGATCTGAGGCTAGATTTGAACCCAGGATTCCATCTCCA
GATCTTACTCTATCCATTAAGCTACCTAGCTGCCCCAGGGAAATTAATGCTATTGCTTAT
GGGATGAACATTTCATGTCCTCTTTTTGAACTTGGTGCAAGGTAGTAGGATGTTTGATAG
GTACTTAAGTCCTTCAGTTTGGGGGCAAATGATTAATAAAAATCAGTCAATACAATTATA
TGAAGGCTTACAAATCTGCTTATATTTTAAATGCATATGTAATTTGTTTTTGGCCTGAGG
GGTTATAACTATTTAATGTGATTCCATTTCATATTTTGTCAAAGAAAAATATTATTTTTT
ATTTTCCAAATGTCACAAAGTCTAGTTTGGTTGAACCTCTTTATATGAATTGAGAGAAGA
ACTGGCATCTGTAATACATACTGGGTCAATAGAATATTTTTGTCTATAGTCCTTGAGAGA
GGAAAGCATGATTTGATTTTAGGGTATAGGGAATTCCACTGAGGTTTAAGGAAATGGTAT
ATCTCTTTTAGGAATGCTTATATAAAAGTGAAATAATATATGTTCGACATTTTAAATAAT
GTAGCTGGCAGTATTTGCTTAATAGAGAAATACAACAGTTATTAGATTTAGAACAAGTGA
ACTTGGGACAGGACAAATCTTGGTTCTTTTGCTATTTATGACCTGTGTGACCTTTGGGAA
ATCACTAAACCTCTCTACATCCCAATTCCTTATGTACTGTTGTTTTATAAAAGAATATAG
TGGGCTCTTATGGCCTCTAAAGTTTTAATTTTCTGCCAGGCCTAACTCAGGCTCTTGTGC
AAATTTGGAATATTGTATAGAACAGACATTTTTGTAAATGCAACAAAATTCAATTAAAAC
TACATAGAATGATTAAAATATATAGACTCCAATTACCAGTGATAGGTTAGGGGAATATAC
TTCCTGGGCAATGAGAATTCTGCTAAAACCTCCAACGTCATTTTCCCAGAGGCCAAGCCT
TTCATATATCAGATAGTCTTCTCAGCCCTAAGTGGACCACCCCAGCCTATATAAACAGAT
GCTGCTTCTACCACAGCCATCAGTTCTAAATCTGTGTTATGCTCAATGAGTTGTTTTGTA
TATAACTGTGCACTGGTTCATTCTTTGTGTCTGCCAGGTAATATTGGTAGGTACCTTAAA
TTTTTCTAGGCAACCAGTTTAAGTGATTGTTTTAATTTTTATTCCACTTAATTTTGGTTT
ATTGATTAATTCTGTGTAGAGTCTAATTCTGTGATCTTTCTTTAGATGTTTCCAATTTCT
TTGCATCTCACTAGATAAAGGCTGGTTTATGTATTCTAGGCAAATTCGGTCAGAAAATAA
AGAGAAGAATGCAGTGATGTCTTTTACAGTTACTGATGAACCGGTCTACATTGACCTGAC
TCTGTCAGAAAACAAAGAGGAGGTAAAATTACTGGATAATTTAGTCTTGATTGTTAAGGA
ATGCTATTTCCATTTTATTTCATTTTGCAAAATAGAACATGTTAATGGGTTTTGTGGATC
TTGTACAAACCTGGGTGGTGAGAATGTTACAGTTTTGATAGTGACCAAAAAGAGCTATGT
TCTATTTAGATTTTTTTTTAAGTAATAAAATGACTAATAACATTTTTTGAGTAAAGAAGA
GGGAAGAAAATAGGCATTTATTAAGCTACTAAAATGTGCTAGATATCCTGTGCTGTGTCC
TTTACAAAACAAATGCTATCTCATTTAATCCTCACAACAACCCTGCCAGGTAGGTTAATT
TCCCAGTTTTTCTATTAGAAAGATTGCAGGGAAGACACCTGCCTAGGGAAACTCAACTAG
TAAATGGTTGGGACTGGATTTGAACTGACTCTGGGCTCAGTCATCTCTCTATTGAAAATC
TCATTAGAACATTTTGGATATCAAGGGGGCTCAGAACTTAAAATAGATACAATTATTTGA
AAAGATTTTATGGATATGGCAAATTGGTCTTATGCTGCATTATCGGATGATTTATTTGCA
GTACAAAATTCCACAATATTGAATTTTACTTTGTATGTTCTAATAAAACTTTATTTATAA
GAGAAGCTCAAATAAAGAAACAATTTTCCTAAAAGTTTGTTGCAAATGACATTTTTCCCC
AATATGAGCATACTTTCTTCAGATCACAACTGATTTAAATATCTACTACCTTACACCAGC
TGAGACTGTACATAATTCTAAATTTCAGTTTTAAGGAAATAACAGCCTTAATGATATATC
TATGTTAACACTTTTCTTTGGAAAGCATGTCACTTTTGTATACAACAATCAGAATTAGAA
AACTTAACTTTCTAAGGGCAACCCCTTAGAATTCTGCCTTTTACAGAATGTAAATTCACT
ATTTAAAATTTTTAGTTTTTCTCTGTTAGGATTAGTAGTATTCAATACATACAAAATCTG
GATTGTGGGATGGGCATAAAATTGATCAAGAGGCATGAAAGTTTTGTAGAATAGTTTTAG
TCATAGATCATTTAATTCAATCCCCTCATTTTACAGAAAACAGAAACAAAGGGAAAGTGC
CTTGCCTGAGGTCACACAGGTAGAAAGGTACAGAGCCAGGATTGGAGTCTGTGTCCTCTT
AATTGCAAATGCATTGAGCTTTCCACTTTGCAGATTTGTACTTAGTTCTAAACCCTTACA
AACAATTTACAAGTAAATTTCTTATTTGTTGATGTTCTCATTTATTATCTGTTAGAGAAT
CAGGATAATCTAAATGTTTTAAAGTAATATAATAGGTCTTGATGGTTTATACCACATGTT
TTTCAGGGTCTTTTCTTCCTACTCCATAGAAATATTTATAATGAAGTGAATAAGCTTTAA
GCTTTATTTTGCCTTGAATATCAGATAGTGGTAGGAGTGATTGAGCTAGAACTTCCTTTT
CTTCATCTTGGCCACTAATCAGGAAAGAGAAAACCATTATTTCCTTACCCTTACTCTTTT
CAATTTTATTTTTCATTTACTTGGACCTGTATATTAAAATGTTCCTATGAATATTAAAAA
GCAAACCAATGCATATCTGTTATTTTTTTAAATTCTTATAGTTGAGACTTTAATTTCTTA
AACTTAACCTCCTAAAGTGCTTCTTAGTTCATTTGTCCTCCTAATTTTTAGTTAACTCTA
AGATTCCCAGTTATATGAATTGCTGATATGTATCAGTGTAGGGAATCTGAAATTTTTTAG
TAGCGATGTCCCAAAGCTCAATTTTTAAAATTCTTCCCTTAATTATGCATGGTAGTATCT
CCCTACAAGTTTTCTATTTCCAAGAAACCCTGTAATCATTAAAGGAAGACATACACTCTA
GGGTATGGGACTGAGGCCTATATAAAGAATCTGCTAGCCTGACTTCTGTGGTATTATGGC
TTTAGTTGTCTTGGAGCTTGGAGACTCTAGAATAGGAATAAAGAGGAAGAGATAATGGTG
GACACACCTTTGCCCTTAACTCCCATTTGTGTACCTTTTTCTACTACTCTGATAATGGTG
CTGCTTTTGGTGCATGTGCAAAAGTTGAGCTATAGAGCACAAACTTTAATGTGTATAATT
AAACTTTTTGTAATACTATAATAGGTTTACCTTAGTACCATTACAATATGGAGAGTCCCT
GTTGAATTTACAATTTAGAGGATTGTAGAAATGTTTGGGAATAGTTGTTTTGTGTCAGAA
AGTTACAGAACATTAACAAATAACAGAAATTTTTGAATGTTTGATTTCAGTGAGAGTAAT
TGGTAAATTTTGTCTTATTCCTTTAGCCTGTTAAGTTAGCTGTTGTTTGTAGAGATGGAC
AAGTTCATTTATTCGAACACATATTAAATGGGTAAGTTGGAATTTTTCAAATAGGAATTT
ATTTTTCTTAACTTGGTTTCTTCCTATTATAGGTTGTTAGCATTGTGTAACTGTATTTCT
CTAACTCTTCTCAACATTTTTTTTTAAACCCTTACCTTCAGTCTTGGAGTCAATACTGGG
AATGGGTTCCAAGGCAGAAGAGTGGTAAGGGCTAGGCAATGGGGGTCAACTGACTTGCCC
AGGGTTACACAGCTGGGAAGTGTCTGAGGCCAAATTTGAACCTAGGACCTCCCGTCTCTA
GGTCTGGTTCTCAATCCACTGAGCTACCCAGCTGCCCCCACTTCTCAACATTTTTAAACC
TTTACATTCTGTCTTAGAACTGATATGAATAGAGTAGTAAGGGCTAGGCAATAGGAGAGT
TAAGTGCCTTGCTCAGGGTCACACAGCTAGGAGGTGTCTGGGCTCAGTTTTGAACCTAGG
ATCTCTTGTCTCCAGGCCTGGCTCTCAATGCACAGAGCTATCTACTTGCCCCTAATTGTT
CTTACATTTTTATCATGTGTATGCTCTGTGTCCTTCAAGCTGATTATAAGTTATAGTAGT
CATAAATCCATATAGTCGTAATAATAGAACTAGGAGAGTGATTTGTTTATTTGTTTTTGC
TCATGATTGCTGGTCAGAAAATATTTTAGGCGAGCCTGTAAAAATTATTATTCGTTTTCT
TTTCTCCTGAAGTGTTCTTCTCCCTCATTACCCCTCTCATAAGATCTTGCTTCCTACTTT
ACTGAGAATGAGGCTCCCAGACATTGTAGTCTAGTAATAGTAGCTAGCATTTATATAATA
GTGTGTGTGTAGTGCTTTAAGGTTTGCAAAATGCTTTACAAATATTATCTATTTTTATCT
TCCAAACAATCCAGGGACATAGATACCATTTTTATCTATTTTAGAGAAACCGAAGCTGAT
AGAAGTTATATGACTTGCCCAAGGTCACACAGTCATTAAACATTTGAGGCTGGGATTAAG
GATCTAAGGCAACTCCTTTGTTTCTTAAAAATTTTCTTTTCCAGCTCATTTATAGAAACT
GAGGCAAATAGGGTTAAATGACTGCCCAAAATCACACAGCTAGGAAGTGCCTGAGGCCAT
GTTTTAATGCAGGAGGATGTTTCCTGATTTCTAGCCCAGTGCCCTTATCTGGTGTACCAT
CTATCTGTTCCTTTTTTCTGAAACACATGTCTTATGTCCTTTTCTAGTCTTAGAGGATAA
GGCCTTCCTTTCCAAGATTGATTGCTTCATTCATGCTCTTATTCCTATCCTCTTTTGTGT
TTCTATCAACTATTCCCAACCTCATACATTTCCACTCTGCTATGTCTTCTACTTAGGATT
CTTATTTCTTTCCTGTTTGAATTCTTTCCCCCTCCTCATGTATTTCTCCCCCAAGAAAAA
AGAAAACAAGTCAACTTTGTTTTACCTTACATTTCTCCCCCTTAAAACTTATTTATGCTT
ATGCTTTTTGTCTTATTACTCTGATCATTCTTTTTTCTTGTTTAAAAAAATCATCTGTCC
CTCTCATTGTGCCCCCCTCCCCCATATACACTTTTTCTTCCTCTTTGAGTAAACACAAAA
AAACAAAGCCATCAATACATCAGCACAGTCCAGCAAAACATTCCCACATTAACTTTGTCT
CTTTCGCATTTTAAGTTTATCACTGTTAGGGCTTAAGTATGTGCTGAACTTCATTCTTTT
GGACTCATTGGATTGACTAAAGTTAAGAAACCTTTCAAAGTTGTTTTTCTCCAAAATAGT
ATAGTATAAATGTTTTCCTACCTCTTATTCACTTTGCTTTGTATTGGTTTACAGAGATAT
TCCCATTTAGTTCTGAAAGACATTCTTTGTGTTTTTATGGCACAGTGATACTCCCTTTCA
TGTATCACAGTTTGTTAAACCATTTCTCTAGTGGCCCCCTTATTTCCAATGTATAAGAGT
TGCTATAAATATTTATTGTATAAAAATCTTTTCCCTCTTTATTTAATTTCCTTGGGTTGT
AAGTATGATAGTTGAATATCTGGGTTATAGGACTCATATTTCAATAACTTGATGCATATT
GGACCAGAATGGATGTCTGATTTATAGCTCCTCCATCATTTGTCATTTTCATCTTTTTTC
TTCTTTGCCATTCTGATAATTGTGATGTAGTACCTTACACTTGCTTTAATTTATATTTCT
CTATTAGTGCTTTAGAGCATTTCTGATAGCTTGAATTTCTTCATTTTGAAAAACTGGTTA
TTGATATTCTTCAACCTTTATCTCCTTGGGTTGCAATTATTACTTGTGCAATGACTCCAC
AATCCATTTAGCCCTTTCTAGACTACTTCTTTCTCATTTCTATGTGCCTTCTTTTACCTA
CACTTAGAAGGTTGTGAATACAAAATGTGTACAAACAAGTCTTTTTTAGTCCTGCCTCAT
ACTTCAGCCCCATACCATTATTCCTTTAATATCTCTCTTGGTAGTCCCTCCATCTGGTTA
TTGAACCAAAATTGGTCTCTTCTGTGTCCCTTTCTTCCCTCTCTATCCCAATCCAATTTA
TTTTTGAGTTTGTATTTTCTGAATTTATCATGTTTCTTATATATTTGTCTTTGTGCTCTC
ACTGTATGTGGTTGGTTCATTCAGATTCTTGCCATTACCTCCATGAATGGGCACCTTATC
TCATCTCCTTGAGGATTTTTTATAAATCTAGTTTATTTATGAACTCTTCCTGATCCCTTG
CTTTACCTCTCCCCATCTCTACCTGTATACACCCTTCTCCCAAGCCCAGCAAGAAAGCTT
CCTAGAATTTATCCACATAGACAAAGTATATACCTCTCTTTGAAATTCACATTTTGCCTT
GTTTCATATTTCATATTAAGTTTTCGTGTCTTATTCTGCCTAACTTTTATAAGATTTTAG
GCTCCTTGAAAGTAGCATCCTTATTTGCATTCATTAGATTATGCTCAATGCCTTGCACAT
CAGTGGACAGAATTTTTCTAAATTGCATTATGGTTGGACACCTAAAATAAAATCCTTTAA
AGGGAATGAGATATTGTATTAGCACCTTTTGGGATTTATAAGATGTCCCCCCACCAAGGA
GCATTAATTAGATTTTTGTGCTTTTATGATTTTTTTTTTTTGGTCTTCCATTTTCACAGT
GTATTTCCTCATTCTTTCTCAGTAGGTTCTCAGAGCTCTCTGCTTTGTACTTGTATGGAT
CTCTGGACCTTGTAAACAACATGACTGTTCCTTTGTTTTGTGGAGAGTGGTAGAGAAGTT
GAGATGTGTAGTTGTGATGGCCAAAGTCTACATAGATAATATGAGCATTGTAAGAGTTTA
TTAGCATAGTATATTCAGTAGACCCTCTCCATCTTGTTTTTACCTTGTTAGGGCATTTTA
ATATTCTGGGTAATGATCCCTTTCTCTTCTCTTTAACAGTTTTCTAAGAGAATTCCTGTG
GTAAGTTTTGATTGGTTACTTAATCTTACATGACTGATCACATTTAATTTTTAAATTTCT
AGATGCTGCAAAAAGCCTTTGACTTCAAATTGCACTATTCAAATTGCAACATCTGGGAAA
GACAAGGAATCAACACCAACACCTATCCCTATTCTAGCAGCAGCTTTTTGTTCAGACAAG
CAATCTTTGCTGCTTGTTTATGGCAGCCATTTGCAGCCAGCGATTGAAAGAGTGGTAAGT
AGATAACTTGATCCTACTTATTAATAATTAATATAAAATTATGTATTTAAGGATATAAAA
ATTAAAATTAGATCTCTATATTTAAAATATATATTTAGGGATTTATTAAGGATCATTAGG
AATATAGGAGTAAGAGGGATACAAAATAAAGAGCACATGCCCATGGCTGATTAGCCATTT
CAAAATCCCCACTCACCACCACCATGCTCACTGACAGAGCCAAAAAGCGGGCAGGATCCT
CCATATCCCCTGTCTACAGTTGCGCTCCCGGGAAATGTAGTTTTTAGGGTAACAGATATT
CAATTATACATTTCCCCCTGATTATCAATTGGGGGGGGGTTAGTCTCCCCAGTTTGATCA
CTGAACATAATCAACTTTAAATTATAGTAATTTGGAGATGAAAGGGAAAAGAACAAATCC
ATGATTGCTAGGCGCATTGACAAAAAAGCCAGTTTGGGAACAGTTTTATTTGGCTGACCA
TGGAGGTTGTGAAGAAATAACCTCAATCTTCCTAACTTTTCTTTTCCTTTATTCTTGTGA
TTATCCCTAAGTCTCCCCCCCCTTTTTTTTTCCTTTTTTTTTTAAACCCTTACCTTCCAT
CTTAGAATCAATACTGGGTATTGCTTCTAAGGCAGAAGAGTGGTAAAGGCTAGGCAATGG
GGATTAAGTGACTTGCTCTGGATCACACAGCCAGGAAGTGTCTGAGGTCAAATTTGAACC
CAGGATCTCCCATCTCTGGGCTTGGTTCTCAATGGGCCACCCAGCTACCCCCAACACCCT
TACTCTACCCCCTCCCCCCCAATTAACAGACCCTCAGATTTTCACCTTGGGGAGGATTCC
TTCAGATACTTGGCTGGTTTGCCTTAAAAGGCAGCAAATAGGCTATTTCTTATTTAGCTG
TGAGGGTAAAAACCTGGGGGAAAGCTTTCACTCCTTCTCAAGGGTAAAAATAGTCCTCCT
CTTGCCCCAAAGGAAAATCTTTTTTCAAAACCCTGGGTGTCTTTACAGTTAAACTTAAGT
GAGAAGTAAAACCTGGAGAGTTCAGTCAGGAAGGGTGGTATTAAAGTAACAACAAAAGTC
TGGTTTTTCCCTGAGGCTCTCACAACCCAAATAAGGTAAAAAAATAATTTCTAAAAACCT
TTTTTGCTCCAGGCCATAAAAAAAGGAGCCCAGAAGTGGAGTTCTACTGATTTCACCCTG
AGGGGAAGTAAGCTGCTTCCCATTGCCCCTCCTATACTTAGCCTCCAACAAAAGGTTTCT
TTTCCTACCCTCTAATCAAGGAGTTGATCAAATCAAGGTGTGATATCCTTAAGGGGACCA
TGCACTTTTGATTTTCATACCCTGACTCTAACCCCTAATCAGTAGTGCCATCTACTGACT
AAAACCAGAATTATAAACAATTTAACAAAATACATAATAAATAAATACATAAATGAATGA
ATGAATGCTACTCTATGTGAAAGTTTTCTAGATTTTGCACAATTAGGAACCTTAAAGGTT
TAAGAATGCTTCCTATTCCTTATGTTCTTAGGGAATTTTATTTTTCTATTCTTAAATATT
GTGACAAGAAATGTTACCATATGAAAAATTAAAGCTGAAATGCAGTCAGACACACCAATC
CAATTGGACAATTTCAAATACTTCTTATATGGTCAAATGGCAAATACTGACCCCATCCAA
AACATGTCTGATTTTTACAAGCCTGTTCCCGAACGACTAAGAGAGGACAATCTTTCCCCA
ACTATATGTCAATGTAGAATTACCTCTCTCATGCTATGCAACTCTTGACTGACCTTACTT
CCCCTGATCCTTCTCCTGAAATCCCATCCTCTCCTGTTACTTCTCCCACCCCATGACCAA
TTCTAGCCCTGAGGAAATCTTGCCCTTTAAACAAAATTGTACCTCCCCAAGCTGACTCAC
CCTACCCAATTCAAATAAAGGCCTTTTCCCCCCAAGGGACGTGCTCAAAATAGGATGCTT
TGGGGATATGGTGATCCTAAGACATCATATACCTTTTACTCCCCAAGATATAAAGGAATT
GACACGAAATGTACCTACTTGTGAAGAAGATCCCTTTGTGGTTGCCAAATAAAATGTAAG
GGGGAAATAAGGGTTTTTATTAAAAAAGGTTGGACAGGGTTATATTTAAAAATAGGGTTG
CCCAGAATTTATATTAATTCCAAAGAGATTTATTACAATTTGTTTACAAAATATAGAAAG
AGTGAAGTAAGAAAATCAGAGAGGTTAGGGTTAAGATATCTAGCTTAAGCACTAAGTAAT
TTACTTTCAGCTCCTGGCTCAACCCGGGCAGGGAGAATTAGTCTTTAGGCCTCGGCAAAG
CCAAGGACCTGGTGAAGTTTCTCCTGAGGCTAGTCTCTTCAGAAAATCAAATATGAAGGC
AGTCAGCCTTTCACTCAGCACATCTTGGGTCCAGCAGATTCTCCATCAGCCTCCACTCCA
AAGAAAGAATTGTCAGTAGAACTGAAGTCAGGAAGTTGTCCTTCCCTTTTAAAGACACTT
TCTTTTGCATCACCTCCTGTGCCTTCCTCTGATTCTTAGGAGGAGAAATCATAGTCTTAA
AGCTTTGCTTAGGACTGCCCAGGGGGCAGTCAGTCAATTCTGATTTGTCACCCACTATTG
CATGGGTGGGTCATAAACCTTACCCACTCAAGTGTGAATGGGGTATTTAGGCCTTTGGTG
ATTAAATCTAAAAATGGGCAGATTTCCCTACTCAACTTTTAAGTAGGGTGTTTACACTTT
TGGTGATTAAATCTAAAAATAGACAGGGATAATAATCTTCACAATGGGGGGATTAATTTT
TATTTTCACTATCAGAGGAGAGTTAAATTTAATCTATGCAATAGTAAAGATTTTAATGTG
TTACTTTCGTTTGTCTTGTTGGTTTTTTGAATTGCTATTTTCTAATGGAATTGAAAGGTA
TAGCTTTTCTGAAGCCCAGGTGTGGATTTTAATGAAGTGAATTAGGGGGAGTATTATTTT
GGAATTTTATACCTGATTATAGTATAGCATCCATTGAATTTCAGTGGATGACCATGTAAT
GGATAATGTAATGATTGAATCTTTCTGACTCCTTAAATTTCTTTTGAGGATTTCTGGTGA
GTTGTTATTAATATATCATTAATAGAGACTTAAAAAAAATCAATGTCTAGTAATTGTACA
TGGGTGGCACAAATCCAAAATCTGTAAATTTTCTTATTAATGTTGTTGACTTGTGTATAT
ATAAAAGAAAGATGTGGTGAGATATGCATTTTTGAGGCATAAACTGGAGATTTCTATAGA
CATTGAACTCATTAGCATTTAAAAGGATTTTTGTTCATGATTTTTAATGACTAGAATACA
TTGCTTTTTAGAAGACATATCTTGAAATTTGTTTTTATGTTTTGGTATATAATATACTTA
AAAATTTTTGTGACTATACTTGATTACAGTGTGTGAAATTAATTTTTTACCTTTTTTTCC
TAATCCAGTCTTTGAACTCCAAAGAGCCCCATATGTGTCTGATAAGAGATATCAATTGTT
GGACTCCAAAAATAGGAATAGCTGTAACAAAGGTGAGTGAGTTTGGCACCCATTTTGGTA
ATAGTTATGAGTAAACTATTTAATAAATTAATCTGTCATAATCATTAATTAAGCATTTAT
TATATATATATTGGGTACTCCATTAGTTGTTGGGAGTACAAATATTAGGAATGAAAGTTC
CGTTTCCATTTGATGACACCATCTTTTGATTCATAAGACAAAGTAGGTTCTAAAGCCCTG
TCCTTCCCTATCACAGTACCCCCTAGCGACTGAAATATTTCCTATCCTTTTTTATCTCTC
AACTGCCATATAAATCCATCATTTTCCACATGGGAAAAAGCTATCCCAGCTCCCCATTGT
TCTTCACTCTCTGTGTCCCTTCCAACTCTGCACAGCTCTATCTCACACTAGAGTAAGCTT
TACTTCTTCCCTTTATTCTTCTTCCACCCCCTATCTCTCACTGAGACCCAGGTCTCCCGC
AACAGCACCTCTACTCACCACTATGCTTTTGGGTATAGAGTGGAGGAAGTGTCTCTGTCT
TCCATGCCAACCAAGTCTGGAGTCTTCTTTGAGGATCCCCATCACCAGCCTACTTCCTAA
CCTCTCTGTCCTTCTGTAGCTTTTGTATTATCTTGGACACCTGCCTCTCTCTGTTCTAGC
CAAGCATTTGCCACATTGTACCTTATCTACCTTTTTGGCATCTCTACTCCTAAATGCCAT
CTTAGTTCAGATCCTTATCATCTCAATCTACTTGTCTACTTTATCCAGTTCATCCGTCCT
GCTTACTGCTGCCAACATATTAAGTGCAGGTTTATCTGTGCCTCCCCTCTTCTAACAAAT
TTATTGGCTTTCAGTTGCCTTTAGGATAAATTTTAAGCCCCTTTATTTAGCTTTTAAAAT
CTTTCGGAATCTGGCCCCACCATGTCTTTTTAATACTCAGTAATAGCCTGTGTCCTTTCA
GCTGTTCTCAGTATAGTGTTTTTCATCTCTACTCTGTCTCCTCCCCAAGCATTTTTTGTG
GCTCAGCCCAAGCACCCTGCCAATCTTTCTTGCACTCCCTCTCTCTTTGACTACTTTTGT
ATTCTTTTGTAGTTTTTTTTTCCTTAATCCTCACTGTTTGTCTTAGAATTGATACTAAGT
ATTGATTCTAAGGTAAGGACTAAGCAGTAGAGATTAAGTGACTTGCCTAGGGTCACACAG
CTAGGAAATGTCTGGGGTAAGATTTGCAGGACTTCCCATCTCCAGGGCTTGAGTTACTGA
GCTGCCCCATGTTATTAGTATAATTTTTGACTTCCCCGGGAGAATGTAAATTCCTTTCAG
GTAAGGGTCTTTTATTTGTGTATCCATGGCTGCCTCCCACAGTGCCTGGTATCAAATATG
CTGTATGTTTGTTGAGTGGTTCTTCCATTTGCTCCTCTCTTATAATGTATGATTTATTAT
TTGCCTTAATGTCATTCACTTCAACATGCCATTAGCCACTAGTCTCAAGGAGTTGTTTCT
GTAATGAATTAGAAATTTAATTGATCTAAGAGCCATACTTAAAACTACCTGCTTTTAGTG
TACTGGAAAATAGTTAAAAGACAATTTAACATTTACATTTTCTACATCACTAATTACTTC
AATAGATGCTATATTCTTTGAAATGCCCATCATTTTCACAGACTTTTGAATTTTTTTGGG
TTTTGTACCTCTTGAGGAAGAATTTCATATTAATGCCATAACAATATCATTAGAGTAACC
TCAACATTTTAAACTTGTAAGACATCTTTTGCTGTGTATTAACCCTTTAGCATCATTTAT
CTGGTTCCTTCCTCAAAGGTTTTTGAGGAGCTCTATTCCTAAAAATTATCGATAGAGAAG
CACCTGTATAATCTACCTTGCCTTGGTGTAATTTTACTATGGTATATAATAATAGTTCAG
TTATCTTGAGAAAACATTCCTCAAACTATGATGGCTAAATTGAGAGTAACTCACTGGATC
AAGACATGTATGTATAATTGGACTGTATTCGGGTTAAAGTTACTTTTGTGTTTTATTTCT
GTAATAGGAGTATAAATATAAAGAAATTTTGAAGGTACATTTGAAAACTCAAATCTTTGT
GAAAAGATACTCTAAAGATATTGTCTAATGAATTATGCCTTTTAAAGTCACTGTAGGTTT
TAACTTGGTGATAATCTCCTTGGAATTGGAGAACAAAATTGGCAAAGAGAGCCATGTTGC
TCTGCTTTTGATTAAAAACTTGAGGCTTGTTAAGTAAAGCTATGGTCTGATCAGAATTAG
TTTGGTACAATGCAAGACAGAAAAAGAGCTGGGAGCTGCTGTGATGACTTCCATTTGGTT
TCGCTTGTGACTGAGTTTCAGAGCTGATGCTTCTCTCTTGGCTGTCTGAGTGGTCCTGGC
ATCTAATGTTCTAATCTAATTCAGCAGTCCTGAACTAACCAGCTATGTCTTTTAAGTGGT
CAGCTTTATAAAGGAAGAATCTTTGTGCTTTACCACTTAATGTAATAAAACAACTTAAAA
CTTCTTGATAAACTAAATCAGTAATAGAATTAGGAATTGAATTGAATAAATGTTCAGTTT
TATAGTTTAGAAACTTGTTTGTATGCAATTTAAAATATGCATTTTTCTTTACCGCTAGTA
AAATTAATTTATCTTCTAGTTTTAACTCTCCAGTCAAGATTAGATTTTTAAAATCTTTTA
GATTAGGAAGGAATCAATATGATATTATTTCTGAAAATGTTTTATAGAGAAACTAATACA
TATTGAAGTTAGTTCAAATATCAGGCTTTTGTAATGCATCTTAGCATCCTTCTTAATTTT
TGTAGGATGAGTAAAATTGAGTAATAAAGGTTTTCCCTTACTTTTCTTAACACTTTCCAA
TTCTATAGGTAAGAACACCAATAATGAACTCGGAGGCCAAAGTTTTAGGCCCTGGAATTC
CTGGACATCATGCAGCCATCAAACCTACATTGGAGACAGAGAAAACAGAAAGTAAAAGAA
GATTAAAGGAGAATGAGGTAATTGAAGTTGAGAGTATCATATGGGGCAGACCATAGAAAG
TGATTTTTTTTCATTGTTTCATATATTTTAGAACTAAACCAATGCCAGTACTCGCTGTGA
TGATTTCATTCTGGTTTCGCTTTTTGCTGAATTCGTGATGCCTTTCTCTTGGCTGTCTGA
GCATGTCTGGCATTCAGTCAGAGGATTATAGATTGAGAGGTGGAAGAACCTATTCTAGCC
TTCTGATGCTGCAGCAATGATTAAGACACAGATTAAATGATTTACCCTGGATCACAGAGC
TAGTGTCTAATTAGGTTTTGAGCTCAGGCATTCCTGAGATATATTGCATGACTCTCTCAA
CTACTCCATGATATGACATTAAATTCCTACTGTATACAGAACACTCTGGTAGCTAAGAGC
TGAGAATTCAAAGAAGATAAAGCCCTACCCTTGGGTATAGCACATAAACAAAGTGCTCTG
CACAAATTGGATCTGAACTGAGTGGTGCAAAGCAATCTCTTTGTGATTTCTAAAGAAGAA
GGAATGGTTTCTTAACTCAGTGATCAGAGAAATAGGATTTCATAGAAGAAGCAATAATAT
ATATATGTAAGTTACATCATGAATGTAGCTTTTAAAAAGGCATATATCTAAGTAATAGGA
AATATCAATCTATGGAGTACCTTAGATACCTGACTGAGGAGTTTAGGTTTCACTTATTAG
GTAGACTTTAAGAATATGGAACAAACGAATGGATGGCCTGAACAGAACTACTCATATGGG
AGATTAATTTGTGAAATATGGATTAGAAAGAATGGAGGCTGGAATCAAATTATTTTAGGA
AGCTAATGTTTTGTGTCAGGCTAGTAATAATGGAGATTAATAGAATGGAAGGCAAGGAAT
AGAAGGAATAAATAAACATGCTATTTTAGAGTTAGTATCAGCACAATTGGGTGAAGGACA
AATCATAGACCTACTTTTTTTTTTCAGTTCTTTAATATTAATCTTGGAAAATATATTATA
GGATCAAATGCACAGTTTTACAACTCTTTGGGCATAATTCTAAATTGCCATCCAGAATTG
TTGGGACAGTTTACAACTCCACCAACAATGCTTTGGCGTCTCAATTTTGCCACATCCCCT
CCAACATTTATCACTTTCCTCTACTATCCTATTTGCCACTCTGATAGGTGTGGGGTGGTA
CCTCAGTTGTTTTCATTTGCATTTCTCTGATCAAGGTTGATTTAGAACATTTTTTCATGA
TTATAGATAGCTTTGATTTGTTCTTCAGAAAATTGTTTTGACCATTTGTCAATTTGAGAA
TGTATTCTTATAAATCTTCCTGCATACTGAAATCAGTGTTCTACTCTAAAGAGAAAAGTT
TGTTAGTAGAGGTATCGTTCCATACACTAGCCATTATAATTAATGCATTTTTACTATCAT
AAGAGTTTTACTGTTTAATCAGGGGAAGGGGAAAGGGGTAACAATTACCCACTATTAACT
CTTAGATCTGGGCATATCGACATAAGATAATTGTATGACCACATTTTATTTTAGCACATG
GCTCCCTATACATGAATAATGGAATAGAATATGCTTTAACCATAATGTTTTTACTCATTC
AGCAAATTAGCATTGAAGAACGACTGGGAGCAATGGACATAGACACTGTGAAAGAAAAAA
GGAAAGGGGACCTGAAGGCAGACAGCTACCCTGTTCTTTTGGTGCAAGGCCTAGAAAGCA
ATGACTGCTACATGCTAAATGTAAGTCTTACTTGTTGGTTTTGCTTAGATAAAAAAATGG
CAACACAATCGCCAGTGATTCATTAGCTCATTGAAGTACGACTTTTTAGGGTCCTATCCT
CTAGCTCTATAAAATCTTTTTGTTTGGGACAAAAGTACACGTGATATAATAATATGGGAC
GTGTACATATATGTGTCTCATGTATGTACTCAAACATGTGTCTTATGTACACATTCAAGT
ATGTTTCAAATAGATTAGATATGTGAGATTCTTCTACCTGATTGGAAAAATGTGGCCTTT
TCATCCATATCCTCCATAGAGCAGCTATTACTCAGTGTTGTAGAAACTTTTTTCCCAGGC
TTTTTAAATGTCTCATGGGGTCTAGTGTCATTGTTAGGGAGGAGGAGGGGAAGTATTTGT
TAATTGTCTTACCTGTGATATCCTTGTCTTTTCTACATGGCCAATTCACTTTATTGTCTG
AAGGTATTTCCAGGAAGATTTTGTGTTTGTATAAGTCAAAGGACTGACTGTTGTCCCTGC
AGTTATATGTTTTAATCTCCCTGCATGGATTGTTCAGCTAATCTTTTTAAAGCAACCGTG
GATCTCCTTGAGGAGGCCTTGTCGTATATTATATTAGTGCAATCTGTAAACTATCATTTG
TAAACAGTATCATCAGGAGTACCCCCATCTCTAGGGAAAACTTTTCCAATAGAAGTGTCC
ATGGCATGTTCTATTAAAATGGAGTATTTGGGGAAGAACATGTCTTTCTATTTTACATGT
CTCATTTGATTGAGTGTCATTGAACAAAATATATGTTGTCAATGTATTTTCTTATTCTTA
GATTTTATTGGTGCTTTGTATATATGTCAGTCTCCCCATTTACTTTTTCCTTGTAACATA
GGAAGAATGGTAAGCAGAATCAGTCAGTACAGCAACTATACCTGAATATGCACAGGAATT
TTCTGCTATTGCATAGTACCTTCTTCATTCCTATGGGGGGGGATCATGCAAGGGAAAGTC
TATTGTTCACTTTGTATTTATTTTTTTGCATGTTGTCTCCCTTATTAGATTATATGCTCT
TTGAGAGCAGTGCCTGGACTATAGTAGGCACTTAATAAATGTTTTTAGAATGATCTGTAG
AGCTGAACTTTTTCTCAGAGGACATCTAGTCTGACTTCCTCATTTTATTAGATGAAGACC
CTGGGACCCAGGATATATAGCATAAATAGGAAATAATTAACAGAGGGATTGAGGAAGACT
TCTTGTAGAAGATGTTTAACTAGTTGGGTCTGAGAGCAAGCCAGGGAACTCTGTAGGCAG
AGTTGAGGAGGGAGGGCATTACAAGTATGAGAGAGAGCCAGGGTGAATACCCAAAGCTAA
AAGTCAATCTGTCTAATTCATGGAACAGCCGGGAGGCCAGTGTCACTGTATCTAAGTGCA
TGTTAAGAGAGGTAAGTTGTAAAAAGACCAGAAAGAGAAGGCTAGCTAATGAAGGGGGTT
TGAATGTCAAACATCATTTGATGTTTCCTCCTAGAAGCAGAAGGAAGCCATTAGACTTTA
CCGAGTAGTTTTTTGAATCCATGATATCTTGTAAGATTTCATGAAAGTAGTGCATTGAGC
CTCAGGGAGGTTAAAGGGGCTTGCCAGTGGTCACTACACAGCTAGGAAGAACTTGTCCCA
AGACTTAAAGCCAGGTCTTGTGATTCTACATCCAGTGCACTTTTTCATAATTAATAAGGA
AATATATTCCTTAATGTTTTCTAAAGAAAACTATTTGTCCAGAAGAAATATATTTCCTCT
TAAAGCTTTCTCATTTTCCATATGTTGCAATACAGTAAGTGGTCTTGCCCCCATTTATTT
TTTATCAGTAAGGGCTCCTTGAAGGTTTTTCTTTCTAGATTAAAGGATCCTTTACCCTCT
GGCTTTTGCATCTTTATCTTCTTTCTTATTTATATTACTGGGTATTTTTCTGTCCTTTAC
TCATAGAAAGTACTTCAAACAAGAAAGGATACCTTAATCAGAAATACAGTGTTAAGGATT
CCAGTATATGCTGTTATTCCATTATTGAATGAGGTAAGAGAATCTTTCTTAGACATGATT
TGTTTTTTCTATAGTCTGACTCTTTTAGAATATAATCTTACCCAATTAAGTTTGAACTTG
GTAGAGTGGGCTTACTTGTGTACCTTTTACAGGTGAGGAATCTGACAAAACAATTGTGAT
TTGTACAGTTACACTATTTTAGTAAGTGGCAGGGCTAACCTTCAAACTTAGCTAGTTTTG
CTGATTAATAATAGGTCAAGGCTTTGAACTCTGCTCAGAGTTAAACTAAGGGTGAATGAA
CTCTGCTTTGCTAGTCTGCTTGGTATAAGATCTAAGATGTAAGACTGTACATTTGGCTAC
TTTATTAGCAGAAATGTCAACTTTGAAACTTTAGGACATATAAGTACATAATAAATAATT
GCCAAAGTCAATTGCCAGAGGATTGTTATAAGTAGGTAGCCATATATAATACAGGCCTTA
ATTGAAAAGAAATCATTTTGTTGTTGCTTCCCTTTCTGCATCAAATCTTTTTTTTTTTTT
TAACTTAAGCATTTTAATTGAATGATACATTTCGAGCTTAGAAGGTTAGGTTTGTCGGGT
AGGAGTTAGAACTGAAGAATATTAATTCACATCTTACAGTAGCTTCAAACTTCAGAATTA
GTAGTACTACTAAATAATGCAGTTATTAACGATACTTTTAAAAATCAGCATTTTTCAAAT
GGCTTTTGAGGGTGTATCAGTGTCTTGATGTAAATAAACCGTTATTAAGTTTTGCTGAGA
TTAGTGAAATAGTTTTCTTAGGGAAAGCTTTGAATGTGGCTTTAGGAAAGAAATTTTCTA
TGTAGTACCTTTTTTAGGAAACAAGGTAGTGAGGGAATTTGAATTAGTGTAGTTTTTAAA
AAAAATGCATTCTATTGATGCTTTTTTGTTTTGACAGTTATTTCCTACCCATCTCCCTCC
AAAAGAAACCCTTGGAGATTTGTATATCAAAGGTTTAATCTTAAATGTGTGGGTGGGAGT
GTGTGTATATATATACACACATATATATACATATACACACATATATATCTCCTATGATAT
ATCCTACAAGTTAAAAATTACCATTATAGACAAATGACTACTGAAGTTAAAATTTTTCTA
GTGTAGAAAAGGCTTTAGTGTGTGTGTGTGTGTTTTTTTTTCTTGGATTTATTCTTGGCA
TAGGTGCTTTTGGGAATTGTAGTGGTAGTTGTGTGTTAAATATTGTTTTGTTTTGCTTTC
CAGCTCACTAAGAGGTTGCAGGGACACCCAAATAGGTAAGATATCTGCTTTATCTTTCTG
CCTAGAATTTGTTGTTGCTTTGTATACTTTTATGAGACTACCACAGGATTTTTTTAGCAC
AAATTTGAGACTGCGCCAGGTTATCTTTAGTCTTTGAAAATTGTGTCCCTTATGGTACTT
AGGTGGATACACTGAGAAGGAAGATGAGATGCCTTGAAAAAAAGTGCCCCTGTCAGCACA
ATGAGTGGCTACTTTGAGAAATTATGAAACCATGATTTTGACCTGCCTCTTCCCTTCTAC
TCCCTTTCCTGTAGATATGCCAACAGAATAAAATCAGAGAGAACAATTTTTCTCAAATAA
CCTTATTTTAAATGATTGCGATTAGCTTTGGGCAAGATCAGCTCTTGTCAGTTGATTTTT
GTACTATTTGCTGTGAAGGTATTAACTGCAAGATTTTTAAAAAATATATTTTTTTGGTAT
TGGGTATTTCCCTCAGTGGTTTAGATTGCAACTCATTCGTCCCTTAATCATAGCCAATCT
ACTTAACATGTTGGAGGCTTTCTTGACATTGCAGTGTATACCAGGACATCACTTTGGTTT
TCCTTATATTTATCATTAACTTTTTTTTTTTAACTATTACCTTGTGTCTTAGAGTTGATA
ATAAGTATTGGTCCCACAGCAGAAGAGTGGTAAGGGTTAAGTAACTTGTTCAGGGTCACA
CCGCTAGAAAGTGCCTGAGGCCAGATGTGAACCCAACATCTCCTAACTGCAGGTTTGCCT
CTGTCCACTGTGATATCCAGCTGCTATTGCTGATTTAGTACATGGCCAGTCCACCTCCTT
TTTTGGTCATTCATTTTATTTTATTTTTTTGCCACTCTATTTTTTTGCCACTCATTTTCT
TAAGTGGGTCTGGCATATATGCTTCCATTTCCCTTTGGGTAACCTATTCTGTTATTCATT
AAGCCACAGAACTATGCAGAGGCTTATGAATCATATCCCAAATCATTGAAGGGGTTGAAG
TTTAGCTAGAGCAAGTGCTTAGGATACCTAGCAAATAGTAGGTACTTAATAAATACTTAT
TCTCCTAATTAATAAATACTTAATAAATACTTATTCTCCTAATTAAGTATGCAGCTGCAT
AACTCATGAAAAGAATAGACATTTGACTTGCTTAATTTTACCAAACATTGCTTAATGCTT
TGGATACAAAGAACGACCCCCAGATATCCCTCCAAAGTCATTTCCTTTCCTCAAGAAGCA
TAATCTAATGGTGGAGACATATAAATAGTTATACACAAAATATCTAAAAGTAGAGACATC
AGAAGTTGGGGCGATTGGGAAAAGGCTTCTGAAGAAGGGGAGCTTTGACTCAGTCTTAAA
CCAGAGAAAACTAAAAATCATAATTAAGTAGGAAGATCCTTTTAGGTAATGGCAGAGAGG
TAAGATATGAATTATATCCTTGAAGAACATATAGTCCATCTACCTTTTTGCAACATTTTT
CATTTATATACCTTTTACACAGCCACCATCATCTTAGCTTTGACTTATCAATTCTTGCCT
GGACTATGACAGTCATATTTTAACTTGTCTCTTTTCCTCAAACTGATCCACATTCCAATT
TTTCTCCATTCAGCTTCCAAAGTGATTTTTCCAAGTATAGGTCTGACCAGTTATCCACAG
TTCACAAATATAGTCTTCATTCTCAAAACCTGTTCCCTTCACATGTACTGACCTACTTGC
TGTGCCTTGAGCATGGTGCTTCATTATTATGTCTTATCTAGATTATTGTTAATTGCCTCT
TGAATGATTTCCTTGTCTATGATCTCTCACTTCTCCAAACCATTTTTAACATGGGCTGCC
AAAATAATTGTCTTTATGCCTAAGTGTGAATATGTACCTTTTTTATTCCAAATTACATAT
TACGGTAGAATACAGATTGCTTAAATTTAAGAATGACAATATAGCTACAGCCTACCTTTC
CAGCCTTATTACCCATTACTCCCTTCCATTCACTCAAGTTTTTAAGCAAATTGGATTGCT
AGTTGTTCCCATCCTGCCAGACCTCATGATTAGAATGTTCTTCCTCTCTAGGTTTTTTCC
CTTTCAGAATCTTTAGGGCTCAGCTCATAAGCTGCTTGGTATTAATTTTCTTTCTCCAAA
TTAATCAAGTATTCTCACACCTCATATTTTTATAGAGTACTTTGGATCTCTCCCGACCCA
GGTCATAGTTCACCTTGGGGCTCTATGTTATATCCTCTATAAATATTTCTTGAGGCTGGG
GTTGTCATTCCATTTTTTGTGTGTGTGTTCTTAAGGCAATGATGGCAAACCTTTTAGATG
GTGTGCTGGGCCCCACCTCCACCCCACCCCTAGACCAAGTGCTCATTCATTTCACCACAC
CTTGTCCCCAACCCAACCCAAACACCCCTCCCCTCCCCCCTGACAAAGGAAGTAAAAAGC
ATTCCCATTAGGCTGTTGGGCAGAGGGGCAGATGAAGTGAGGATTATCCTCAGACATGTG
TAATAATGAAAATTACGAAACTGCTAGTAGCTTTATAACTTTATTAAATCTAAGTAGTAG
AAATAAAGAGAGAAAAAAATAGGAAAGAGGTAGAGAGTTAGTTACTTAGCTTTCTACTTT
ATTGGCTGTCATGATGGGCCTGTGGCTAACTTTGACAATAGTTCTTCCAGCTCACGCTCC
AGCAAGAAAACCCCAAGACCTCCTGGTCTTCCACTTATATGCCCTTTTCTCCACCCACTA
GTTCTCACATGTCACAGCTCAGGAACCAACCATAGTTTCTTAATTTGCCTGGGCCACTGG
GGTGGAGGGGGGTGAAGTGCCTGTGAAATCAATTTTCTGTCTTGTTGTTTCCTTGGTTCT
TTAACTTCCTTTCTCTGAGGTCTTATCTATACCTGAATAACTCAGTGGTCTTTGACCTCC
ATGGCATTGATAGATGACCTTAAAGAGACATAATGGAGAGAAATTCTCTTCCAAAACATG
GGGCGTGGCTCAGACCTGGCTTTCTAGTAAGACCTCTGCAGGCTGCCCACAGAAAGGGCT
CTGTATGCCCTTGTTTGCATATGTGCCATAGGTTCACCATCATAGTCCTGGGTTATTTTA
CATAGTGTAATTAAATAAATGTTGGGAATTTTAGTTTTGAATTCTACCATATTGTTACAT
ATAATTTTTATTGTCATACAAGTGATATCATTCATATCATGCCTTCTATATGAGCCATAC
CCTAGCTGATTATGTCTGTTAATACTAATGCAAGGAAATGGTTACTCTGTCTGCTTGTTG
AGTTAAGGCACCAAGTTTCTTGATTCCTTTTTCTTTTTCTTGAACTTTTGAAGTAATTGC
ATGCATATACACATACATAAACATGTGCCTTTCAAGCTCTTAAGGCTATGCCATATGACC
ATAGCTGTATGGTAATAATAATGATTTAAATTTTCCTTTTATGGATACTATTCCTACGTT
GTGAAAGAGGCTCTTTGTCTTTGCTATTTTGGTCATATTTACACCAGATTAACTGACTTC
CTATTCCCCCATTAAAAGCCTATTAAGTTCTTTGTATTAATAAAGAGGATTGAATCTCTT
GTTGATAATAATTGCCCCTTGATTTCTATATACCTCAATAGATCTTGCAACTGTCCTGTG
ACTTAGGTGCTATTGTGATCCCTATTTTAAAGACTGGGAAACTGAGATAGGTTAAATGAT
CTTGCTCAGCATCACTTAGATAGTGAGTATCTAAGACATTTGAATTTGGATATTCCTGTG
ACCAAGTCTTTGTGCCTCCTTACTGTCCCAGCAGAGGACAGTGCAGTAGAATTAAGATGG
GAAAAAGAACAATTTTTTGCCTTAGCATTATTCTCTAGATAGTAAACAATATAATTTCTT
CATCTTCAGTTTTGAATTTCCAAGGGAAGTAATATGATATGTCCCCGTATTTACCAGTAT
AGTGTAAAACTCAAGATAAACCCCCTAGTGAATGGTGGAAGAAAATTGGAAACTGTAGAA
CTGCCATGAGTCTTAATGTTATAATTTACCTTCAGAGAACAGGTGCTATAATTTAGTTTT
TTTACATAGTTGCTACTACTGACTTTAATTTTTTTTAAACCAAATTAATGATAAAATTAT
TTTGCACATTGATTTAAAATTTTTTTTTCTTTCTAGTGCTGTACTTATGGTTCCATGGTT
AAAATCTGTATTGACCATACATGCATCTTATCTGTCCACAGTAAGTATCTTCAACAGTAA
TAGCCAAACATTTCATATTACCCTGTGGGGAGGGACAGGCAGTGTCCCTGCCCTGTCAAA
GTTTAATAAAAGATTTGGCTTAAATATTCCCATAACCTCCAACCCTCCTCCCTTCTTATT
GCCCCCTAAATCTATCCTTGAACTATGTTTCTTAGAGATTCTCAATTATAGTTCAGTGGC
ACTGAAGCGCGCGCTCCCTCCCCCCCCATCGCTACTTTAGTACAGTATTTTGTATGAGAA
TGGTCTGTGTCTCATTTATTGTTTCAAGTCCTTATTAGTTTTATTAAGAGTCAGTACAGT
GCAGTGTGTAAGGGGAGCTCTTAGGAAATGGAAAATGAGGGGGGTCGGCTGGGTAGCTCA
GTGGATTGAGAGCCAGGCCTAGAGACAGGAGGTCCTGGGTTCAAATTTGACCTCAGCCAC
TTCCTAGCTGTGTGACCCTGGGCAGGTCACATGACCCATATTACCTAGCCCTTACCATTC
TTCTGCCTTGGAGCCGATGCACAGTACTGATTCCAAGATGAAAGGTAAGAGTTTAAAAAA
AAAAAACTGGAAAATGAGCCCAGGGACTAGAGAAGATGGTTACAGATAGTCTCCGCTGGG
AATCTGGGTCCTACCCAGGGCATTCTAAAAGCCACCAAAGCAAGTTTGTCCTCAGTGTGT
TTCATGGTAAAGGCAACCCAGTTTTATTCCTCTGAATTATCTTCTTGACCATCTACTTTT
GCCTCAAATTCTTGTAAGGCAGGACAAAAGATGTACACCAAAGCAGAAATAACTATAGAA
ATCTTGATTGTGTGAATGGAGGAGTAAGATGAGGGGGAAATGATCCTTGTATACTGACGG
AAATAATTTAGGTTTGACTTTGGATTTGGTGTTCTGTTCCTAACCAAGTAGGTTAGAAAT
AACACTGGGAAGGGAGTGATTTGGATGTACCATTTCCTTGAGGTAGCCCACATTTTTATA
TGTGTGTAAAACTTTTTCAGCAGCAAGCTGGGTACATTGGTTAAATTTCTTTGGAGTGGG
TGAAGAAACAAAGCATTATTTATGAGGGATAGAAATTTTGACCAAATCAAAAGTTTAATC
CTTTACTTTTTAAAATTAGATTAAAAATTTTATTACCATGTTATTTAGAAATCTGAAGCC
ATTTTATTAAAGAAAATAAAAATGTGTGTTGTTATTAATAATTATAATGCTTAACTTTAT
ATGATGCCAATTATGTGCCAGGCACTGTGCTAAGTACTTTATAGTTATTATTTCATTTGT
TCTCATAACAAACCTAGGAGATAGATACTATTATTTTCCTCATTTTATAGAAGCAGAGAT
TAAGTGACTTGCCCAAGGGCCACACAGCTAGTTAGTGTCCAAAGCCAGATTTGATCTTGA
ATCTTCCTAATTCTAGGTCTAGTTCTGTATTCACTTAACCACTTGGTTGCCATGCATGAT
CAGTTTGCCCCTAAAATTGCTATTGTTTTTTTAAAACTTTTTACACTTTTCCTTTTTTTG
ACCTCAATAAATAAGCTCAACAGACATTTACCACTATGTATTTGGGAGAATTTGAATATA
ATGAATGTCTGTAATATAATTTTGTTAGCTATTATATACCCTTTGTTTTCACTGTTGTTC
TGTTTTAACATGCCAGGACAGAGAAGAACTAAAAGTATTATGGGGAAAGTTCTTCATTCT
TGGTAGTGGGAAGGTAGATGGTAGTGGAAAAGAATAGGTTATAGTCTTAGTTCTTAGTAT
ATATTAGCACCTGAGCAATCCTCGTCTCATTCACTAAGCACATGCACACACACATAATGT
AGTATTTTAATATTTGGAAGTTTTTTATATACCTTCTTTGATCATTACAACTCTTTACAA
TAGGTCCTTACAGGTAATGTCCCCATTTCATAGATGAGAACTTTTAAAAAATTGTATTCA
GCTTTGCTAAAAAGAAACCAGTACTTTGTGTCATATGAAACTTTTATGTCAATGTTAGTT
AAAAAATTACTACTTCTCAAAAGTTTAATTTTGTTTTCCCCTAGGGAAGTGGTTTATGTG
AACTTGAACCTGTACCTCCTTACCCTTAACTTAACTTAATTGATTCTAAATCACCCTTTG
TTTCTTGAATATAAGCCTTTTAAGGGTAGGGATCACATTTGAAACATATGACACACTGGG
GATTTGTATCAGGGAATGCTGCTCTGTGTTTGTTCAATAGTGAACTTGACCCACATTCTG
CTTAAAATGGGGAAAGGAAGACTGGGAAATGGCATGAGGTGTATTTTTTTTTCTTAAATA
TTTTGTTGCATGCTCCCGAACCCCCAATCCCCTTTCCCCCACTAAAGTAGTTCTGTGAGA
GAACTGCTTAAAGGAAATTTTGTGTTAACTGAGATTTCCTTTGCTTCTATTTGCTTGACA
TAATATGAGACAAGTGCTTCTTGATTATTTTTCCTGTAGTTGCCTGACCTGGTACCCCAA
CTAGGCATGTTATACCAGTTAATGGAGAGTAGAGTCAAAACCTTAAGGAAGCTCTCTCGA
CTTCATGGAAAACTAATTCTTCTCATTACACAGGTATGTTCATTATCAAATCCGTGATGA
AAGGTTTTGGATATGATAGTAATGGAAGTGTAAGAACATATTCATCTGGTCCTATAGTAA
ATTCCTACTTTATTTTAGTGAGAAAGATAACAGGTCAATTTGGAATATATAGTAGAAGAA
AGATTCTGACTTAATTGTCCAGAAATGCCCTGCTTGTCAGAATTAACATACTGTTTTTAG
GATTTTGTGTGAAAAACAGAATTTCTGAAGGTGCTTACTTAGACTTTGAGAATTTAAATG
AAGGCTGTTATATTTTGTCCTAGTTGCTATAAATTTTATGAAGTTTTTTAAATTTTTTTA
AATGTTTGAGTGTATTCCTGGGCTCAGAAGTGTCCTTGGGTCTATTCATGGTATATGTGT
AATTCAGACTCTGTTAAGGGAAAGCAGACAGACCCCATGTTGTTAATGCTTATTACCCAG
TTTAGCCCCATTAGCTCTCAAAAGTTATCTGACATTCTAAAAGGGTTGTATAATCTTTTG
TGGTTGGTGGAATTACTGTGCACTGAACAGAAATCACAGATGGTTGAAATTTTGGAAATA
TATTTGATCCTTTACTCTATTTCTTGGTGTAGTTTTTTTGTTTGATGGGTAAAGTGCGGG
GGGGGGGGGAAGACCCCGCTATTTACTGACTTTTATGTTAAATGTTTCATCTTTTAGGTG
GCAGCATCTGAAAAAACTCAGGGTGTGCCTCAACCTGAACAAACAGCCAAATTGGTTTAT
GAGGAAGGTAAGGAGTAGGGGCTAGAAAGAATTGTGTCTTTACAGACCATAGATCTAGAC
TCGGCTTTGAATGCTTGCATTTTATAAGTTTAATGCAATTTTTAATAAAGTATGTTTAGG
TCTTTGGTTCTTCAGTTGCATCATTTTCAGCAAGAATTTAGGCTTGGGCAGGAAGTATCT
AATAAAAAGTGGACAATGTGTCATAGTGGATACAGTGTCAGCTTTAGGATCATGTAGACC
AGGACTCAAGACCCACCTATGTTACAAAGTAGCTGTATAACCCTGAGCAAGATACTTAAC
CACTTAATATTCTGGGTAATATTCTCAGCCTATTTTACAGAAGAGCTCCATTTTGATACA
GTCAATCAGCAAGTATTTTTTAAGACTCTTACTGTTTTCCAGGCATTGTATAGTCACAAA
GAATTCCTCCATTCTTCCAAAAGGGAATATTGGACAGGCAAAAACCAACCCCTCTCCCTA
AGGTGTTTGCCTTCTTCTGGAGGAGAATAGATTTCCTTACTAGTAATTTCCTTTACTATT
GAGAACTTAGCTTTAGAGTCAGGAAGGCCTCTGACACACATACTTGACCCTGGCCAGGTC
AGTCCTTCCCAATGCCCCAAGTAATTAATTTCCCAAGCTGCAGAGAAAGTGCTAGTCTGC
ACTGAAGGAGTTTCCTTATCGTGAATTAACAGGTCTGGTCAGAAAATAGTTTGACTCACG
TAATTGTTAAATAAGCTTTTCATGAAATTAAACATGAGGTTCTACATTATATTATTTTTT
AGATGTTTTGGGAATTAAGTAAAGATTTTGTTTTATAGAGTCTTCTGAAGAGGAGTCTGA
TGATGAAGTAATGGCAGATAAAAATTCTGATGTAAGTAACTTTTCCTGCCACCATGACCT
TTAGCCTTCTCTTGTGGATACCTTACAGATAGTCTTTATGAATTCCTCTGCTTATTAATT
TATCAGGAGAATTGGGAGGAGGATGAAGAGAGAGAAAGTGAAAAGGATGAAGATGATGAT
GATGAAGATGACGATGATGATGATGAGCAAGAAATAGATCAGGACACAGAAAATGGTGAG
GACAAAGAAATGGCTCTTGAAAAGGAAATAAATGGAGATTCTGATTTGGACCCAGAAAAT
GAAAGTGAAGAAGAATGAAGAAGAAAGGAAAAATAGGCCAATAGAACTATAAACTTTGGC
TCATATTGTTGAATGCTGCCATGTTCTCCTGGAGAGGGTGATTTCTGTGTTTGACCTTTG
ACAGGTAGAATGCAGACAGCCTCCCACCTTTCCAAATTCAGAATGGTGGCCTCATCAAGC
CAGTCCCTTTGTCCTTCCCACCTCAAACTTAACTGTGTAAATAAGAATGTTTCTTTCAAT
TGTTAATAAACTTTACACAGTAAATAGACACATTTTTTGCAACATACTGACACGATTGTC
CTACATATCTTATATTTTTATAATATAATAAAGTCCTGGAATGATTGGTTATATCAAGAA
TTGAGTTAAATGAAGATGAGGACCCCATCCCATCCCATCCCATCCCCCTACCAAAACCAC
AATCCAACCTATTCTTTGGAGGAATCCACTCTTACTGTAGTTTGGTATGTTTAATCTGGT
CCAAGTGTGATCTTGCCCTAAGTAAAATTGGTAAGGAGGTATGAGCATGAGTCAAAATTT
CCCTTGTGTACAAAATGAGACATGACAAAATGAAGGCGTAAGTGTCATCGCAGGTTTTAG
GAAAAACTTTAATCTCAAGGATAATTTTCGCCAAAGTAATTTGAACCAGGCAGGCTCATT
TGCTGGATTTATCTCCTCCCCCCCCTCCCCCCCCACACACACACAAACACACACTCCACC
ACTACCACCCCTGTTCCCCACCCTACTCCCAAAACACAGAAAATCTGCTAATATTTTTTC
TAGAGATTCAAGGAATTTTAAAAGAAAAACAATTATGGTGGTTCAAAAACCAAAATAACC
AACAACCCCCTAACCAAATGAATGGTTCTGTGTGACTAGAACACAACCAGGAATCCATCC
AACTGCCTGCAATGTTCTTTGGTAGTCATCTACAGTCACTGCTGAGGTCATGAATTCACT
TCAGCTTTCCACTATCAATTAAATTTTTTAGAACAGACCAATTTCTATTTCCTTTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1288, 11580..11717, 14322..14443, 18242..18362, 19547..19686, 22839..22941, 25286..25350, 28862..29033, 32528..32611, 35468..35596, 37202..37339, 39306..39392, 40623..40654, 44796..44859, 47319..47432, 48117..48186, 48998..49050, 49146..49176, 49231..49337
1001..1288, 11580..11717, 14322..14443, 18242..18362, 19547..19686, 22839..22941, 25286..25350, 28862..29033, 32528..32611, 35468..35596, 37202..37339, 39306..39392, 40623..40654, 44796..44859, 47319..47432, 48117..48186, 48998..49050, 49146..49176, 49231..49334
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved