Monodelphis_domestica Locus ENSMODG00000004571
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000004571
Monodelphis_domestica
ENSMODG00000004571
1
SNORA65
4812..4943
6847
AAATTCTTGTTCCTGTTCATTTATCCCAAAGATATACTTGAAAAGCCATGCTCCCTTGT
AGCAACAGGCTAGCCTGGGAGTATGCTTCCTAAAGGTGATGCGTCATAAGTATTCAGAAT
ATCAGAGCTCTATTGAAGGAACAGAGACTGTCTCATTTTGAAGATGAAGGGAAGTGATTT
GCCCAAGGTCAAACAATTAGTAGAGGTGAGATGAAAACTTTGGTTTCCTGACACCCAGGC
CATATCATCCAGGTCTTTTTACAGTATTAAGAAATAAAGATTAAAGTCCCAGAAAACCCA
TCCACACACCCCCCCCCCCCAAGCCCCCAAGCTAGGGGCTTACATCGGTTGACAGCCACA
CCTAATGACTACAGACAAGTGCAGTGATCGGGTAGGGAAGAGGAGAAAGGTCCACGATCT
GGGTCCCCTAACCCGCCACAGTCTTGCTAGCCCTGCCCATTAAAGAATTCTCGGGTGTGG
AGACAGAGCTAGACAGCGGGGTGTCTCTGTTAACTGGGGGAGAGGGAAGAACCTCAGAAT
TGAGTAGAAGAAACTAGTGGAGGGAGTGAGTGCGGAACCCATTCCTGAAGGGGCTCGGGG
TCCGGGAGTGGGGGAAGAGGGGGACAGAAACTACAGACACTAAAGCCTGCCCCCTCCCCC
CGCAAGTCCCCCTCCCAGTCAACCAAAAAGGGTAAAGGGGTGTAGCCGGAACCCCGATCT
TAGAACCTCCGCCCTATGGGGGAACGAGACTCCCAGATCGAAGCGAGGACTCCGGGGACG
TGGGGGAAAGCTCGGTCCCCGCCTCCCCACCCACCCCGCGAGATGCAGCAGCTAGAGCTC
ACCGCGATCGCCGGCTTCCCAGCCACCAGCTCCCGCCCACAAGAAACATGGCCGCCGGAG
CGTCGGCTGCAATACTACGACGGCTCTCGCGAGACTTGGATCTCCCTATATCCGGCGCTG
TTTGGGCCGCTTCCGGCCTCTTGGCTCCCAGCTCGTGGGTGGTGAAGGTGCAACTTCTTT
CGGTCGTCCCGAATCCGGGTTCATCCGACACCGAGCAGCCACCCCGCAGCCTTCAGGCCG
AGCCTCCACTTTCGTCGCAGCCATGCCGCCCAAGTTTGACCCTAATGAAATTAAAGTCGG
TGCGTCTCAGGGTCCGGGAGGGAATGGGAGAACAGGGGCCTACTTCTCTCGCCCAGCCTC
CCCCCAGCCTCCCGCCACGCCTGAGCCCCGCGCTCCTTGTGTTCCGGCCAGTTTCTGTCC
CTGGGCCCGGCGGGTTCCGAGCCGCTCTGCCTTTCTTCCCCATGTGACGCTCCAGGTCTG
TGGGATCCCAGCACTACCCCCTCCCCCAACCTCTTCTGTTTTCTTCTAACCTAACCTGAG
CCCCCGATTCTCCAAGGGTTTGTTGCCTTTTAAAAAACGGGGGTGGTGGATTGGTCTGGG
TTTGAAGCCACATTTGGAGTGAAGCAGATTGCTGGTGTGGGACCCTGGTGCGTCCTTCTC
GCTACTACCCCATTCATTTTAAGGTAAGGGTTTTTGAATCCCAGCGCGGACGCTGGATTT
CGAGCTAGAAGAGACTTTAGAACTTTATCTCCACCTTTTTTAAAAAAATGATAAAAGTTC
GGCATATTTTGGTAAGCACTGACATTACAACGAGGAGTAGGATGATCTTTATATATGTTT
TATTTTAAGACGTATTACTTATGTATATACATTATTTATAAGATAAAGAACTTTTTCTGA
AGAAAGTGCTTTGAAAATTTGCACGTTTTGCGTTATTTATAAGCCTATATTTAAGAGCTT
TTATAATGGCCGGCATTCTATCTTGAGTTCTCTGAAGCACACTGCATCAGGAACTCAAAA
ATGCTTTCTGACTTCCAAAAGTGGTGCAGGCCTAGTTTGTAGCATCATTGGGGTGTCTGG
AGTGTGCCTGAGCATTCATTGTTGTCGCCCATGTTATAAATGGAAGATTTTCTAGAATGT
AAAACCCACTAGAAACCATAAAGGATAACCAGTCCAGACCCTTGATTTTTACAGAGGAAA
AGGTTTAGAGTGAATAAGGAATTTGCTCATTCATAATGACATGGCTAGTGCCTAGAGCAA
AGCCCAATCAGATGTCCTATGCCCAGCATGTTTTACTGTATCAATGATGTATTGTATATT
CTCTACAAAGGCACTGCAGAAAATAAGATAGGATCTTGTCTATCACATCTATAAACTCAT
CATTTAAAAAAAAATTATTCGTTGTTTTTTCTCTAGTGTTTTTAAGGTGTACTGGTGGTG
AAGTTGGTGCCACATCTGCCCTGGCCCCCAAAATTGGTCCCTTGGGTTTGGTAAGTTAAT
GCAAAGATTTTTCCGAATTTGTTGATTAGGAGCCTTTTTAGTTGTGTCCAACTTTTCCTG
ACTCTGGGGCTTTATTAGCAAAAATACTGGAGTGGTTTTCTGTTTCCTAATTAGTTCTGC
TCAACTGAGGCAAACAGCATTAAATTTAAGTCACGTGGCTAGAGCCCATTTGAGCTCTGT
TCTTCCTGACTTAGACCTGGAGAATTAGCTACAGCACCACCTGTAGACTGCTCCTAATTT
TAGAGTCTTCAAAGCACATACATTTGTAAAATGACCAGTAACAAAATAATTACTGGGAAT
CTTCCTTTAAAAAAAATTTTTTTAAGCAATTTGGACTTGAATAATACAAACAACAACATA
AGTGATCTCTGATATTAATGGCTTAAAACGTGGAAGTAATGAAAAATGAGTAGGAAAATG
ACAATTTATGAAGGGGTAGATTACTTTTAAAAGCTTCCAGGAATTATGTCAATCTAACAG
CGATATATGTGAAAAATTGAGGGTGCTTTATGCAGCCTGAATTTGTGTTTTAGAACAAGT
GGTTAAGATTAAAAGTCCTAATAGATCCTCCAGACTTTTTTTTAACTATAGGCAGGCTGT
TTTGTGAGTGTTGTGAAGTAATATAATGACTCTTTTTTTTCCCTTTAGTCTCCAAAAAAG
GTTGGTGATGACATTGCCAAGGCAACTGGTGACTGGAAAGGGCTAAGGATCACAGTGAAA
CTTACCATTCAGAATAGACAGGCCCAGGTAATTTTCTTAATGTTGAAATTTGGACTTTTA
AGAAAGTATATGTATATAATAACGACTTCACAAATGAACTACAACCCCCTTGCAAAGGGA
AAAGCCCATTTTTGAAAGAAATGTATTGAAAGTCTTAAACTAGCTTCATTCTGACCACAT
TTAGATTTCTGTACTTAGAAGCAGAAATGGCTTTTCAAGTAATGCAAATATGAGAATACA
TGAACTCAGATAAAATGACCAGGATCCAGAATTTGATAGGCCAGATATTTGAAGAGCCCA
GGAAGATGAAATTTAGTGGGAGTAGATATAGTTAAATTTTACATGTTACATTTTACATCT
TTATTAGACATATTTTAGAAGTATAAAATAAGAGAAGCTAGACATGCCTCCAGTTATTAG
CCTAAGGAATAACTCAGAATTTTAGTCAACACTATGATATGGCTACCCTAAAAAAGTAAA
TGCCATCTTGTGGCTGCATACAAGACTATGGCATTGGTAGTTTTGCTTATCCTTCACTTA
ACTGGACTTATACTGATATGTTATGGTCATTTCTTCCTGTAACATCTTGGGAAAGATCTT
AGTGAGGTAACAGAGTTGTGTGCATCTCTGTAGGCTCCCCTTCAGTAAGATTCTTGTAGC
AAAATCTGTCTTCACCTGTATTGTCATAGAGGTCCTTGTTAGAGACTTATATTGTCTTGG
TTGGCTCTCAGGTTCCCTCCAGTTCTCAAACTGTCCTAATGAGGTAGGACAGCAAAGTAT
ATGGAAGAGAATTAGGAAATCTAAGTTTGGGTCCAGCTAGCTGAGGCAAATTGTTTTACC
ACTGGACTTCATTTAATAGAATTTTTATAATCTTAAAGCTCAAAAGAAATGTAAGGTGTG
GTTTATTGTTTAGAGGTAACAACTCAGTTAAACAGGAGGCATTGTGGAGTCTCAATTCAG
GCTTGTCCCCCGTATTTTATGGGCTAATAATAAGCTAATGACTGGTGTTGAGATGAAATG
ACATAGAACCATGCATTTGGGAAAATAACTGAATTTATTTGTCTCTTTAGATTGAGGTAG
TGCCTTCTGCCTCAGCCCTGATCATCAAAGCCCTAAAAGAACCACCTCGGGACAGAAAGA
AGCAGAAAAATAGTAAGTTGCTTTTCTTGAGAAAATTGAAGGTACTCACTATGAAGCTGT
GGGGTTTGGTTTTGCCTTCAGCCACCCGCCACTGCACCTGTTTCCAGTATCATGTTGGCT
GGTGCAATCCAGTGGTGAGCTGAGAGAAAAACCCAGCTTAGGAAACAGGGTTATTCTGCT
TGTGGGTGACTCTGTGCCGAAAGCTTGGGAACAACTGGTTAGAGGGACTATGGAATCATG
TTACCCTTTACCAAGTATAGTGAGAGAACTTACCAGGACTTGTATGTGTTTTATATAGTT
AAACACAATGGAAACATCAGTCTTGATGAAATCATCAACATTGCCCGACAGATGAGACAC
CGATCCCTGGCAAGAGACCTCTCTGGTAAGAACCACAACTACAAGGAAACATACCTAGGG
TGTTTGGTATGTTTGAGGCATCAGGTTAGGAGCTGGGAAAGAATAAACGATGTATGACCA
ATTTTTAAATTAAGGCAGTACTTTGGGGTTTTTAGTGGGTGTGCATTAGAAGACTTCTCA
AAGAGTATGGAGGCATCATGCAGGAAAGGAAAGGCTGACCTTTGTACTGCAGTGAATGTT
TGCCTTCAGCCACCCGCCACTGCACCTGTATCCAGTATTATGTTGGCTGGTGCAATCCAG
TGGTGAGCTGAGAGAAAAACCCAGCTTAGGAAACAGGGTTATTCTGCTTGTGGATGACTC
TGTGCCGAAAGCTTGGGAACAAGGAGCAACAAAGGAAATGTTAAAAAAAAAATTTTTTTT
TTTGTCTGCAAATATTGTGCATCAGTTTACTAGAACATTCTTAAAGGGAAACTTTTAAAT
GTCTAGAAAAAAAGAATGTGATCTTGAGTGAATTTAAAGGCTGATGGTGCAGCTGACCGT
CTTAAATTCAGAAGTGANNNNNNNNNNNNNNNNNNNNNNNNNTGATACTAGTTTTATTTG
TAACACATGATACACTGTTTCTGGTGTTTATTTGCAGAAAGTTGGAGGATTTTGTTCATC
CCCATTTTCCTTAAACATGAACAAGTTTGAGTGAATTATGGACCCTGGATAGCTTAATAT
TTTGTTTTCCCTTTTTATTACAGGAACCATTAAAGAGATACTTGGAACAGCTCAATCTGT
GGGCTGTAATATTGATGGCAGACATCCTCATGATGTCATTGATGACATCAATAGTGGGGC
TGTGGAATGCCCAGCTGTAAGTATTAATTCATCTTCTTAATAATTTAACATCATTGGGGA
CAAATTTAAAATAAAATTGATGATGCTTTTTTTCTTTCCACAGAGTTAAGCCACAAGTGG
AGACTATTGCAATAAATTAACATTTGACAACAGACACAGGAGTTCTTCATTTTTCAGACT
GGCAAATTTTTGCACCAAGCCACCCCACATTCTGGGAAATAACTGTTAATTTAGTTTATT
TAGTCCTCTTACTCTGCAGGAATTTTTAAGTTACTTTGCAGCTCATTTTGGGGGTCACAG
GGTGTTAGAAGAACAGGGAAGTTGTATCTTGGCAATGGGGCTGAAAATTGAGAGGAAACT
GGTTGGACAAGCCAGCATTTGAATATGGTTTTCTGGAGATGAATACAATCTTAGATGAGT
TCAGATAAGCTGGGACTTGGGGATCAAGCAATATTCCAAAGATAACCCTTCACTCATGAT
TTTTGCACAATTAGTATGTGTTTTTATACTAGGATTGTATGTGGCCAACATTGCATAAAA
GTGTTATTTTCTTTTCCTTTGTTTTTAGAGCTAATATTGTAAGCTAACCTTGTAAGGAGG
ACTTGGGTATTGGCTTGGAAGGAAGATGAATGGGTCCATCTGCAATTTTTATCAGAAATG
TTCTACTGTTGCTAGAAATTTTTACAAGAGTATAAATTTGGCTTATCCTCTATACACCCT
TATTCCTGGTGGCACCTAAAATTATTTCTGTTCTTTGTCCTGGAATTTATTTGGGAGAAA
AGAATGATTTAAGCTTAAAACCTGCCTCTCATTCCTAGGAGCTCCAAATATATAAAAACC
TTGGGGAAAAAATAGTGAAGATATTCAAATGTTGCAACGCCCTGGGGTAATCTTAAACCT
TGTATCCTTGAACCTTTTCATTTCACACATGCCTGCAACATTTCTACCATATTTGTTGGA
GAATATTTCTGAAGAAAATAATGAATTCTTATCAAGATTGGTCATATCTGCTGACATTGC
AATTTCTGAAGGGGCCACAAGGTGGTAGCACTAGCTCATACCCTTTGCTTTAGCCAACAC
TCAAGAATGTAGGATTCAGGTTTTCTCTATCTTTTCTTAGTGCCCACATATTACATAAGA
CAGGGCACACAGTTGACTTCAAGGTTCCTATCTCAGGTCACCTGAGGAAAAAATGTTTCT
AGACATATTGCTGGTGGATTATAGTAGGAGCCAAGACTAGTTTTATGTGGACTCTTGCTA
CTAAAACAGCAAGAGAGAGACTTGGGCTGCCAGAGGACAGGCAGAAAGCAAGGGTGGTCT
TAAATTTGGAAGAAACACAACCAAGTCTGTAGCAGCTCATAGCCCCAAGAATGGGAAACT
CAAAACTTTGTTCAGTCCAGAAGTAAGAAAAGAATTTTATTTGAGGTAGAAGTGGGTTTT
GCTGGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 1170..1272, 2191..2329, 2988..3086, 4130..4215, 4281..4330, 5819..5847
1001..1112, 1170..1272, 2191..2329, 2988..3086, 4130..4215, 4281..4330, 5819..5847
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved