Monodelphis_domestica Locus ENSMODG00000012754
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000012754
Monodelphis_domestica
ENSMODG00000012754
1
SNORD24, SNORD24, SNORD36, SNORD36
1348..1423, 1829..1901, 2163..2240, 2636..2713
4653
GCCTGTTTTGTGTTTAGCTAGTGGCAAACTAGAAGTATCTGGGTAGCCCTTGGCCTGGA
ATCTGATCAGGAAAATCCGAGTTCAAATTCGGCCTCGTGTGACTGCACAAGCTACTTATT
TAACCGACTTGCCTCGCTCCTCGACTGTTTCTTGGAATCTAAAATGTCGGTTCCAAAGCA
GAAGAGTGGTTGTTAGGGTCAGTCAATTAGGGTTAAGTGACTTGCCCAGGGTTACACAAA
TAAGTGTCTGAGGTCAAATTTGAACCCAGGATCTGGGTCTTGAGGCCTGGTTCTCTGTCC
ACTGAACCTACTTAGCTACCTCCTCATTCCTCGGCTGTTATAAAAAAAAGAAAATCCGGA
GAGGGTAGATAGCAAGAGCCTTGAAGGGTGATTGAGGATCAAATGAGATATTTGTAAAGC
TCTTAGCCCAGTTCCTGATCTATAATACCAGCCCTGTAAATGCTTTATTCAGTTTATCTT
CACAGTGGTATAGCCAACTCAAATTGATTTATTAAGCACCAAGCTTTGGATGAACCACAA
TATTTGTTCATTTATTTCCTGGTAGAGGTGTCAGCAAATTGCTTGAAACTTTGCAAAGGA
AAAAAACCTTCAGCATCTAGAGATTAAAACCTTGATTCTACAAAATGTGTCATAATACAG
ATTCTCACCCTAACTCCCACCCATCCCCAGTCTGGTACATCAGGGGCAGTTTATCTTTTT
ATTAGTATTAGGTATTTAATCCCACGCATGCCTGAGCTCAAATTTGTTCCGCATCCGTAA
TGGCCAAAAGGGAGAAAATAAGATCCTGGACCTAGAGTTAGAAGAGATCTCCAAAGCCAT
CTCTTCCAACTTTCTTTTACAAATGAAGAAATTAGGCGTAGGTAGGTTTTTTATTTTTAA
CTAGAGAAGTAAATTACATTTAACTCTTTATCTTCTGACTAGAGTCAAGGCTATGTGGGA
AAGGGGTACATCTGAAAGTAGATGGTTACTAGCAGACTTTACTTTTTTTAAAGCCCAAAG
GGAAGAAGGCCAAGGGGAAGAAGGTGGCCCCGGCCCCTGCCGTTGTAAAAAAGCAGGAGG
CCAAGAAAGTGGTCAATCCTTTGTTTGAAAAGCGGCCCAAGAATTTTGGCATTGGTGAGT
AAATGGTGGCAGTTGGGAATGTGGGTGGACTGGAAAGTTGTATATAAAATGTGCTAAAGC
ATTAATTAACTGGGTGACCAAATTCATTTGAATGACCTATAAATATTGGGAGTTAAAAGA
AGAACATAGCCTGGGAATTTGCTTTGTTTACAAGGCAGGGGGACAGGAGTGGATGCTAAT
TTTGGGATCCACCAAGAGTTAACCATTGTGCAAATGATGGAAAAGAATATTTGCTATCTT
GAATGATGGTGATGAATTTCATAACCACCAAGATCACTGATGCACTTCTGGTTTAAGACA
ATCTGGGTTAGAATTGCAAGCTTAATGAAATTTCCCTCATTAGGTCAGGATATCCAGCCC
AAAAGGGACCTCACCCGTTTTGTCAAATGGCCTCGATACATTAGACTGCAGCGTCAAAGG
TCTATCCTTTATAAACGATTGAAAGTGCCACCAGCAATCAACCAGTTTACCCAGGCTTTG
GACCGTCAGACAGGTAGGTAAAGGGAAATCCCAGACTAGGTCTTAAATCAATTTTAAATA
TTTTTAACATTTGTAACACACTTTGTGCCTAAAACTTGAGTTTTACTCATGGGAAGGCAT
GGTTTTATATAGCTGTGAAGTTCTTGGGGTTAATGAGTTTTATGCTCATCCTAAGTACCC
ATTAATTTCTGGCATAAATGGAGAATATGTGCAGATGATGATTACGATATTTGCTATCTG
AGTTGCAATGATTACATATGTACCACCGAGATCGCTGATGCACAGATTTAAGAAAACATT
CCGGTAATTTTTATTTTAAAACAAAACTTAACCAGCAAACTTGTCCCTTCCAGCTACTCA
GCTGCTTAAACTGGCTCACAAGTACAGACCTGAGACAAAGCAAGAAAAGAAGCAAAGGTT
GCTGGCTCGGGCTGAACAAAAAGCTGCAGGCAAGGGGGATGCTCCCACTAAGAGACCACC
TGTCCTCAGAGCAGGTAAATTAGTTTCTGGTCTAAAACTGGTTGTTTGAATTTGGACAAG
CTATTGCAATGATGTATGAATTTCTTCACCTGAAATAACTTGTGTAGAACAAATACACGA
GCTTTTTAACCCTGAGGCATAGCTGAAGATCCAGTTTACTGGTTATTCGACCAAAGTAGG
TAAGAACTAGAAAGTAACATAGCAGTACTGAATAGTCCATGTAAACATTGTTTTTGTTGT
TGGGGTTTTTTAGGTGTTAACACTGTTACTACCCTGGTAGAAAACAAGAAAGCACAGTTG
GTAGTGATTGCACATGATGTGGACCCCATTGAGGTAAGTTCTCAATTTCATACATTCTTT
TATGTAGGGAAATTGCAAAAGGGGTAGGGATGTAGTGTTCTTATATCAGGACTGAGAATG
AAATATGCTATTTTTTTTTTTAGTGTCATGAATCACATTAATATGACACACAAGTTGTTT
AACTCCCTGAGATGTTTTTAAGGGATTAAGATCCTATAGCAGTGAGCTCTTGGCTTTTGC
AATGATGTGTGAATTTCTTCACCTGAATTAATAGCATGAAGAATAAATACACGAGCTTTT
TAACCCTGAGCAAAGGCCAAAGACAATGTTTTTCTTTGCATGATAAGTATGCTAGACTTA
ACTATCTATATCTTCCAGCTTGTGGTTTTCCTACCTGCCTTGTGCCGAAAAATGGGAGTT
CCTTACTGTATTATCAAAGGTAAAGCCAGACTGGGTCGATTGGTTCACAGAAAGACTTGC
ACAAGCATTGCCTTCACACAAGTTAACCCGTGAGTATATTTTGTTACTCTTTAGTGCAAC
TATATTTAAATTCCAAAGGATTTGAGGAAAGGGAGCTTAAATTTATTTGCTCTACCCTAA
AAGAGGAGTTGTAATGGACTATTTATAAATGTGATTGCAATATAGCTTAGCCATGTATTT
TACTTTTGAGAAGTTACTCAGGAATTTTCCCAGGGTGCCCTATTCTGAACCTTTTGACAA
TGATGTGTACAGAATTTCTTCACCTGACAAGACATGTAGTAATATTAGACCCTGAGACAA
AAGGTTCTATGTCGAAAAGTGGTAGACAAGAGAAGATAAGTGAAAGGGTTTGGTAGTATT
AACTTTTTCTTCTGATCATTTTCTACAGGGAAGATAAGGGAGCCCTGGCTAAGCTGGTAG
AGGCCATCAAAACTAATTACAATGACAGATATGATGAGGTAAGAACTAATTCAGTTAGAG
GTTGAATATAGATCTGATTTTCTACCACCAAACTAATTTAATTAAATGGCTTGCAATATT
CCTTAATATACAGTGCTCATCTTTGATTATAAATAGGGAAAGTGATGGACTTGGAAATTC
TTTCAAAGGGCTGGGAATGTGTTACATAATGTAGATAAATGCTAACTATTTTTTTCTCTG
TCTTTTCAGATCCGTCGCCACTGGGGTGGCAATGTTCTGGGTCCAAAATCAGTGGCTCGT
ATTGCCAAGCTGGAAAAGGCAAAAGCTAAGGAACTTGCAACTAAATTGGGTTAAATTATG
TTTGATTTTTCCCTACATAAAAATAAAAAATTTAAACAAAATGGAAGTGGGAGTGATTAT
AAAATACTAGAATTGAAGCTACTATATAATTACTAGTCTTAAACACTGGATAAAAGTGTA
GTACCTGGCGTTCAAGGAATGTTCTGATAAGAGAAGACATGTATGTACATAGAAAATTTA
ACAGTAATTTAGGGAGAGCCCTAGCAAATAGGGAACACAATTTGTTGGTGTCAACTAGCA
TTTTTTACACTCTTGCTTTCTATCAACCAATCTATTGAGACACAAAGCTGCCCCCTCAAT
TAGCAATTCTAAATTAAGTTGTGTTAATTATTGATGCAAAATGCCATGCCTCTCCCCCCC
CCCAATTCCCTGGGATTCTGAACTTAGTCTAATGGAGAACCAGTTCTAAAGATTGTACAT
GAATTGGGTCTGGAGAGAGAAGTGGATTAGGTGGGCAAGATAAAGCATTCTGTGTGGAAG
CCCTAATAGGCCATGGACCAGAACTTTGAAGAGGCAATAGTGATAACATACTGGGAAGAG
GAAGAGTTAGACTGAAGATCTTATTTAGTAATCAGCCATTGAAAGTGGTGAGAATGAGTT
GCTTTCATACCTGCCCTTAAGAAAAATCATCAGCTATGTGAAGAATGGATGGGAGTAGGA
AAGAGGTGAGGGATATCTGAGAACGTTGTAGATATTAAAAAAAAATAAAAGGGCAGCTGA
GGTAACAATTGTAATTTCCATTAGATATGGAGCCTTGATTTTTAATAGTTAAAAACTGAC
AGATCTTATTAAAAAATAGGCCACAGTATTCTCAACACTTTGTCCTGTGGTTATTTGCCA
CATTTTCCCTTTACTGCTGTCTCCTAGGGTAGTCGAACAAATTTCTTAAACCACATGTAT
GATGTTGCTGCAGATAATCCATACCTGAGGGGGAAAGTAAATAATTAATCCTTGGAAATT
ACAGAGAACAACATTTAAATTTTGTAAATGATCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 1483..1632, 1973..2113, 2353..2432, 2778..2908, 3268..3337, 3549..3653
1001..1133, 1483..1632, 1973..2113, 2353..2432, 2778..2908, 3268..3337, 3549..3650
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved