Monodelphis_domestica Locus GTF2A1
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica GTF2A1
Monodelphis_domestica
GTF2A1
1
SNORA79
28547..28691
47214
TCGCAGGGACAGGAAGGGGAGTCATGTGACCAATTAATCACTGGCCTACCCGGAGGCCA
GAGCTAACAAGGCTTCAAGTGAGCGCCACTTCTGAAATTTAGTCCGGCTGACACGGAGCG
CCCCTGGGGACTGGAGAAAGGGCGGCCGATCGTCTACTCGCTCCCTGCAGGGATTGAAAC
CCCCGCCTTTCCCTTCAGCCGATTTAGCTAGGGTTTTTTTTTTTTTTTTAAACTCTTATC
TTTCTGAAGTGAGAGAAGCGAAAAGAAACTTCCGCCTGGGTCACGGCGGAGGCAAACCAC
GTGATCCCGGCACGAGAGGCGATTGGGAGGGAGGGCGGACGGGAGTAAGTCGGTCAATTT
CCCAGCTCCCCAGTCCCCGTTCCCTCCCCACCTTCGCACCGTGCTGAGACGTCGGTCGAC
CGCGAGTCACTTTAGCAGTCTCGCGCGCCCCCACGCGTGCGTGCACCCGGCCGCTCTCGC
GGTGTCTTGCGCCGCCTACCCGCCCCCTTCTTACTCCTCCTCCCTCTCCCACTCCGCTCC
TTCCCTCCTCCCCTTTCCCTCCCCTCCCCTCCCCTTCCTCCTGCCCCTGTCTCTCGACGG
TGGTGGCTCGCGCAGCTCGTTGGCTCACTATATAAAGGAGAGAAGCGGGCGGAGAAGACG
GCTGGTGGCTGCAGCCCGTGCGGCGGCGGCGGTAGCGGCAGCGCGGGGGGCGGCGACCGG
TGGCGGTTTCGCTCCTTTGCCCCGGGCGGGGGGCGGGGAACACTCCCCTGGACCCCGGAC
GGGTCAAAATTTTTTTTTTAAGGGCGATTCTCGTGGATCTCAGCTCCCGGAGGACTCCCC
CCCCCTTCACCGCCCCCCTTCCCCCAACTCCACCTTCGGGACTCGATTTCATTTTTCATT
TTTTAAAATCTCGGTGATCTGGTTACAGTCGGGGTCTCTTTTGTTTTTATTTTTATTTCT
TTTTTTCTTTTCCTTTTTTGGTTGTTGTGTTGTGTGTGGAAATGGCGAACTCGGCAAATA
CAAACCCCGTGGTAAGGATGTGACTCGGTGACCGGCGGCGGCGGCCACGGCCGGAGCTGG
GTGGCGGCGGGGGCGGGCGCGGGCTGGGGGCCCAGGAGCCAGAGACGGGCTCAACTCTTT
TCCCCCTTCCCCACCCCCACCCTCAGCCTTCTCTCGCTGTCGCCGCCGCCGCCACCTCTT
CCCGCCGAAGGGAAGACCTGGGCCGAGGGCGGGGGAGGGGGGGCTGGGGTGGAGGCAAGA
ACGGGGGGCTCATTGGGGGTGTAGGGTGGGGATCCCCCCTCTCTAGGAGGGAAAGGTCTT
GAGAAGGGTGGGGAGAAGTGGGGAAGACGAGAGTAGGTGGAGGGCTCTCAGCGGTGCTTT
AAGGGTTTAAGGAAGGCTTTCCTCAGATTAGTCACCACTCGAGCGAAAGAAGAGGCTAAA
AACTTGAGAAAGGGGAGGGAACGAAGACATACCCTCTCCTCCCACCTCTCTTTCCCCCCA
AAACCGCCATAAAATGATTTTGGTGGAGGGGAGAGAGTTGGTTTTGTTTTAGAAAAGGGG
GGGGGGGTTGTGGTAGAGGGAGGAGTTTAGAAAGGAGTCTGATCCTCCGGGGCAACTGAA
ATCTATGGCAGTCTCTAGACAAGTGAGGCAAGTGTAGTGGCACCGGAAAGCCCAAGAGTC
CCCAAAGCCCGAGCTGGCCCGAAGTGGGCTCGTCCCGCTGGGCTACACTCAACTGTTTAA
TTCAGATCTAGGGGGGAAAATCCGGGGCTTGGGGAAGAAGATTAATCTTCCAGACCCCGC
CCCAATACAGTTTGCTTGGGGTGTGTATGGGGGGGGTCTTTCTTTTCTTTTTTTTTTCCT
TCTGAACGAGGATGCCTTGTACTAGCTCGAAGTGTGAGGCGACCTTTGAGTTTTGTGTTG
GTTAGTTTCTTTGGAACTGGATGGGGCCATTTTACGTTTTATAAAGAAGGTTGAAAAGCA
CTTGTCCCATCTCCTTTAGAATCGTTAAAATGGCGAAGGGGAAACAAAATCCCGTCATAC
CTTCGACTAGCAAGAGGAAAAAAAAATTACATTGACCATGGCACCCCTTTTGCCTTAAAT
GCTGCCTTAGCCCCCACCCACCCCTGTGTCCTTTTATTTTATTTACTTGCAGTCACATAG
GTTTGCAAAAAGCAGTCACATAAATAACCTTTGCAGTCACCAGTACAATGTGATCCTCGA
TCCACCCGACTCTCCTTTTATTATAAGACTAATAACAATAAAAAAAATGACATCCCCCTC
CCCAAATGCCGCAAACAAACCCTCTGCCCAGGACTGTACCGTGGAGACTTGGCCCCCTTG
TTTGCGACTCTCAGAGAGAGATCGATCCATCATGGCTGCTGCAGCTTCCCGTGCTTTTCA
GTCCCTGCTCCTTGTGGTCCTCCTCCCTTTGGCTGCCCTGTTTATATAGAGCCATTGCGC
TCTCTAATATAGACTCTGCCAGGATGGGAAGGTGCTTTTCAGTCCTACGTCACCGGCTCT
CCATTTAAACACCAGATCAGGCTTTAAATAGTGAGAGCTGCGGAGAGCGAGGCTGGGAGG
TGCATGCTCCGGAGTGAGAAACTGATTCGTGCACAGCAGTTTTTTTTCCGGGTGGCCTCT
ACTTGCACTTTAATTCTACAGCTCTTGGGTCCACTCTCTATTGCTTGTCGACCCTGGCTT
TTGCTGCAGTAACTTGTTTTTCTTTCTGCCATCTAAACAATAGGAGTTTGGTATTTCTCG
ATGACTTTTGTGTTATTTTTCGAAGAAGAAAAAAGCAATAGGCCACTCTTCCTTCCCCTT
TCCAGTACCCCAAGTTTTTCCAAAGTATTTGGATGTGGAAAATAGTCTACGTTTCTTATA
ACTTGTATGGAAAATATAGGACAGGCTATGTCTAGTACTGAGTATTTTGGTACTTTTGGT
TACAGATGACTTTAAAGCATTTAAAAAATTTAGAAAGCTCTAAATTGTTTACTGAAAAAA
TTTAGGATTGTAAAACTTGTAAAAATAATATTTTGAAATGTGGAATAGATTGTAGGTTCT
TATAATAAATCTTAAACTTAATTTCCTTTTGATAACTTTTATTTAGGAAAACGTTTCATT
GTGAATGAAGAGGTACTTTAGAATACAAACATTGGATTTTAAAAAATAAACATCTGATCA
TTTAATTGATTGATAATAACATTCTTTTTTAAACACGCAATTTCATCTTATTTTATATTG
TTTGTACATAGGGTTTTTTAGGTAAATTTGTAAGCCTTATAGAATCTTAACATGACCACT
ATCCTCATAGTGGACCATATAGATACCTATTGTTATATTTAATAGATGTGTTTATCAGCA
ACTCTGTATATGGAATTTTTGTTACAAGAACCAATTATTCATATTTGGAGAACTGATTCA
GAGGAACTCTAATAATAGTTGACAGTTACATAGCTACTTATATTATTTCATTTGATCCTT
ATGTGAACCTTGTCAGAAAGGAAGTGTAAATGTTTGGGCTATTTTATTAGTGAAGAAACT
AAGTCCAAGATTGCAGGGCCAGCAAGAGTTGGATGGATTTGAGGCTTGAGACCTGGAGAC
AAGATGACTTGGGTTCAAATCACACCTTTGCTACATTGTATATAACTCTACAATTAGCCC
TTTCTTATCAGTAAAAAGAGAGTTGGACTACATGGCCTCTAAAGGACCTTCCACTGTTAA
ATCTATGATCCAATACAGCTGCTTCTCTTCTATAGCAAATTATTTGGTAATGGAAATATT
TACCCTCTAATTTATCCAGTTGTAAAATTTGGTTTTAAATGTGTGGTTCCCATATAATAG
GGTATAACTGTATTTGCCTGAAGCAGTGTGTTTGGTGCAGTCTGTAGCTTTCATTCAAAT
TGAATAGGAAATGTCTTTAGAAATGATTTTTACTCAGTATGGTCTCGGAAGTACCTGAAC
ACCAATATTTTTTAAACCTCATTAGCATATGAATAAAGGCAGCTAAATGCATATACTTTA
TGAAAATACAATTATTCCATTGCCCTTGAAAAAATGCAGAGTACATATAAGTTCACTAGC
ATATGAATAATAAATAGGTTACAGTTTCATCTGACATGTTCTAAAAATATATAGCTTCAT
TTAATAATATGTACCAATACAGAGAAGTTTCTGATAGTAGTGAAGTTTTGTACTGTAGTA
CTTTAAAAATTAAAACTACTGTCTAGGTGCCTAGATCTTTAAACTAAAAATGTCTAGATT
AACTGGTTCATAATCAGAAAATTTTGTATAGATGGGGAAATAATAATAATTTGTAATTTA
ACTACAGCTCAGTAATTTCCTGATATAATTGTAGAAATAAAAGAACCTTGTTATGATAAT
ATCCTTGGAGAATTTTATGATAAAACCATCTTGGGGGGGCAAACGAAGCTGGTATTCAAG
AAATTAAATCCTTTATATGTGGATAATATAGTAGAAAATATTCCTGAGGTGTTTTTTTTT
TTTAGGATGTATTGTATTGAGCCAGTCTACATTCTTATCAAAGAAGTTTGTTTCTAAATC
AAAGTTACTTTACCATTTTTATTTCATGGACTTAGCAAACTTCTGAAGCCTTTTCAGAAT
GTTTGTAAATCCACAAAATAGGAAGCTAATGATGTTGAAAGATATCAAAATTTTAAAAAA
TTCATAGACCCTAGGTTAATTTCTGTCCTAGATGGCCTCTTGTGACCTGTAATATTGGTG
GTTATACAATTAACAGGGTTGCAAATGCTATGTGCAGTAGGCTAAAGCTTTGCTGTTTCC
AAGTCTCCTGAGTTCTTGACCCTGGGCTAACTCTATCAAGGTTCTGAGTGAGGGGAGATG
ATGGTAAAAATGTGGTGCTGGTTTGACTTGAATGGTAACTCCTGTTTTCTCCCTTTGGGT
GCCTTGCTGCTTCATCTTGGCTGACTTGCTTATCCTTTAGACTGGAGGTGATTAGAGATT
ACTGACCTTTTTTCCCCTGTAGTTGTTTCCTGGGATAATGCTTCTGAGGACTTGTTATCT
CAAGGAAACTCTTCAAAAAAAAGGAACTTTTTTTTTCGCCATTCTTTGTATGCCTGGAAT
ATGATAGTACTTAATAAATAAATGCTTATTGACCTCTATCTGCCTTTTGGCTACAGTTGA
TGGTTGTAAGGAAGGTGTTTGTCTTTTCCACAGTGGTTTCTCTCCTCAGTTATCAGTGTT
ATTAGCTTGGAAGCAGACCTGATGGTTAAAGAGCACTGCTATTCCTGAGACTCTTTGGTT
CAGGGTCCTAGGATGTCTTCCTCAGGGTCTGAGGGCAGGTGATTGTTAAAGTGTGACTGT
GATTTGACTTATCTGGTACATGCTTCATTCTGTCTCTCCTTCAGGGTACTTTCCTTCTTT
TGCTAGTTACCTTATTTTGTGTTAGAGATAACTTTCTCCCTCCAATTTGCAGATGGGAAA
ATTGAGGCACAAAGTTTAAGTAGTAAGCTGACAGTCAGGAATAACGTCTCCAGGTTTAAA
ACTTGGTGTTCTTTATTATATACTGTGGTGGCTTTGGGCCATTGCTAGGTTTCAAGGTGG
TTCTATTTTGTGGTTTCTGAATGGAACTTCATTGTGGATAAATTTGATTCCATGGATTAT
TTTGGTACATTAAAAGTAATTTAAAATTCAGTGTAGATGTTAAATGAAACTTACCAAACA
GATGTTTTGTTTTAGGAATGAAATAAATTCTTGATCATTATTTGAGTTGTACATGTTATC
TTTGACCATTTGAGTGCCTCATGTTCTGTGCCTGGAGATACAAAAGAATGTAAGGCATAA
TTCTTACATGCTGTCCTTCAGAGTAAGTTGGTCCTTCCAGAATTTACATCCTTCTCGGGA
GATATAAGACATAAGCATAATGAGTTAAAATGTAGGTTGCACATGTTTTACCTAATGGCT
GGTAGACTATTTAATATTTCCTAGCTTTTCCCTTCATCTTTAAAATGATCTTTCAATCCT
AAACTTCTGTGATTCTGTATATCTTTTGTTTACATAATAGGTAAGGGGCAGCTTGGGGTA
GAGTATAGTGACTTGCCTTACAGCCAGGAAGATTTAGATTCAGGTCTCACTTCTGATACA
TCCTGGCTCTGACCCAGGGCAAGTCACAAGCACTCCCATTGCTGTAGATAACTCTCATAA
GAGTAAGTTTCAGAACAGCTGCTGCCCTATACTGGTAGAGAGGGGTTTCTTTACCTTGGA
GTACACTACATCTCCAGGTCCGAATCTCCATTCTTGTTCCTGTCCTTACACAGTAGATCA
TTAGAATTGTCATCTATCCCTTGGATTTGACTTCTTGTATATTGGGACAGTTTGAGGGAC
ATACTGATGCTCTTCTCTGATTTTAATACCGTGTGCCCCCATATCTCTTTCCTTCAAGTA
AAAGAAGAGAGTGGGTTTGATTTTGGGGGGTGAGACATATCTCTAAATGAGAAGGAAAAA
AGACTAACTTGAAAGTCGTTGTGAGTGAAAGGGAAGAGTAAGGTGGTAAGAGTGGGAATA
AAAATTGATGGGGTGACCGTGAGTAGTTTGCTTAATATTAACCAGAAAAAGGAGTCGTGT
GGTTATTTTAACTAGAGCAGAGGTTGGCATGAAGCTTTGGAAAGTTGCAGGGTTGGGGGG
GGGGGTGTCACAGTAAAGTAAAATAGTATTAGAAACCAAATCTGAGCAACCTACAAATAT
GCTGTTGAATACCAGCCATAGTAGTTGGCATTGAGGTGCTAGGATTTTAATGTTTGTATT
GATATGAAAATTCCTTCTATATCAATATATAATGAATTATTCCAATTTTACTCTTAAATA
TTCCTTAGAGGGTTACTTTACTGAAGGATTTAGTGAATAAATAACCTGTGGACCTAGAAT
TTGCCCATTATACTAGAAATATTAGTTGTTTTCAGATAAGCAGATTGACATCCTACCCCT
CAATCTTTATGGTTAATGTTTCCCTTAGATACGTTGTTGTAAAATGTTGTAAAATGACAA
CTGCATTAAATTCAGTATACATATATATATGTATATATATATTCTTCAACAACTTCTTTT
TTTCTTTATAGCCCAAATTATATAGATCTGTGATGGAAGATGTCCTCAATGATGTCAGAG
AAGTTTTTCTGGATGATGGAGTAGATGAACAAGTACTTATGGAATTAAAAACAGTGAGTC
ATCATATGTTCAAAAACATTTATAATCGCACCATTGCTTGCTAAACATATTAGACAAATT
TTTACATTCTTATAGGAGAGAACTATTAAAGTAATAATCTTCCCAAATATAGCTTTTAAA
AATTGCTTTAATTTTCTGAACGTGATTGTCATTAAGCTGTGTTAAGATGTTACGGTTTGA
ATGACATCTCATAATTTTGTTAGAAAGATTTCTGATTTTTAACCTAACTCCTAAGGTTTT
ATGAAGGCCAAGAGATAAGTTTTTCATGTCTCTGGTCAGGTGAATAGCTCTAAAGTGAAG
ATTGTGATTATACCTGGACATTTTCTTAGGTTTGGACAAGTAATATTGGGATATTTTCAT
TCAGCATTTATATGCTACTAGTTGGTAAGGTGACATGATAGCAAATGTGATTTGGGGGGG
TAATATTATACTTTAAGTATTCTTTATTATTTCGCTAACTGGCGAATGAGGATGTTCTAT
TATATAATATATGAACATAAATAAAATGACCATCTGTACCTTATCTTTGTCTTGATGTAC
TGTATAAGCAGTTAAGTTCAGTAAACAAATTCAGTATCTATTCTGTTCAGTGCACATTAG
ATGTTGTAACAGGTACAAAAATAATTGACATTGGTAACTGCCTATGTCTGTTATGTAGCA
AGAGAGATAGAAGGACCATAATTATTATTTTCCCATAAGACAGATCTTATTTTTATGTGA
CAGTAAAATTTGTGTCAGTCAACCAATGCTTGTACTAGGAAGTGCTAAGAATACATAGAA
TAAAAGGATATCTTCTCTTAAGGAACTTGTGCCCTATCAAATGAGAAAGTGCTTAGTGTA
GCATCTGGTGTAGTCAGTGCTATATAAATGTTAGCTCTTATTGTTGTTACTATCAAGAAA
GACAATATGAATGCATATAAGCATATATAAAAAAAAATAAAGAGAATGAGTACAAATGAA
TACAAGGTAGTTCGGGAGGTTACTAGCTGTTGGAGGAATCAGAAAAGGCCTCATGAGGAA
GATGGTGTTTGAACTCCATCTTGAAAAAGATTTCATATTGGTTCTAGGGTAAGGAGTCTG
AACTAGGCTATCAGTAACCTAGCCAAAGATTTTATCTTAACTAGAAATTAGCCATTTCTA
CCACATAATTCTCCCTCAACCTTTTCTCCCTACACTCAAAATCACCACCTTAATTCATAC
CCGTATCATCTCTGATCTAGTTTATTATAGTAGCTTCTCAGTCTTAACTCCCTGGACTCA
AGTCCAACTTCCACTGAGTAGCTTAACCAGACAAGGCAGCAGAAAATCCTGCCCCGAGGA
GCAGTAGGCCTAGTCTCATCCAGGCAGGAGCAACATAGGAATATCATTGGAGGACAGATA
GGAGCTTTCTGGAGGATCCCATCCTGCAGGATTCCTGTATTTGCTTTGTTTCCTCATTAA
TGTTTTGTTTTGTCTGTAGTAATAGACTTCCTAAATTATGGTGAGCAGCAAATTGTGGTT
TTTTTTGTGTGTGTGCTGTTAAATTAATTATTTTTACATTGAAATAATTATATCTTCTAA
CTGATAATTGAAAGATAAACATGTCAAGAGGGTGGGGGAGGGTGTCTTTATGATATTGTA
TAGTTTTAGGAGTCTGAGACCTGACCTATTAGTATGAGTTGGACTGTATTGGTAAGGTCC
TGTATTGGTAAGGTCTTCAGGGATAGATGTTGAGTGGTGTGGGGAAAATTCTCTTAACAA
AAAGTCAAATAAGAGAAACTGATGAAATCAAAAAGGGAATAAGTTTATTGCAAGAAGGCT
GATCTCACAATAAAGCCAGACTTCTGGTCAAGACCAGAAGATCCCAACCATTGTGAGAGG
ACTTTTTTTTAATATCCAAAGAATTAGAAAACTTTTATACCAGTATAAAAATAATCCAAG
ACAATAGTTATACCCATTTAAAATTAGAGGCATGCAGAAGCAATGAGCATTGGTTGGGGC
AACTAGGAAATACTTCTTATTGGTGGTAGAAGTCATTTGATGATGACTTAAAAGTTACTT
GATAGACAAAGGGGGAGCAGGGGAGTTGGACTAGTGACACAAATGATGAGTGGGTGGTAC
CAGGCTTTGAACCCATGGGGTCAGGCCTGGTGATATATACTGGATCACAAGTTCAAGACC
ATAATTATTGCTGATGATGCATGATATAGCAAATTTGAAAGCTAATACTGATACTGAGGC
TTCTGCTAACAATGATTATATATATATATAAATTCAGTCATACTTAATTCAACCCTAATA
TTTATACTAAAACAATCACAAAAGGCCTACTAAAATTATAAGTTATGCTAACATTAGTTA
CCTATCTTAGAATTACAATTTATGATTAACCTGCTACTACCACTAACATTAAAATCTAAT
ACTCATATAAGGGAGTAGGGGTTTTCAAGCTTACAGTGGACAGATCACAGTGAAAACAAG
CAATGGCAAATGTTCAGATAACACACAGATACTTTGTGACCTGGATAAAAATAGAATGGA
CTTATTTTAAATTCTTTAAATATTAGCTCCATTGTAGCAGTAATGTTAACTAACTCTTTA
TATTATTATCATTTTTATATCTTTTAGATACATTTTATAGATAATTTTTTAGACTTGAGT
TTTTCCAAGTAACTTAATATTCAGTTCTCATAGCCTAATTCTCTTTATAACCTTCTGTTA
CAGCTTTTCATGAAGCTAAGGAATTTCCTATGCTTCCATTGGATTAAATTTCTTATAGAA
TGAGAATTTATGGGGGCAGCTCAATGGATTGAGAGCCAGGCCTAGAGACAGGAGGTCCTA
GAAACAAATCTAGCCTCAGACACTTCCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAGGCATAAGCTTTTAAGGGCCTCTCAATGAGGCTTAAATGAAGTCT
GTTTAAGAAATAGAACTATCTATCTTCTTTTTTCTTCTAGTCTAAAACAGTGATACTTGA
TGCTACTTTCAAAATTGCCATTAGTAACATTGACGTTAATGTGTGTTTGAGAACCTAATA
AATTATTTCTGATATAGAAATTGCACATATTAACAATGGTATTTAACCTATATATTTATT
TGTATATATTCTTGTTTCATCTTAAAGGATATAAATTCCTTGAGGGAAGGGATTATTTCA
TTTAAGTCATATCCTTAGAGACTGGAGATAAACCTTTGCACAGTGGTCAACTTGTGTAGA
TCTCAAGCTTGGAGCCATCATACTCCCAGAACCACTGTCCAATATTGAGAGACCTTACTT
GAATAGAGTTTCCTTAGTCATCCTCTTCTTAGTTTTTGCTTCTTTTTTTTTATCTCTAAT
ACTTCATTCTACTCCTTACTTCATTTTACCTCTTGATTTCCCTTTTCCTAGACCTCTTCC
TCTTTGGATCAGGCTCATTTCCCAATCCCCCCAATAACTAAATTGATAAAATCATTGTAT
CTCTTAGTCCTGATCCACAAACATGCATTATAATAAGGCCTTTCTGGAGATAAGTAATTA
TTTTGTATTTCTAATTTGTTATAGTTAAATTAAATAATAAAAATTTATAAACCAATAAGG
TTGGTATAATCTATCTAAAATTAGTCATATACATTGTGGTGAAAATTTATTTAGCTGAGA
TACAAAAAGAAAAAAGAAAGCCAAGTCTCCAAGCCAAAAAAGAAATCGGTTTATTGAGAG
AGGGGTGATTTCACAATAAAGCCAGACTCCTGTTAACAACTGAAGACCTTGAGCCTTGTG
AGCTGCCTCCTTATATTGTACAATTTGATACAGAATGTCATATATTACTGCAGTTATATA
TACAGTGATCCCTCACCTATTGCAGGTGTTATGTTCCAGAGACCCTGTGATAGGTGAAAA
TCCACAAAGTAGCAAGAGAGCAAACAAACTGATGCTATAGTCACTGAGCCAATCAGTGCT
CAGGATATAGGATACAGCACTGTGGTTGGTTGCCTTTGCACAAGTGGTAGTGGCATACTA
TTTTTCCATTGTGTACAATATGGTATTCATCTGCAGAATCCCATGATATAGTGAAAAATC
TAATACAGAATTAGATTTAAAAAAAAAAAAAACATGATACAGTGAGGCTGCATTAAGTGA
ACCATGATATAGCGAGGGACAACTGTATACCTCTTACTCCATGAGCCTGAAGTCAGAAGT
GAATATTCAGCAATACAAATATCATACATACAGGGTAAAGGAGTCAAGAGTGTAGAACAA
GTATAAGACATGGGTATGTAGTATAACATGTCTATACTGTATGAGGTTGAGGCCTTCTAC
AAAGGCCTTGGTGGTAATTTTACAGAATGTACAAAGCACAAAATATTCACAAAGCAAGAT
GATAGGATATGTAAAATACCTACTGATCCTTATATTACATATAATATAAGGGATTTCACA
TTCACAACATACACTTTAATGAAAAATATATTCCTTTAAAAAGTTTATTTGATAGGTCTT
AATGACACATGTAAAACCCAGTGGAATTACACGTCCGCTATGGGAGGGAAAGACTTGAAT
CTTGTAACCATGAGAAAATAGTCTAAATAAATAAAATTTTCCAAATTAATAAAAATAAAA
AGTTTATTTGAGAGCAACTAGAAACCCCACAAAGGCCTTACATAGGTACCTTATTATGAC
AAAGAGTGGACTCTGGACTTTTGAATGTCATGTCAAGTCAAGTGCACATTGTGAAAGGTT
TTGCCAAACTGAGAGAACTTTGAATATGATCCTGGTGATAGCCTTTATCTGAGGACCAGC
CAAGCTAATTATGTAAAGGCTTATCATTTGTTTCCACAAAAAAAGTCAAAAATACAAAAT
GATCCATGACTTATACATCTTTATTCATTATCTGTAGCAAAAGTATTAGGATAAGAAAGG
ACAAATGACTGAGAACTATGCAGTTCTTTAGTTGTCTACAAATATGAATTTAACTTTTGT
TAATCGATGTGAGATTTTTGACCCAAAGACCAATGTGTTGAAATACTATTTGAAGAACCA
AACCATGGTTTATACTGATTTTTTTTTTGCTACAAAGCCACACCATAAATAATTTATATT
TAAATGGAAGAATAGCTCACAGGCTATCCTCAGAGGTGAATGAAAGATTTGGCAGAGTTT
GGTACCTGAAAACAATACCCAAAGACAATAAGAAATGTTGCTTATTTTGCATTTCTTCTA
TGAGTAAGCAAACAGACTACCCTGAGGATAAATAGCAGTTTATATGTCCACATTGCATCA
ACAGATGAATCGGTAGCAAAGATCTAGGAAGAACTTAACTTCCTCTACATTAAGCCATAT
TGAGGGCAACTGGGTAGCTCAGTGGATTTAGAGCCAGGTCTAGAGATGGGATGTCCTGGG
TTCAAATGTGGCCTCAGAAACTTCCTGGCTGTGTAATCCTGGGCAAATCACTTAATCCCC
ATTGCCTAGCCCTTATCACTCTTGTGCTTTGGAACCAATACATAGTATTGATTGTAAGAT
AGAAGGTAAGGGTTTAAAAAATAAATAAATAAAATAAATTAAGCCATATTTACTGTAATA
CTTGATGCTTCCAGTGCAAAGGTGGGTGTTGTATTTAGATGTGGATATAACATTATAATT
TTAAATAATTGGTTAGTCATTTCCAAATGAGCTTCTATGTAGGCTAATTATTTATCATTG
AAAAAAAGATAAAAGTCAGAAGTTATATTCTATATGACTATAGCAGTTTTGACAAACCCC
ATTTTAAAAAAGATGTAGACTTTACAGTATTACCAAAAGTAAAGACATTGTCTCTATCAC
TAGTTTTGAAAAAATTTATATTACATAAATGATATTGAAAAATGTTTATGAAAAATATTT
TATTTAATGTTAAGTACATAATAAGAACTTTTTTAAAAAGGAAAGGTGGGTTGCTAATAG
TCAACAAGAAAAAAAAACCCAGAGCTACCAAAAATATCTTTTCTCTATCAAAGGAATATT
AAAACTGGTAAAGGTTGAACAAACAGGTTTAAGAGGGAATTGAAGCCTCTGGAGAAGTGC
TTTCTTTTCACTTTCTCACTTAACTACTTTGAATATGTTCAAATGATGTAAAGTAGTTGT
CACAAGTCGACCAAAACATCACAGAAATAATTTTATCCACTAAACACCACATTTTCTTGC
CCAATAGAAAGACAGATACCAAAGGCAAATGTCTAAAGTTATAGAGGACAATAAAAGATT
GAGTAGTGTCATTATTTTATTCAAAGGTGGTAGAGAGTTAAACTGGTGTTTATATTCAGT
AAACATTACATGCTTACTAGGTGTCAGGCACTGTGTATAGAGCTTGGCATGAGACCCAGT
GAACTAAACCACATCATTCTGAGAAGATTTGTAGTTGAAACTAGACAGATGATATGATGC
AGATTAGATCTTCATACCTATAATTTTATTTTTGTCGATGAGAGTATTGGCATATATTTA
GAATTTAATTACTTTAGTATCCACACTGTACAGTGTATTTTAGCAAGGTCTCTTCTGTCA
TGTAAATAATTGAGGGTTTTTTGTTTGTTTCAGCCCAATATTCTATTTGAATCTCAGTGT
TTTCATCTGTTCTTTTAGCTATATCTCCCAATTTTGTATTTTGTCATTTGAAGTTTTGAT
GAAAATGCCATTAAAAGCTTTGTCAAAACTATGTGGTACATAAGGTAGACACTAATGACA
TGCCATGGACAAGTTTCTTCACGTTGACACAAATGACTCAATAATCTAGTTAACTGTACT
ATTTTTACCCATTCCACATTTATCCATCTTATTCACAAGGAAATCATGTGAAATAATGTC
AAATGCTTTGCTGGTTATCTATTTATATGAAGATTATAACATTTCCCTGTCTGATAACCC
AGCAGAAAAAGAAGTAAAATTCATTTGGTATGCTTTGTTCTTGGTAAAAAATATTATCTC
CTGAATTTTGGCATTTTATTTTGTAAATTTTCACATATCTGTTATAGAATTTTTGCAAGA
AACTTAGGTCTTATATCATTGGTTTATAGTTCTCAAAATTTGCTTCATAATTGGGGCAAT
ATTTATCCATTTCTAGACCATAAACATCTCTATTACCACAATAACAAAAAAGTTGCTATA
AGTTTTCTGGGTTGTAGTTTGTCCACATTAGTGAAATTAACATAGTTAAAATAATCAGGT
AAGGAGATGAAAACAGAAAACATCTTGAAGCTTTAGTTCCCTTCCCTCTTAACTATATTT
GTTCTACCTCAATTTTTTCCCTCAATAGAAGAGAAAGCAAGATCTGTTTTTTTTCTTGTT
GTTTAATGTATCTATGGTGTAGTGTTCTACCATCCTTTAAAAAAAGTTTCTCATTCTATT
TTTAACACCAAACATATAACATAGTAAGACGGATAGAAAAAAGAAATTGTACATGAAATT
GGTTATTTAAGTATATAATTTCATTGTGTACCTTTCAAAACTATCCTATTTGCTGTGCTT
CTTTGTGGTCTTCCTTTCTATTTTTTTTTACTCTGTTCTTTTCTCCTTTCACTTTCTTAC
CCTCACTCCCATTGAAAATAAAAAGAAAAATAATACCTTTGTATTAAATGTGCTTCATCA
AGTAAAACAGATTTCCATAGTGGCTTTGTCTAGAGAGATGTCTCATTTTGCATCTTGAGT
TCATCAACTTCTCTTTCCATAAATGGGGTAGCATGATTCATCATCAATCCTCTGAAATTA
GTCATTACATTGATCAGAGTTCTCAAGTCTTTCAAAATTGTTTTTCTGTATAATAAGATT
TTATAGATTGTTATGGTTCTGCTTACTTTACTATATATCAGACAATAACCCGTCTTCCCA
GGTTTCTCTGGATAAAACAAAACAAAACAAAAAAAGACTTTCATCATTTCTTATGGTGTA
GTAATATTCATATATTATGATTAGGTTAGCCATTCTGCAATAAACAGGCACCTTCATAGT
TTGCAGTTATTTTGCTTTGATATTTTTAGCATATAGAACCTAGTAGTGGTATAGCTAGCT
GAAAGAGTTTGTATGGGTTTGTGGATTTAGAGGCATATTCTAAATTGTTTTCCAGAATGG
CTGGATTAATTCCCAGTTTGATTTACAATCTGTTACTGTTTCTGCTTTCTCAAAGCCCTT
ATCACAATTATTTTCCTTTCTTGTCATCTTTACCAACACTGTCCAACACTGTCCTCCAAA
AAGTATTTTATTCTTTTCTTAAAGAATGACTGGGCACAAGTAACTTGGTGGCTTAGTAAT
TAGGACTCTGGGCCTGGAGTCAGGAAGATCCTGAGTTCCTATTCAGCCTCAGATAACTTC
CTAGCTTTGTGACCCTGGGGAAATCACTAAACCTCTATTTGCCCTGATTTTCTTAATTAT
AAAATGGGGATGATAATAGAATCTACCTCATAGGGTTGTGATGAGAATCAAATGAGATGG
TAGTTGTAAAGTGTGTGACACAATAGGTAGCACATGTTAGGGGGTATATAAATGCTTATT
TCCTTACCTTCTTTCTTTGTTTCCTTTCCCTATACCTAGTTTAATGTCTTTGTCTGTTTA
GGGAGTGCCAGCTTCTGGTAGTTCTTGACTCAGCTATTTCTGATTATTCACAATGATAAC
TTTCTCTGATTTTTAACTTCACCTACATGAAACATGGGAAGGAAACTTTCCATACCTCCA
GAAATAACATGATGATATCAAATAATAATTCAAGAAGATGTAGGTTTGTTTTTTGAATCC
ATATGAAAGAAAAAATAATGAATATGCATGATATATCTTAAAGTGATAAATTCTTTTGTA
ATTTTTTTTCAGAGACTAATACTGGAATTAATTTAGAAAACCAAATGATCTGGTTTTACT
GATAAGCAAATTGAAAATCACTTATGTGAAATTTGAGGAAAGGACAGGGAATAAAATGAT
CTTTTAGTCATAGCTCTATTTGGACCCTTTTTTGCCATGTTACATTAACATACCTATTAG
CACCAAACCAAACTTTTTAATAATAAGCTTACATATTATTTGATTGAAATTCAGGTTTTG
CAAAATTAATCAGCAAATAAACATGAAAAGTTACCTTCTTAAGAATATAAAGTCTTCACA
GAAATTTTGAGGCCACCACACTTTTCCCTAATAAATCCCTTATTGCCAAAGGGATTTTTT
TCCTCTAGGATACCCTCCTTCTGCTTATCTGTGTGTTCTTTCTAGGCCTCAGTTATTCTT
ACTTGTGAAATGAGGGGATAGAATGTGATTAACTTCTAAGGTTCCTTCCAGAGCTAAATC
CTATGATCCTAAAGTTGGTGATTTCCCACAGGGGGGAAAATGTTTTAAGTAACAATAATA
GCAGCTCCCATTTTATTTAGTTCTTAACAATTTTCTTAAAATTACCCTATAATATAGATA
GTACATGTACTTAAATATTTCAGTAAAATTTGGATCTCATTGATGTAGGGCTCCTCCTTT
CACCTCGAGTTCATTTTATAACTTCTCTATTTTTCTCTTTTACCTGTATTTTTCTATGAA
ACTTCCATTCTAGATCTGCCCCAAATACTAGAATTTAAGAATAGAGGTCCTTCTGTGGTT
CTCTACTTATTATTCTCACACATCACATGTCTTCAGCAATGTCTTTTGTAGCCTTTGTCT
CAGCTAGTTCTCAGCCTATAATCAAGAAAGTGCCAAAATTCAAATCTAGCTTCTGACACT
TACTAGCTGTTTGGCAAAGTCATTCCTTTTTGTGTCACTTAATTTCTTTTCTGCCTTAGT
TTCTTCATTTATAAGATGGAGAAAGATATAGCACCTACCTCCCAGGATGGTAGTGAAGAT
CAAATGAGATATGCTTAGTACAGCATCTTGCATATATTAAATATTTCATAAATAAGCTTG
TTCCCTTTCCCTTCATCTTTCTTTATATGCAAATCATTGTTAATAATATGCTTTAGATTC
TTAACCCAACCATGTTTCTTTCTCTTGCCCTTTTGAGTCTTTTGTGGTGGTGGTAATCTG
TGTTTTGCAATATATAACATCACTCAGAAAATATTGCTGTTTTAAAAATGGGTTTTGTAG
AAGGGATTTCTGAAAACATTATTAATTTTCTCAAATGTAATTCAACCTAATGTCTTAGTT
TAGGCCCAGATTATTGACCATTTATGGTACCTGTCAGTATTTAAACTGATGGTTGTCTAT
CCAGCTACATTTCTCATTTTGCCAGTATATATCCAGCAGCTAATAAGTATACTTTATAGG
TATGTTATAAATGTAAGACTGTGAGTTCCTTTGGCAGGTGTTTGTCTTTCTGTTTAATTG
CTTCTTGATGTTGATTTTCAGTGAATTCAAAAGGTTATCTTGTTGCAGTTCTCATGGAAT
TTTGTGTCTTACAGTTTGTGTTCAAGTACAAAGATATAATGAGATAGGTTATCTGAAGAA
GATTGTGTCTAGTAGTATCCTTGAAACTTAACATGAGTCAGTAGCATGATAAAGTAACCC
AAAAAGTCAGTGTCAACTTTGACTACATTGAAAGGCATAGCATTCAAGATTTGAAGATTG
ATAGTACCCTTGTGGTCAGTCCTGGTTACGTCAGATCTATAAGATTGTGTTTAGTTTCAG
GCTCCACATTTGGAGAATGTCCAGAAGGGAGTAATCAGAATGGTGAGGGGCTTTGGGATC
ATGCCATTTGGGAATTATTTGAAGCAACTGGGTATGCCTATTATGAGAAAACTTGGAGAA
ATAACTGCTGTCCTTTCAAATATTTGCAGGGCTGTCATATAGATTCTAGGGAATAGACTT
GTTCTGCTTGTCCTCAAAAAGCAGTAGGAATGATAGTTCAGAGTTGCCAAGAGGAAGATT
TAGGCTTCATGTGCAGGGGGGGGGGGGGGGGGGGGGTTAATATTTACATTAATATTTCCT
TTATAGTCTTTCCTCTGTCATGTCCCCTCAACCACTGTAGTCAGGCAGTTGCTTTTCCTC
GGTGTATTTACTCCCACAGTTTGTCCTCTGCTTATGAATAGAGTTTTTTCTCCTAGATCC
CTGCAGATTGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTCAGTAATAATAAATAATAATAAAATAAATAAATAAAGTA
AAAAAAATAATAATAAAGCTCTTACTCTCTGTTCTTTAGTAGTAATATTGAAGAAGTGGT
CTGCTGTTAAGAGTGACAAAGGCCTATTCCGTCTTCACGTGTACATTGCTTTTGATATTC
TCGTGAATTCTCTCTATCCCTCCTCAGAATAATGTTTTTAAATGTAGAAAATAAAATTTA
TAGGATCACAAAGGGAGCTGATTATATTGAAATATAGTTATCGAAAAAACTTTTAAAGCA
TGCTCATAGACCCCAGATTAAAAATTACTGGCCTAAATTCAAAAAGATTTTATAGAATTA
AGGAAGGTAGACAAGGGACTTATCTGATGTTATTTCCTTTTTTTGTTGTTGTTGTTTTTT
AGTGAAAATAATTAGCATGATTTAATTCATCATTTTTTAGAATTTTTTTTATTTGCTGCT
TCTAGAATAAAACAAATTTCCGCATGTATTTGGGTGGATGCAGCCACTCTTTTATTTTTT
ATTTACTTCATTGGAGAAACTGAACTGTTTTCAGTTCCTTTTCTGCTTTTATTTATGAGA
ATATTATTCTGAATGTGGTTTAATTCCCTTAGACTATCACCTCCTTGGTGACTGATTTCA
TGTTTAAGAGTACTAATTGCTTTAAATTTGTAGATGATTTTAAAATTGTGATTTTTAATA
CCTTCTCATTTAAAAAAAAATCCTTATCTTCCATCTATTGGTTCTAAGGCAGAAGACTGC
TAAGAGCAAGGCAATAGGGGTTAATAATAAGGCAATAGGGTTTGCCCAGGATTACATGGC
TGTGGAGTTTCTGAGGCCTTATTTAAACTAAGGACCTCCTGTCTCTAGACCTGATGCAAA
TTGAGCCACATAGATGCCCCTTCTGCCCATTTTTCTGCTACCATACAATTTGGGGGGAGG
GGGATGGCACACATAAGATGCTGGGCTGTTTTGTATATTTATTAGTTTGGTGATTTACTT
CAGTGACCAGACTTTGGTGAACCTTGCCATACTTAGATAGGCTTGCCCTCAACATACTCA
TTTTGTTACCGGAAGTTTTTCTAGGTTGCAGTAGAAACCTGGATGTTGCTGCAAGGTCCT
GCCATCGCACTTCCCTTCCCATGATAACATCACTTGGGGATAAAGTGACTTTCCCAAGAA
GATGCAGCTAGTAAAGCATCCTAGCTAGAGATAGAATTCAACTCATCTAGTTCCAAGTCT
AATACTATTTTACCTGCTCCACACTGCTTCCTTATGTAATTATAGTAGTACAATAGTCTA
GCATCATTGGAACAACAAAGACTATTGTTAACCGGTGTAAGAATGGTAAGGGGGATCTTG
GCAGAACCTGTGTTTTGATGGACAGGCACAGAGGTGGCAGTTTGGAGACAGCAAAGGATT
GTGGGAGAGAACTGTGAGCTGAGGAGAATTCTGGCCAGCCCATGGACTTCCATTCTGTAC
TGGAAGGGGACGGTTCTTTTCCTGGTGTCTGAGGGACATCCAAAGCCACGAGAGAGAAGA
GACTTTTCTGCCTATCCTTTGAAGCTGTTGTCATCTAGAGAGCTTTCTACTACCTTCTTC
CATCTGCCAGAAAGAACCACTGACTCAGAAGAAGTTTAGCTTGGACTCTCTCAACTGAGC
CAGCTTTCTGACTTCATTTCTGGGTCTCTCTTTGCCTTTTCTTGAACTGCTTTAAATTTA
CAGATTAGATAAATAGTAACATAGGATAAAGAGCACTGATGGGGGAAAAGGGGGCTGAGT
CCTTTGAGGCTCAAGCTTCTGCCCCTTGATCTGGCTATTTGGGGTTTTTAGTTTGTCAGG
GCATCCTGCTCCTTTCCCCCTTCCCTACCTTCCTTTCCCTTTCCCTTTCCAAATAAATTC
TTTAGTTCAAGTCAGATTTTGGGTTGGCCTGTTCCATAACAAGAGAGAAGTTGGGTGATT
GAGAGCAGGATTCAAAGGTGAATCCTGTCTCATCTGTGGCAAAACTAGACCTGGTCTCCC
ACAATTCTTCAAAGAGAAGGGTCTGAAACAAACCTTTGCTCTATAACAGCTGTCTGGGAT
ACAGACATTTTCTCTTCACATTGGTGATCAAAGGGATACAGTTTTTAAAATCTCCCTTGT
GGGAAGAGACAGAAGTTCTCCTTTCTATCTCTTTCTGGAAGTCCCTCAAGCTCTGGTGAG
ATGTCACCATCATTCTCTCCACCAGCAGATCACACCTTAGGCTCCCCAATTTCCCTCAAC
TGTTTCACTGTAGCCTACAGTAGGTTTCTAGTGAGACAAAACCATCCATCCCTCTCCATT
TAAAAGGAAGGAAAAATCTCCCCCTTTCCTTTTTTTCACTGGCTTTGAATTTATCCTCCC
ACATAGGGACAAATCCCGCAGGGCAAAATTTGATCCAGAATTGGAGATTAATTGTATCTA
GCTTTTTATATATTCTTCAGTCATTGAGCTTACAATGATACATAATTACTGTATGTTACA
ATTTCCATAATTCAGGTTATTTTGCATTAATCAAAATTTTATATTGGTTATTTTTTTGTA
AAGATATTTTATTTTCCCAATTATATGTAGTAACAATTTTCCACATAAGTTTTTGAAAGT
TATACGACCTTAATTGTCTTTCTCCTCTTCTCTTCCCCTTTCAAAAGGTGGTAAGCATAT
ATTGGTAATTTCTTGATGTGACTGTAGTAATCTACCTTAATTTTATTTGTAGCATTTAAA
CATTTGCATCCTAAAAGTAGGTTACTAGGATAAGTTTTTGCTGATAATTATTCTATTTTT
TTCCTTTTAACTAAGAAAGTGATGCTTCCTGACCTAAGATGATAAGTAATTTAAATGCTT
ACAGTCAGCTCCACCCTGAGCAAAGCACTGGGGATACAAGTGTTAGAAAGCAAAGACTCT
CCTGCCTTTGAGGAGCTTATACTCTTAATATTGGGGAAGAACAGAAAGAACAATATAGGA
GAGCTGGGAAAAGCTAGAATATGAAAAGGGATAGAAATGATTGCTAAGAAGAGAACGTAG
GTTCTGGGTAATCTAAAGTGAGCTATAATTGTAATTATCAATTAGAAAGAAATTAAAATG
AATGAAAAAGGCACTGTGTTAAGTACTGAGAATACAAATATTAAAAAAGCAAGATGTCTG
GTCTCAAGGAACATGACATATATAAAGGAGCAGTGGCCTGGGAGGATGGTTTTGTAAAGG
GAAATCAAAGCGATTAAAGATGGAGCCATTGAATAATTAATTGACTCATCTGTTCCTTTC
TTCCATTGGTAATATTGATTTTATTACTATTCCCAGTCTTAAGAGATTGGTTGGTTGGGG
TTTTTTTAGAGTTAGGGTTTAGTCTTTAAAGAAGACTAAAATGACAACCTAGGTTAGGGT
CAATGTACAGTATCTTACTATTGCTGATCAGACCAATAAAAGTTCAGAAGACTCTGCTGT
AAACCTTAAAATTTCTTAGACTTATAAATGTTAGAAATTTCACCATTGGGAAATTTCATA
CTTGGAAAATTTCTTACTGATAGTCTATTGGAATGTAAACCCCATTGGCATGGGAGGTTC
TTCCTCCTCCCTTCTTAAGATTACTTTAGGACAGAAACCTTTTGCTGAACAATGGAAAGG
GCTGCAGCATAGATCAAAATTTAATTATTCCAATCTCCACTCTACTCAGGGTAACAGGAT
TTAGGAAGGGCTGCAGCATAGATCAAAATTTAATTATTCCAATCTCCACTCTACTCAGGG
TAACAGGATTTAGGAAGGGCTGCAGCATAGATCAAAATTTAATTATTCCAATCTCCACCC
TACTCAGGGTAACAGGATTTAGGAAGGGCTGCAGCAAAGGATCAAGATTTAATTATTTGA
GAATATGACCTTCAACAGACATGTGCAAAGCCACAGACCTTTGGGCGGTCCTGGGTTAAG
CTAGAGCCACCATTGGCACAGGGAAGACATGGACAGTGATTGGTAGATGTGAGAACTGAG
GGGAGGGAACTTGGATGTTTTCCTTAAAGATAGCAGGGTCTGAGGACTGGGTGGTTGGTT
GGAGAGGTTGATTGGAGAGGTTGTGCTCTGAGAAGCTTGCTCTGAAGGAAGCTGGAGGTG
GAGGCCCCTGAGACTGTTTCTCCATTTTGGTCACGTGAGTGATAGGGACTGATCTCTTTT
CTTTGCCTCAGCTATCTAAGGGCTTGGGCCTTTTGGCCCAGCCTAAACAGAAGGGGTATT
TAAGCCCTATTCCCTTCTCTCCCCTTTCTCTCTCCCTCTCTCTCTCTATCTCTAATACCT
TTCTTCCTCCTGTTTGTAATTAAACTCCATAAAAGGTTGACTGCTGACTTGAGTTTTCAT
TTAGGAATAACATAGCTGAATTCCTTGGCGACCTTAAATTAATATATATCAGTCTTTTAA
AGTGATCTCCTTGTCACACTGCTATGGGTCAGACACTGCCACAGGTCAGACACAAATAAC
CTGTATGAACATTTGGGATGGGAATGCCTCTTAAGTTTTAGCATCTCATGTTTCTTTTGA
ATTATTGCAGTTCTGCTTTGCTCATAGAACACAGCACTTTCTTTAATGCATGCATGTCTT
AAAGGACAGCTCAGTGCCAGTATTTCCCGTCTCACTGGATGAGTGAGACTTTGAGAGTGT
CCTTGTATCATTTCTGACCTCTGTGTGAACTGTTGACCTTATGTGAGTTCTCTGTAAAAA
TAGTCTTTTTAGGTAAATGTGCAAAAGGTAGAAGTAAGGAGTATTAGGAGCATGTGTTAG
CAGCCTTGTTGTGGATCTGGTTTGGGCTATAAATGATGAAGGCTCACCAGTTAGAAGCAC
AGAGTTACGGCAGGAAATGGAAGTGACTCATCTGAGTTGAAAATTGGAGCAAAGGAGCAG
AAGATGAGCAGAATTTATCCAAAAAATTACAATGATCAAAATGGATTAATACCAACATTA
GGAAAATAATGAACATAATCATGTCAACAATAAAACCATCCAATACTACAGGATTTTATC
ATTACATGGAGAAAAATCATTGGACAAAAGTACACATTCCTTTAATTTAAAAGCCCTAGT
AAGAGAGGTTAGATGTAGATAGACCTTTTAATGTAACAAAAAGCTAGCATTCTACTTAGT
GGGAAAACACTAAATGCTTTCAAGTTCCCACTCATATAGTTATAGAAATGCCAGCATTAA
GACAAGAAAAATAAAAGCAAAAAGAGGAGAAAAAAATCATTCCTATTTGAAATTATGGTT
TTCAACTATCTGGAGCATAGCTGTGGCCTAAGAAGGAAAAAAAAAGACTCTTGTTATAGA
TTTGTCTGGCTCTTGTTGCTGACTTGTCTCTCATTCCTTATAGCAGTTGTTAAAATTTTT
TCTTTACTTCTCTTGCCCTCCAGTTACATTTTTATATACTTTTAGCAGAAGACCTAGCAC
TCTAAATCACTCTTAGGGTTGAGGTTTCCAACCTGAGCATCTTCAGTCCCATCCCTTTGT
TTTTCTGATTTCTCAACTTTTCATAGCTCCTTTTCTTAGATCACCAAATTTATAACTTGG
TTCTCTTTTATGATTTTTTTTCTATGCATTCTTGGTCTTTTTTTCCCCATCCACATGTTA
TAAGTCCTTATTCCAGCAATTTCCTTCCTGTGTATCATCAATATTTTCTTTTACACTTTC
TTATCCTTGTTTCCCAAATCCTGAGGGGGGAACACCTTTGACTTTTTTACCCTATTCTGG
TACTTAACCTGTGTCTCTGCCCTTCACTGATAAGCTTTATTAAATATAGTTGTACACTCT
AATTCCCAACTTCTATTTGGCCTCACTTCTGCTCTCACTGTGTTTCTGAAACTTTTTCCA
TTTGTTATCAATGACTAAATGGTCTTTTTAAGGTTCTCATTCTTCTTTACCCTTTTTTTT
TTAGACTTAAATGGTATTAATTGACCATCTGCCAAAATATTTTGTTTCAAACCTTTGACT
TCACAGATAGCATTCTCCTTTGGTTCTTCTGCATCTCTAATTGTTCCTTTTCTGTCCCCA
TTGTTGGCTTCACATATTCCTTACCCTTTAATATGGGCATTCCAAGACAGAAAAGCAGCA
AGGGCTAGACAAACACAGCTAAGTATTTGAGGTCAAATTTCAACCCAAGTCCTGACTTCA
GATCTGATACTCTTATCTGCTGTGCTACCTAGCTGCCACTTCACTAATACTTCTTGAAAG
GAAAATGCCATGGTTAGACCTGTGTTTTACAAGTATTATTTTGGCAGCTCTATTGGGATG
GATTGGAGAGGGGAGAAACTAGATGAGAAGAGAGCTGTGAAGACACTATTCCAAATAGTC
CAGGCAAAAGTTGGTGGTAGAGAGAAGGATATAAATGTGGAAGGTGAAAGGGTGGTGTGT
AAGAAATCTTAGATGACTAGTAGAATAATGTTGACTCTAATTACAAATAGAGGAAAGAGG
TCAAGTGGAGAGATAAGTTATGTTTTGTGAAAGTTAAGTAAAAATATGGCCTGCTTTGTG
AATCTTATAATAATCTATTTCATGTACTTAGTCGTGTTTTTTTTGTCCTCTTCTAATCTG
TTTTTCTGTACCTTGCGTGTTAGTTATTTGTTGATGCCTTATCGTTTTACTAGATTGTGA
GGGTAGAGATTCTATCTCATCTAAATATCCTGTCTCTCCAAACACACAGTATAGTATTTT
GTACATAGCTAAAGTGTTTGTAAAAAGTAGATTAGAAGTGGGGAGGTGATATGCAGAAAA
CAGGAAGAAATGAAAAAGCTTACACTATAATAAATTCCTAATGGAATCATTGTATTTTAG
TATAACAGGATCATTACTCTGTAGCATCATGAGGTTTTATATATTAACCATATTGTATTT
AAGAAGACAATAAATTACAAAGTATTATTTTTAGTATTTTGGTATTAAAATTATTAATAC
ATGTTGGTATTTAAGAGGGAAAAATTTGAGTTATGTATGATCTTTTCACACTAATGTTGA
ATAAATGGAATATTAGCCTTTAATAATTTCGTTGAAGATTTTTTTAGCAAGAATGACAAA
AAAATCACCAGTACACTGGTGTGATTTTATTATTTAATTTGTTATTTAATCATTAATAAT
AAAATCACAGATTAATCACACAGGAAAGAACCTTAGAGCCCACTGAGCCCAACTAACTTC
TTTTACAGATGAGTCTCTCTTTTATTTCATTTATTTCAAGAGTGTAAATCTGTAGTATAC
CTGTATTTACTCTTGGAAATGACAACATACATAAGCATAACAAAAGCATAGGATATTTGC
TTTTTTTAAATTATTATTTCTGTCTAAGGCAGCTTGGTGGTCCAGTAGATAGAGCACTGG
GTTGGTAATTAGGAAGACTGATCTTCCTGAGTTCAAATCTGGCCATAGACACTAGCTATG
TAACATGCAAGTCATTTAACCCTGTTAGCCTCAGTTTCCTCATCTGTAAAATGAGCTGCA
GAAGGAAATGGCAAATCTCTCCAGTATCTTTATCAAGAAAATGCCAAATGGGGTCATAAA
GGGTCAAGCATGACTTAAATGACTCAACACATTTAGCCTTTTTTCTTTTCTTAGTTGTGG
GAGAATAAGCTGATGCAATCTAAGGCAGTAGATGGATTTCATTCAGAAGAACAATATTTA
ATACAAGTACAACAGCAGCAACAACAGCAGCAGCAACAGCAGCAACATCACCATCATCAC
CACCATCAGCAAGCACAACCCCAACAGACTGTGCAGCAGCAGTCCCAAACACAACAGGTC
CTTATCCCTGCATCACAGCAAGGTTTGTATGAAATTGGTTTTAAGCTTTTAGATATTCTC
TTTTTTTCCCCTCTGTAGGAGATATTAAATCTGAAAGAGTTAAACCAATCATGGTTAAAT
GGTGCTTAGTGAGACTAAAAAGTGGCATGAATTATTAATGTTGGCTGCTGTCCCAGTTCC
TTTCTTTTGGCTCAGTTATGTGCATATTCATTTACTCCTTGAAGATTAGTCCAACATAGG
AGGTACTATTATAATGCCTTGCACTTAGTGGGTACTTAAATATTTGTTGAATCAAATTAA
TACCTAGTCTCATTTCAATGAGATCAAGATTTAGAGGTGTAAAGGACCTTAAGGATAATC
TTTATTATTATCCAAAGATAATCTTTATTAGTCCAGCCCCTTCCGTTTTTATAGAGGAGC
AAACTAAAGCCCAGAAGAGTTCGCATGCCTGGAAAAGTCGTGCAGTCTGTACATAGCAGA
GCTGAGATTCAAACCTATATCTTCTGATTTGAAACTGGTGAGGGGTTAAATCTGAACTAA
CTGGGAAACAAAGATTTGAGCTTCTAAGCATATAGATTTATTTAGCTATGCCAACTGCAT
AACAAATTGGGACTAGGCCACCTCAGCCTGGCACTACTCTCCCAAATACAGGGGGAGATA
GATTTTCATGCATTAAAAGAAAACAATTAAAAGGATATATAAATTCCAGGATACAAGATT
AGGTAATCTGATTTCTAATTGGAGGAAAAACTAGGGACTCTCCACATTGGGAGGGGGAAA
AGGGAACAGATACAAATCTCAGAAATTTAAAAAAAGAAAAACTGTTCTATTTCCCCCAAG
AACCTGTATTCCATCAAGGGAACAGTAATTGATTGACTAGTATGAGGCCAGTTTTCAGAT
AAGACATAATGGGCTACTTGAGACATATAATAATGAGAAAACTCCTATCAGTCTTTGGCT
CTGACCAGGTTTCTGGTTAGCATAAACTGAGTCCTTAGTTAAGGGACAATAAGCAACAGG
CAGAGTTGACTAGACAATGCAACAAAGTTTTCTCAAAATTCCCATAATTAAATAGTCTCC
TCATAAGAAAAATTGAGCTAGCCTGTAATTGAATAGAAAGAGTACTGAGCTAGATCCAGA
ATTGAGTCACAAGATGGTGTCATTGTGGTTCACTCAGTACCCACAAAAACTTAGTGCTCA
TTCCATTATGCTGTACTCTTAACAGCCTGTGTAAATAAATGAATTACTGTTTTCACACTT
GCAATACACCATATGCCCAAGTTAAGACAGAAACATTTCTAATTTTTCCTTAGAAAAAGA
TTGATTGTTCTTACTATTTAGGTAAGACAGTTACTCTGTGACAAGTTAGTTAACCTCTGC
CTTTGCTTTCCTCATTTGCAAAATGAGTAGGATGGAATAGATGATTTATAAGTTATATTT
CAGATTTAAGAATCGCGATTCTAATCATTTGATAGTATGACTGAGCTTTATTTTCTTTTA
CAAAGTGCCTTTATTATTTGAACAATCTCCAAATTTCCTTTATATGTTCAATTATCTTAT
AGTATTTAGTTTCCATTTGGTGGGCTGAACTTAAAATATATCTTAGTTCATGGCCTTATT
TTATGTTTTCAGTATGTGCAGTGTTTCTGCTTAGGCTTTTTTTTTTGTTAAAGGTGAGTT
TTATTGTGCTAAATTGTCTCCACATACTTATTTGATTAATCACAAAATTCTAAATAGTGC
TTTCCATATTTGCAGATGTTGTCTATTATGTATTTTACCAATTCAGATAGTAAAGCAGGT
GCTTATCCTAAGTGCTTAAATTTAAAAGAATTTTATGCATCTGAAAAGGTGTACAAATTT
ATAAATATCTGTGAAACAATACGTTAACTGCACTTCGGAAGAGTGATGACTTTATCAGAT
TCAAGTAAAGATTTAGATTCACAGTGCCTATGCTTTTAGTCTAAGTCAGCCTTCTTAAAT
TACTCTAAAAAAAAATTTCATCTGTTAACCGATCGTCTGGGGATGAATCTTATCCCAATT
TGCTAGACCCATCTTCAAATAGCAGTTTAGTTTGGGTTATATTCTGTTAGCATAGGCTTA
CTTCTTTGTCAAATGAGGTTCTGGAGAGTAGGAATTAATTGGAATATAAATGAAAGATAT
TTTTAATGTAATAGGTAGATTTAAAAATCATCAGTAATGGAAAAAATTAATTTATTCATT
TGGAGAATTTTTTAGTTTTTAACTTACTTAAGGATAGAAGAAATTTGTTTTGCTAAAATC
AGTAATTTCATTTGATAAACTTATAGATAATTTCCCCCTTTCTGGCTTGATGACTGTTCC
TCCTATTGCCTAGAGCTCTGGCATTAGGATTTTATGTCATCATACATTAAAATTTGACTT
TTTTCACTCAGAGAATATTTGGGATAAATGGATTATCCTTTTCTTCTCTGAAATTTGCGG
AGTCAAACACTTTTTAAATATTATGCATTCATTACCATGAATTACTGGTTAGGAATGAGT
GGCAAATTATTTGATCATATTGGTTTAAATGTTCTTGATAGTTGACAAGGGTGTGTTTCT
AAGTAATACTTAACTTAAAGCAGTACTTTTAAAAAATAAATTTTTCTTGATATCTTATAT
CACCATCATTTTTTTCTATTATCCCCCTTTTTTTTTAAGATCAAAAAAAGAAGAAAATCA
ATGTAACTGTTCCATTCATTTAAAAAGCTTAAAAATATGTTCAGTGTTCAACACTGGACC
CTCCTACCTCCTCAGAGTTGGTGGGGTTGCAGTATTACATCTCTCTTTCCAGTTGTATTC
TTTATAATTTCCCAAGTTATGGTTATCAATTGTGTTTAAAAAATTTTTTCTATCACAAAA
AGGGCTGCTATAAATATTTGGGGGCAGTAATTCTCTACTTCAAATACTCTAGAGCTTATT
AGTCTGTTTTCAAACCTAGATAGAGTTTATTATTACTTACCCTCAGTTACATAAAGCAAA
AAGATGACATGGTAATGTTCTTTCAGATCATTCTTAAGTGATAACTCTGTCAGTGTTTAA
ATCTTGAATTATAAAAGACCAAAACCCTATTTTTGCATCTGTGAGGTATACTGTCATTAT
TATTATATATTCTGAGTTACAGAATCTCAAGAGTTTGAAAGGACCTCTGTGCTCTAGTTC
CTAAAGCATAAAACTCTACTACAAAATTTCCTATATAAGTGTTGCCCCAGGCACAGTTGG
AATATTTCCAATGATGGAGGGTTCATTCATTCATGAGGGACAGTCCATTTGATATGTAGC
TCACTCTCAACTGCTATGAAGTTTTTCTTTATATTCAGGAAACATCCATTTTTCCTATGG
CTTCCACCCTTTAGTCCTAGGACTGCTTTTTAGAACTGAGCAGAACAAAGCTAGACACTT
TTACTACCAGACAGTTTGAAGACCTCTGCCATTGTTTTCTTCAGACTGAACATTTCTAAT
TCAATAGCATGGCTCCAAACCAGTTCACTTTTGTATTCAGTCTAGCTTATTTGTGTCATT
CTTAAATTGTAGTGTGTGGGATTGGAAAGGGTACTTTAAAATGTAATCTAAGCAGGTTAG
AATATACTGGGACTATTCCCTTCTGCTGTAAGCACACAGTATGGACTCCTTGGCTCCAAG
AGAGAAAGTAAAGGTTTAAAAAAAAAAGTAGTACTGAAAAATCAAGTTTCCATCAGCCTT
AAATATCTAAAATGTGTAGTTACTTATGAATAGAGAAGAATTATAAGACCTTAGAGAGAA
AGAGCTATATTTCATTTCTTAAGACTGGTCTGGAGTTTCACATATATAATGTTAGCATAT
TAGTAATATTGGTAACATGATGTGAATGGATGTAAAATCAGAGATGCAGATGAGGAACAT
GGGTTTGGGATTATTGGAAGATGAAAGAAAGACTGAAGAATGAACTAACAGTGAGGGAGG
CGTGTGGACTAGTCTTTTCTATAGAGCAAATAGCCTTCTAACTTGTAGCAATGGATTTTC
TCAATGATTTTGAGTAATCAAGGAAAGATTAAAGGTTTGTTTGATATACTGTGTGTTGTA
GACCAATGAAAGGAATTATGTACTAGATTTCAGGCATTTTCCCCCCAAAATCAAAAAAGA
TAAAAACTTCAATTTGCTTAAATAGCCACTTTGACCTTATTCCCTGAAAGTACATTATGT
AAAATTAGTTAATCAGATCTAAATGATTTTGAAGTGCCAATATTAAGACCATTAATATTC
GCATGTGACTTTCACATGAGAATCACTTTTGTTGCTTTTGAAATTTGTGCTTAGTAGGAA
AAAAATGGATGTTTTTCTAGCTGTTCTCTAAGACTAATATCACTTCTGTTTTCTTTGACC
ACTAGTGATTTTTTTTTTATGATACTTTTTTAACATAGTTTTGCGTAGGTGGCAAAACCA
TTGGTTTTCAAAATGTTAAAATGATAAAAATATGCTTTTTTTGTATTATGTATAATATAA
TTGCCTTTTGAATTAAGAAAATATCTATTAACACCATTTAAGCTTCCTGAGTTTTTATAA
AGTTAGTAATGCCTTACATGTGTACATGGTTTTTGTTTTATGTTTTCAGCAGCACCACCT
CAAGTTATTGTACCAGAGTCAAAGTTGTTACAACATATGAATCCTTCAAGTATGGTAAGA
TAAACAATTTTAGCATTTTGATCACCTTAACTTCTCTAAATAGGATTTTTATGACTTGAT
ATATTAGTAAGAGAAAACAATAAATCAAGCCCCACCATTAAAAAATAGTTTTAAATAAAT
TATTATTATTTTTGGATTTAGCAGGTAAAACCATTGTTTTGAAATTGTATAATTTGATTT
GTATAATTTTCTTTGACATAACATAAAATCTTACTCTTCATGAGGAGGCAAGGACTATTT
CAGAAGTTGATTTTTTTTTCCCCCTGACTCCTGGGATAAGTCATTTAATTAGATTAAGTC
CAGAGAAAGCATGGTGGGAATTCTTTATTTTAAAATTGTCATCCAAAAGGTTTATCTTTG
TATATATCTCCTTTGTCCTTAATGTAATTTTATAAACATACACTAAATTTTAGCAGCCTC
TCAAAATTATTTTTGCATTTGGTAACTACAGATATGATTTTTTTTCACACTTGGAAATGT
AGATACTTTATATGAATTGTTTTCTAGCTAGCTTTACTAGTTAGCCTCCATCCCATTTGT
CCACATCAGCTCATGTAGGTCTTCCCAGTTCTTACAGAAATCAAGCTATTCTTTCCTTAT
CATCATTTAATTTCTCATTTGGAACTGCTTTTTCTGTTGTTTGATTTAGTATTACTTAAT
TTCATTTTTACCCCCTCAGAGTGCTGCTGCCACTGCTGCTACCTTGGCACTGCCTGCTGG
TGTTACTCCTGTTCAGCAGATAATAACTAATTCAGGTAATTCAGGTAATTCAAAATAATG
GGTCTATTTGACATCTCAAAAATTACACTATCACCTAATCTTGGTTGATGAATTTATGAT
TTCATTTAATTAGAGAGACAAGAGTAATTATGTGTGTTTAGCACATATTTTGTGCTTTTC
ACTATCACATTTCTTTTTTTTTAGTATAACTATTCATGGAAATAACAGAAGAATGTAATG
GTATTGAGCATTAATAACTAAACACTTAGATATTTAGATCTTCATATATTTACCTTGTTT
TATATGTATGTAAACTGTTTTACCACATTTGGTATTTATTATTTTTTTTAGAAATGAACC
TGTGCACTGTGTGTGCACATGTGCATACATACATATTATCATCTGTGTAAATAGTCTGAA
AGGAAAAAAACTACTCTGTTTATTCAGTCAGTGGCTGTCAGAGAGCATTTATGTAAGAAT
ACATATGTGTGTGTATATATATTTGTAAGCATCCCCTGCAAATTGAAATTCTTCCTAACC
CCAAGTAAGATCTTAGTGCATTTTGCCTATTACACAGACAGCTAGATGTCACAGCAAATT
GAATACTGGGCTAGGAGTCAGGAAGTCAGGAGTGCTCTCATCTAGCCTTAGACAATTTGC
TAGCCATGTGACTCTGGGCAATCATTTAATCTCTGCCTAGTCAGTTTCCTCATCTGTAAA
ATAAGGATGATAATATCTACCCTCCCCCTGCACCCCAGGGATGTTATGAGGTACAAGGGA
GATTTTTTTTTTGTATAGTGCTATTATTATATTACATAACTACTAAACATAACTTTAAAA
ATCTTTTTTAATCCTTACGTTCTGTCTTAGTATCATTTCTAAGATAGAAGAGCAGTAAGG
GCTAAGCAAATGAGGTTAAGTGACTTGCCCAGGGTCACACAGCTAGAAGTATCTGAGAAC
AGATTTGAACCCAGGACTTCCTGATTTCAGGCCTGGTAGTCCATCCACTGTGCTATCTAG
CTGCTCCTTATAGTAGGCTCCTCATAAATATTTGTTGGTTGATTGTATAGTGTTTTAAGG
GGGGAAAAAAACCATGTTCTTTTATCAAGGCAAGGCAATATGATAGGATTTTTGACTTAC
TTCAGCAGAATAGTTATGTTTAATATTTGAAGGTATACCCTTGGAGAAGAGAATTCTTGA
AAACAAAAGGTCATAACTAGGGTATAACAAAAGAATCAATTCTTTGCCACATGACTTTAA
GAAATTAATACCGTTATTTCAGTTTAGTGAGCCATTCAAGAGGCAGCATAGAACAGATAT
TCTTGGTCGAAAAGACCTGAGTAGGAGAAGAGACATGAGGCACTGGATTCAAATTTGACC
TCAGACACTTCCTAGCTGTATGACCCTGGGCAAGTCACTTAACCCCCATTGTCTAACCCT
AATCACTCTTCTGTCTGCAAACTAACACACAGCATTGATTCTAAAGCAGAAGGTAAGGGT
TTAAATTTTTTTTTTTTTTTAGAAATGAACCTGTGCACTGTGTGTGCACATGTGCATACA
TACATTAATAATATTAGCAGGATGATGATTGCATTGGTTAAGAATTACTAAGGAAGCTCC
CTTGACCAGAGCAGATCTGGCAATTGTTCTGCAACTTAAATAGTCTTACCAAGGTGTCTA
GTACATGACAGGTTAAGTGACTTCATGTAACCAGTGCCTCATGTCTCTAAACCTGGTTTT
CAAACCTCTAAGCCACCTAGCTGCCCCCATTTTGAAAATTCTTTAAAGTTTTTCAAAGCT
TGTTATTTTGATGTTATTTAGGAAAAAAGACTAAGATGTCCACCTTACTATTAATCAAAT
GATAACAAATTCAAAGCTGTTTGGCTACTAGGATTCCACTTAGAATGAAGTAGTCTTCAG
ATCAAATCACCTGCCTGCATTGGGAAGTGAAGGGAAGGGAGGGAGGAAAATAGGTTCAGT
CATGTAATTTAGGAAAACTTGTGTAGAAATTTGTTATTAATGTAATAGGCCAAAAAAATT
AGAATTTTAAAAAGATTTTTAAAAAAAGAATGAAGTGGTCTTTCTACTTGGCTCCCTACT
AGTCTGAAAAATGTACACAGTTCTAAAATAATGCAAGTAGGATCATAGGACTTTAAAATA
GGTGTTCAAAAGCCTCGAAGTATCTTCTTGAACTAATTTTTTCAAGTCCTTAAATTAAAG
ATAAAGGATCAAAAAGAAAACTACATTCAGATCAATTATAAATGTGTTTCTATGCATACA
TAAATATATATATATATATATATATTTTTTTTTTTTTTAGGTTAGGTTAAAAACTCCTAA
TTTAGACATTACCTTATATAGCCTCTTCACATTTCAGATGAAGAAATTGAGGTTCAGGGG
AATTAACGGATAAATAGCAGAGAGGGCTTTTTTAAAGTCCAGTTCCTCCTCACTCTGGAT
TCAGTATTTTAACATTATTTCAGTCAGTAGTTTGGGTCCTATAATCAAATCACACTTAAT
AAAACCATATTGGAGGGCAGCAAAAAGGTGAGAACAATAGAAAGTGCCATGTTTAAAGCA
GTACTTTGTAATTTAATATTTGGACAAAAGTAGAGATGGGGAAAATAGAAGAGAAAGAGA
AGAGTATATTATATATAGATGATAGCATTGAATTCAATTTTTAAGCATTTTGTTAGCTAA
CTAGCATGTTCTAAGAGAAGCCCATTCAGTCCAACTTGCAGTATGCTATAGAAATCATTA
CTTAAGGTAACTTGAATAACTTTTTGTTGCTGTTATAGGCCAGATTCTTCAGGTGGTTAG
GACTGCCAGTGGTGCCCAGTACATCCTTCAACCACAGCAGTCAGTGGTTTTACAGCAGCA
GGTTATACCACAGATGCAGCCCGGAGGAGTACAAGCTCCTGTTATACAACAGGTAAAAGA
ATCCTTAATAAGAAATTCTTTTGTATGTATGTAATACCTAGTAGTGGTATTAATTCCTAT
TGGTATTAGTATTGGTGTAACTAGGTGTTAGATATAGTTATTAGTATTGGTATTAATTTT
CACTGGTATTAGAATTTAAAGATATCTCAACCGCCCTTCCTCGTTTGGCATAGCATACTT
TGGCCTACTCTGACAGGGAACTTGCCTGTGCAAAACTAAGTGGTTGCAGCTAGCTCTCCA
GGTGTCCAGAAATCCTTTCTTGTGGTCTATGTAGTGTCTCTCCATCACAAGTATGGCAGG
GTAGGATCCTCAGTGGCAAAATGGTCATGGCTTTCCTTCTCTTTCTTCAGACTAAAGTTT
CAGCCTCTGCAGAAAAAGGCTATTCTTCAAAAATGAAATTTGTATTTATAACCTTTTTGA
AAATCTTCCCATGTACTAAAACATATTAAAAGTTTTGAGATTCAGAAATACTTCTTATTC
AATTCAAAGAAATCTTAAATGCCATCTATATTCAGAGGATTGTGTTAGGTGCTGTGCATA
CAAAGGTGAAGGGGATTGGAGGGAGAAGTAATGTACATAGCTGCTTATAATATAATTTAA
AATAGATCAGTTACATGGAATAGGTCAAACATGGATGTGTGAGGTTCATGGCAAAAGAAA
CTAATACTAGTTGAGGAGTTAATAGAAAATTTCATTCAGAAAGCAGTGCCTGAGTTGGTC
CTTGAATATGGAAGATTTTATAAGATGAGAAAATAAAGGGCATCTGATCCAGGTGGGTGG
GCCAATGTGTCTAAGAGTGAAATGGGAGGCCAGAACTGGGAATAATCCAGTTTGAGCTGA
GCAGACATTTACCAAGATCCATGCATTAGGAAAAGAACTTGGTGATATAGAGACCAGATG
AACTATAATTTTCAAATTATTCTTTTCCTATGGTTTAAAGTACCACTTGCTCCCTCCTTG
TTCAAATTATATGACCTCATACTTTTTGCCTAGATTATTGCAACAATCTCCTAATTGGTC
TTCCTGCCTCAAGTCTCTCGTTATTCTAGTCCTTCCTACTGCCACCACTGCTGTCAGAGT
AATTTTCCCCAAGTGCAGACTTCTGAATCCCTTAATGAGTAAAGTCTGGTGACTTCCTAT
TATTGCCTCTAGGGTAAAATATAAACCTCTTGGTTTGGCTTTTAAAGCTGTACATTACAT
GGCTCTAACCTATCATTCTGTCTTCACTAGGCATTATTCCCTGTCTCATACTCTGATCCT
TCCAAACTGGCTTTCTCTCTATGTGAGGAAATATAGCACTCCTCCTGCTCTTCATGCCTT
TAAACTGACCATCTCCCATGCCTGTAATGCACTTAATTCCAATTAGTAACAACCATGTGT
TCTATCATTTCAAGGTTTTGATTTCCTTTATTTCATCTTAATTACAGCTTTATGTTTTGT
ATTACTATAATCTGTCATGTTTTTTGTGTTTGGTTTTATAAAACAGATTAAGACCACACA
TTTTTAGATCACTTACTTTAAATGGGGGAGAAAAACACACAGTAGGTAGTGGAATTCTGA
AAGATTTCTACAATTCTGCTCAACAGCTATCTGTTGAGGCTGATAGTTTTTCTAGGTCTA
GTATTAGAATACTTTTTTCTGTTGAAGATGTGAATGAAGTATGCATGCTCATAGACTATT
GGATTCATTTTGGGGCTATTAAAAAAACTTTTTTTTCCTTTAAGTCATAGCTCAAGCACC
ATCTTATCTTTTTAATGAAGTATTTCCTGATCTCCCCCAATTGCTAGTTCCTTTCCCCTT
CTTATCTTTAATTGCCTACTATCTTTTCATTTTCATTTTTATTTATTCACTTTAAATTTA
TTCTTTCTATATATTTTTCATCTTTCCCGTTAAATTATAAGGTCCTTGATAGTAGGGTTT
ATTTTTTTGTACTTTGATCTCCAATATTTGGGGCAAGGTAGGAACTTAATACTTGTTGAT
TGATATTGTTCAGCCTAATTTAAATGAACCTTAGTTAACTTTTATGCCCATGCCTTTATC
AAAGGAGCTTCCTGAATTTTATTTCTAGAAAATAAACACAGAGTGATTTTTGCTATTTTT
TTCCGCACTCGTAAATTGTTTAATAAAACTAGACAAATCTTACCTGCTAAAATGAATTGA
ATAAGTGAACACTGGTATAAAAAATGATTTGAAAAGGGGGAGACAGTGGCACAGGCAAAC
CAACCCAGGAAGCTGTTTCATAGTTTGGACAACAGTAATAAGGACCTACATTAGGACTAA
AGAAGTGGAAAAGAGCCAGGTAGATAAGAGAAGAATAGGTTCTGAGCTATTCAGCATTTG
ACAGATTTGACAAGTAACAGTGGTCAAAACCTAAAGAGTCAATGATGACATTAAGATTTC
ATACTTTGATGACTGGAAGAATAGTGATTCAGTTAAAAGAAAGAATGCATTAGTTTCTAT
TATGAGGACATGTTAGTACTGAGCACAGAACTAACAACATTTTTATCAGTTACATTAATG
AGGGTATAAAATGGTATGTTATAAAATTTGCATGTTCATAAAGCTGAGAATAATTAAAAC
ATTGACTATAATCATATCCAAAAAGATTTTAACAGTATAGAATAAGAATTTATTATAATG
GAAAATAACTTGGGAAAATTGTAAAGTTTCTAACAGGTTTTTAAAAATCAATTATATATA
GGACGAGAGAAAGGGAACGAAGTGGAGCAATGGATAGAGCACCATGCTTGAAATCAGGAA
GATTCGTTTTCTTGAGTTCAAATCTGGTCTCAGACACTTTTATTAATTCTGTGACCCTGG
GCAAGTCACTTAAAACTTTGCTCAGTTTCTCATCAAATAAACTGGAGAAGGAAATGGCAA
ATCATTCCAGTGTCTTTACCAAGAAAACCCTAAATAGAGTCAAGAAGAGTTAGACATGAT
TGAAAAATGACTGAGCAACCACAACAAAAGGCAGGAAAAACATGGTTTGAAAAACATTTT
GTGTGAGATGAATACCAGGGATTTAGGAAAAGGAAGCATGATTTTTCTTTTTTTTTTTAG
CTCCCTTAATAAATGCATAGTGTCTGAAGGAAGGGAAGTTTATTAGAGCCTCTTGGTCCT
CTACCACAGACTGCATCTGGAATGCTGTGTTCCTTTTTGGGTGCCATATTTTAGGAACCA
AAAAGTAGTTGGAAATCACAAAATCTCAGAACAGGAAGAGATTTAATTAGTTCATTTGGC
TCAACTAAAATACTTAAATGATTATCCAGCACTGGCCTGAAAATCTCTGCTGAAGGTGAA
ACAATGCTTCTTCAAGCAGACCATTCTGTTGTTGGACAATTCTATTTGTTATGAAGTTAT
ATCTCAAAGCAAACTTAAATTTGCTTCTCAGAAACTTGGTATTGCTGTGAACCTTTGCTG
CTAAGGGCAAACAGAACAAATGTAATATTTGTTTCACATGAGAGGCATACGTAACTCTGC
AGGTCAAACCTCTCTCAATCCTTCATTCAGGCTTTCTGTTGCATGATCTTAAGACTTTTC
ATGATTCTCTTCATCTTCTCTGAACATTCTCTAGTTCAATCTAGAAAGTGAAAAGAGAAC
TTGTAACTTCCAAGTAATATTCCAGAAATGATCTGATCAGGTTGCAGAGTACATCAGTAC
TGCTATCTCCCCTGTTCTGAATACTAATCCTCTCTTAAACCCAAGATTACATTAGCTTTT
TTTAGCTTTGATTTTGTACTATTGCCATCTCTTTGGACAAACTGCCTTTTATACTTTTGA
ACTTGATGTTTTCAATTTACACTTTTATACTTGATCTTATTTGCTTCAGCCTAGCATTTT
AGCCTGTAAATAAAATAATGAGCCATCTATTACTTAAGTCATTATCAAAAACATAAAATA
GCACAGGGCTAATGAGGCATTCCAGTTGAGATCTTCCAAATTGATTCTGGTTTAGTCAAC
CATTGATGTTTAGGTTCACATTTGGTTTAATTGCTGGGTCATGGTACATCCCCTACTCTT
ATTTCCCCACGAGGTAGCTGCTTAGGGGTCAGGTTCCCCCTCCAAAGCTCTGAATTGGGT
TTAGCAATTGAATCTAGAGTAGGCACTAAGCCTGATCCACTGCCAAACTCTTATTTTTAT
CAGTCTCCTGGGGTCTTCCTGAATCCCTGGGGCTTACCAGACTTTTTGCCTCATCCCCTA
AAGTAACCTAGACTAGAGTTTTAAGCTGGCTTCAAGCCTGTCTCCTGGGACTTGGTTAGA
TTTCTTTGTTCAGTCACCTATCATAAGCTCTAGAGCTTTAGACTGTCACCTGGAATACTC
AGATTCAAGTCAGTATTGGCCTCAGACCTTTTTTCCTGGACCTAGTTCATTTTATGGGAT
GAAAGATCTCATTGATACATCTCTAGTTTTGGTGAATTTTTATATGCGATTCTTCATTAT
TAGACAGTATTATGCTTGTTTAACTTAGCCAAAGTGGGTGTTAGTCAATCACACTTGACA
GGTATTTGGAGTTTTCTTTGCCTTGTACTAGCTGTATGTCCTGGGTAAGCAGCAGACCTT
ACTGTACTGTGTGGAGATAAAGCTTGACAAATTTTTGGCAGAAGATAAATATTTACATGT
TAACTGAATTGGTGGTATTAGGTCAAAATTATGTAAGTAGATGTGATGCTGAAAATAAAG
TAGGGATTGTGGGGGGGAAAGTTGAGAATAGCCACAGAAAACATCCCTTTGGAACTGGGA
AGAACAAGCAGTGGAGAAAACTGGGACAATAAAGATTATAAAATTCAGCATGATAAGAAA
ATAGGAAAGCATGCTTTAGGGCAAAGGAGGCAGCCATATTTGTAAAAAGTAGGTAAAGAA
GCAAGGAGAGAGAGATCCAAGATGAAAGAAAGTGGGAATGATAAAGGGCACAAGCTTCCA
GAGAACACCAGAATAGATTAAAACATAATACAAGTGATCAAGCTAGCTTTTCCAAGGAAG
GAAATGACATTTGCAAAGTATAATTCTATATTTTTCTTCTTTAACTTAATCTTCCTTCTA
GCCTGTCTATTTCTATTAAATGGGCTGCCATTCTTGCAGTCACCTAGTGGTTATCCTCAA
CTCTTCATTCTCACTAGTTCAATCTATGTCAAGTCATTGGCTAAGTTCTGTTAGTTCCAT
ATTTTTATCCTGTTTAATCATATCACAACCAGTCTAGTGTAGGCTCTCATCAACCCTGCT
ACTGAAAAAGCCTCTTCCTGTATTTCCCTGATCCCAATTTCCTTTTCAATCCATCTTCCA
TATTGCTGCCAAATTGATATTCCTGAAGTTCAGGTCTGATCCTATCAACTCTCATTTCAA
CAAACCCCAGTGGCTTTTTATTAACTTTAACAATAAAACACAAATCCCTCTTTGGCATTT
CTAGTCCTTAAAGCCCTTATTAATCTGGCTCCAGCCTATCTTTCCCATATTACTTTTCCT
CCTGCATTCTAAACTCCAGTAAAACTGGTCTGCTTTCTATTCCTCATGTACAGCTTTCCA
TTTCCTTCCTCCATGCCCTGTGTTAGCTTTGTCTCCTATACCTTGAATGCTTCCCTGTCT
TCTTCTCTCTCTGGTAAATAATCCAAATATCCCTTCAAAGCTCAGCTGGAGTTACATGCC
TTTCAAGGGGCCTTAACCTATTAGTTGTAAACATTCTTTCTTCCAAATCACTGTGTATTT
ATTTTGTATTTAATGAATCTATATGTGAACATATTAATGCTTGATGGACAAGATAAAATG
AGAAGCTAGGTGAAAAAACATAGGGGTGTTTTATATGATCTGAGGGGAGGACAATGAGGA
AGTTTCTGATAGGTGTTTAAATGTCTTTCTTGTCAAATAGACTCAGTAATTTCCTGAGAG
AAAAAGGGGGAGATTGTGAGGGCATACGGAAAGTTCCAGAGGAGGTTTAGTTCTTGGGAG
AGTGAAGAAATGAAAATATTTCTGTGCATTACTGAGGAACCAGTTTAGGTTAGCATAAGG
TTAGCATAAATTTGTTGTGGACTCAGTTATGGATGAAATAATTATGAATGAAACTTTAAT
GTTCTATTTTCTTGTGTGTCAGGTTTTGGCACCTATCCCTGGAGGAATACCACCACCAAC
CGGTGTTATCATACAACCTCAGCAGATCTTATTTACGGGGAACAAGACACAAGTCATACC
AACCACTGTGGCAGCTCCCACTGCAGCACAAGCACAGATCACTGCAACTGGTCAGCAACA
ACCACAGCAGCAGCCTGCCCAGCCACAAGCTCCTTTGGTGCTACAAGTAGATGGAGCTGG
AGACACGTCATCTGAAGAAGATGAAGATGAAGAAGAAGATTATGATGATGAAGAAGAGGA
TGATAAAGAGAAAGATGGAGGAGAAGATGGACAAGTTGAAGAGGTAAGTGGGGAAAATTT
GGAAATGAAAAACTAAATTGCTGATTTTTATTTTTCATATAACCTATGTATAGCATTTAT
TTGGAAAGTCAGAATTTAAGTGTTGGTTATTTAGAGCATAACTTTTAAAGAAATATTGTT
TAAAGGTCTTCATAGATCTATAGGATTGAGATTAAATTAGCTAAAATGAAAACATTTAAT
ATATCCTTTTCTTTACAGTTTAGGTTGCTATTCAACAAATTTTGTATAGTGAATAAGTAT
ATAGATATAAGATTTATGGCAGCTAAGTTATAGTATTTATGTCTATAAATACAGTTAATG
TGCCTTATTTTCAGCTCTCAGATTCCTACGATAGGCCTAAATATGTAACTTCTTTGATTG
AGCAGATAAAAGGTAGTGCATCATTTTACTAGGCTGCCTCAAATAGATGAGATTTTAAAG
AAACCCTAGATAAGCCAAATGTCTTTCATAGAAAGAATTTTTCTGTTCTTCCAATTTATT
GCTTTTGGCAATTAAAATTAAAGATAGTAAATTATTCTACCATTATATTCATATATATAA
TTTCAGAGAGCCTCAGTTTCCAGAATATTAGTAGGGTTTGATGTTAATATATAAGCTAGT
GACAAGTAAATATAAACATCTTTTCTAGGAACCCCTGAATAGTGAGGATGATGTAAGTGA
TGAAGAAGGACAGGAACTATTTGATACAGAAAATGTTGTTGTGTGCCAATATGATAAGGT
AAGAGTTTAGCAAATATAGTGGTTGTGTTGTAATTTCTCATCTTGTGTTCTTGACAACAT
TTGATTGAAATTGAATTGAAAATGCTCACACATTTGATTTTTAAATAATAAAAGTGAAAA
GACCTCTTGTGATAGTAGTACAAGCAGATACTCATCACATGGGATCTGTATGAAGTGAGA
TGGCAATTGGAATAAGAAAGTGAATACTGAGGGAAATTTAATAAAAATGGAATTTAAAGC
CCCAGTTAACTGGATAGAAGAGGAAATTTTAAAAAGAAAGCATTTATGATTACTTTAGGT
TATAGACATGGGAGATTGAGAATGGTTGCTATAGATTGAAAGTAGTAACGTATTGAGGAA
GAAAGATGAGTTTGCTTTTGTTGTTCATTTTTCAGGTCCTACTGGACCATCGAGGTAGAA
ATATCTTAGAGATAGTTAAAAATCCGGATCTGGATGACTTGGGTGTTAATTTACATATAA
ATGGTGGTTGAAACTTTGGGAATGGAGATTTCCATAGGAAGATTGTATAAAAAGGAAGAA
GAAAATTGTTGGGGAATACATTAAAGGATCAAGAAAAGATTAAAGAGCTAGCCTGAGAAC
CAAATAATATTTTGCCCCTGAAACTAATGGAGTAAAGAAAGTGTATGGGAAGAAGTTTTC
AACAAAGTCAGGTGCTGTTGAGAGATAAAAGTACACAGACTGACAGAAGCCATTGGATGT
GACTTTTGAAGTATTTAGGAACCTGTGCAAGTATGATTTCAGAGTGATGAGGACAGAAAC
CCAATTTTAAAGATTTGAGAAAATAATTTGGGGAGTGAGGAACTGGAACCAACCAGCATT
TATTTAGTGCTTGTCATGTACTAGGTACTGGGAAACAATGGTGGCGGAACAGTTGAATGG
CAGTATAGAGTAGGAGGTTGCAGGAAAAGATATTTTAGGATTAGGGATAGCTTGACCATA
TTTGTAGGCAACTGTGAAAAACCTAGTAGAGAAGAGCAAAGATTATGTGAAAGAAATGAC
AGCAGTAATAAAGTCCTGGAGGAAGTAGAAGGGGAGTAGATGGTTGATCATTGACCTATC
TAATCATTAAACTATATGTGGCTTAGGGGAAAGAGTGCCAGATTTAGGGTGGAGATTTGG
GATTTAGGAGCCCCTTTGATAGGGGCTCTAGGGCAATTGTGTGACCTTTGGGCAGGTAAT
TTACTTTGCAACTCTGCCTGTCTGTAAAATGGAAATAATACTGCCCTTACATGGCTGGAT
GAGGTTCATATAAGATGTTTAAAGAACTTGACAAACTTGAACATGACATAGATGACTATG
ACCAGTAAAAAGGAAGAGAATGGTGGGAGGTTTGGGGAAAGAAGCCTGATTAGTTTTTCT
CAATTCAAAGTGCAATCATTATGCATTTCAAAGACTAACAAATAAAACTTGAAGTTGGCT
GCAGCATTGAAAAAGTATTGGTATAGTAAAGTTTGGGATTAGAACTTCAAAGACGTTTGG
GTTTGAATTCTATTCCTGATACTTATTACCCATCACTTAACGTTTCTGAATCTCTTACTT
TCCTCACACCTGAAATAAGGGAGTTGGACTAGATTACTTCTGGTTCTAAATTTTTTGGCT
ATCATACTATAGGAATGTTGTGTATTTCTTGTCACTGGGAAAGAGAAGTCATGAATAAAT
TATTTTAAATTGTATTTAACTTTCACAGATTATATGAGTAGTTTTAAAATGTATTTGCTT
ATTATATGCTTACTAACATTAATATAAACACTAACTTTCTATGGAATTTTTAAAAAGACT
TTTTTGACTTTGTAATGAATGTCAAACATTTGGTTTATGTAGGATTTTAGTTATAGAATA
TAGTCTGGGGGGCAGCTGGGTAGCTCAGTGGATTGAGAGCCAGGCCTAGAGATGGGAGGT
CCTAGGTTCAAATGTGACCTCAGACACTTCCCAGCTGTGTGACCCTGGGCAAGTCACTTG
ACCCCCATTGCCTAGCCCTTACCACTCTTCTGCCTTGGAGCCAATACACAGTATTGACTC
CAAGACGGAAGGTAAGGGTTTAAAAAAAAAAAAGAATATAGTCTATTCTGTTATGGTCTT
GTCCCTTGCTTTTTCCTGCCTTTCTTGCTTGCTTTAGTTTGGCCCTAGAAAGATTGTGAC
TTACACCCATAGTCATATAGATAGGCAGGATAGCTAGGACTAGAATCCATATTTCCTCAT
TCCAATTACAAGATACAAAAACTATTTCAGGTGCCTGCCTTTCCCTCTCCTTGGATATTT
CACTGATCTTTCCACCAGAGGGCACCCAAAAGAAGTAGATGAAAATCCAAGCTCATAAAT
CAAAGTGCCTATTATCATTTACATCCCAGCAATGAATTTAGACATCTGAGATCAAAAGTC
CCCAATGATTAGGTATATAGCAATAATTTCAGCATGTTTTGCTCTTCCTTCAAATTAATT
GGAATGTTTTCACAAGAGTCAATTACAGTCTCTAAATATGTACATATATAATATATACAT
ATACATGCATGCCTGTACGTACATATAATTGGACTAGAAATCAACTTGGGGGTAGGAGTG
GAAGGTTGGGAGATATAATAAAGGACATCTACTTAAAGGATTGTCACATAGAGAAGAAAA
TAGATGGTCTGAACTTCAAGGATAGAATTTAGGACCAGTGGATCTGATAGTTCAGTTTTC
ATATAAGAACATCTATGCTTCAAAAAGAGAAATGACCTTCCATTGATATTTTTTTTCAGA
ACAGTGATATATTGGAAAATATCTTAAAATGCTATTATTATAATTCTGACTTAGATTCAA
GACAAAGATTTTTAGTCTTGATTCATAGATTTGACACCAAGTCATTTTGGCTCAAGTCCA
GTCCTTTTTCTGCAATGCCTTTGTTGTAGAAGGAGTTCTGTGATGTGTGAACTTTAAAAA
TATATTTTGATAACTGAGTATAATTTATTTTCTTCATAATAGTCTATTTTATTCTGTTCA
TTTAGAACATTTTAAGAAGAAAAGGGGTTTGGGGAAGGTCTATATGCTCTACCAAATTGG
CAAAATGATGGTTAGTGACACACACAAAAGGACTGAAAACACTTGATTTATAAGAGCACT
AAACTTAGAGGACCTGGCTATGCTATTTAATAGATTTGTGCCTGAGGGCTAATCATTCTC
TGGGCTTCCTTTTCAGTTTCCATGGTGATTGTAGTGCCTCACACGGTTGCTGTGGGGAAA
TTGTGTTATAAAAGTGACATTTTTTAAAAAATTCCTAGGTTAGGCATAGTGACAAACAGA
AGTAGCATAGATAATGGAGATGTTTAATTGTTAAAATTTCCATCAGACTTTTTATTAAAA
GTAGTTAGAATGAACTGGTTTTAGAATTTGCTTCTCTTATTTTCCTCCTCAGTTGAAGTA
TAGAAAATGAAGAAAAATAAAAGTGCCTCTTATTTTTTTACCCTTAATTAGCTCTCAAGC
TAATTTTAAAGGTGGCTATAATTTGTAGGAATTTAATAAAATCCATCTTAGGCCATCTAA
GAGGGACTAGTAGATAGAAGCCTTATTCTACATTCATGTGAGATACAGATAGATACACAT
CCCTGTTGCTTTGGGTAAGATCATTTGTGATAAAGAATTCACAGGGCTGAGTTATTGTTG
GGTTTTTTTGTTTTTAAACATAACAACTGCTTTTTATAACTACTTCCTTCCCTCTCATGG
CTTATATTTAGTAGATTTGTGCCTGAGGACTAATCATTTCATCTCTGAGCTTTAATTTCC
ATTTCTTTAACTAGGGATTATAGTGCTTCATATGGTAAAGAAAGTGTTTTGTAACCTTTA
AAGTAATAAAATGTCTATTATTTTTATTGTGGCTCCTAGGTTAGGCATAGTGAGAAAAAG
AGAGAGCATTGATAATAGGGATCTATTTAATTTTAAAAATTCATACTTCCTATTCTACTA
ACATTTTTATTAAAAGTAATCAGAATCAACTGGTTTTAGATTTGCTTCTTTTATTTTCCA
TCTTCATCCTCTGCTGAAATAAATAATAATCAGAACTCTTTTATCTTCATTGAATCCTTT
CTTGTAAGAAAAAAAAACTGGTCACAGTGGCCAGGTTTGACAGTATATATACTTAATTCT
AGATGCATAGTCTCTACATATAGTCTCATTCTCTAGACTCCTCCCTCCATCCCACCATAG
ACATATACTGCAAATTAGAGGAATGTATTTGTTAACCCAGGTCTCTGGGACTTAGATTAT
TTATTACAATTTGTCTTGATTTACTTTTTTTTTAAATAAGGCAGACTTACCAAACAAATG
GAATATGATGTCCTATTAAAGTTTTTTTTTTAATTCTTTCTCATAATTTCTTTGTATTCT
TATTTTCATCTTATTTTGTTTGTTTAGATCCACAGAAGTAAAAACAAGTGGAAGTTTCAC
CTCAAAGATGGCATTATGAATCTTAATGGAAGAGATTATGTATTTTCCAAAGCCATTGGA
GATGCTGAATGGTGAAGAATTGCCTTTTTTAAAAATAATAATAAAACAAAAAAAAGGATT
CTTAAAGCTGGACTGGTTGAAAACCTAGGACATTATACTTCAACCAAAATTTACTTCTGC
ATGTCAGAAAAGTATGGTAGAAGCAAAGCTACTGGAACAAAGATTGACCATGACAACGTA
GACACTACTTCAGACTGGCAAGCCATGGAACTGTAGCACCTGATGTTGTTGGGAGCTGAA
TTTTTGTTAGGAATACCATAATTACCACTTCAACATACAGGTACCTACAGCCAGTAATTA
GCATGTTAGGCTTTGTTGCCATCTTTTCCCCTCTATCTTGTTAAATCAGAAAATATTTCT
TGGAACAAATTGAAGGAACCTCTTCCCTTTTGATAGACTGATCTGGAACTTCTTGTGTGT
GGTCATTATATTGATTAAATTTGTGTGTGGGCTTTTTACAAAAGGGAAAGAATTATGGTG
TTGAATTAAAATTATCTTGTATAAGGAAAAGATTTAAAATTCTATTTGATAGGTCTTAAG
TAATTTTACTTGCCATTCTCCCTCAGTGATATTCCTTCCATATACCGACCCTATCCTTTT
CTCAGCATCTATATAATAAAGAAAAGAATATAATCAGTGATAATATTCATAAGATCATAG
ACTTAGAGCTGGAAGGGACCTTAGAGATCATCTTACCAGTACCTCATTTTATAGATGCTG
GAATTTGAACCCAGGTTCTTTGCTAAATTTGGACTCTTGTTATTATACCACATTGCTTTC
CCAATTAAATTCAGTTTGGAGACCACATCTTTATTTGACCTAAAACTCAAGTTTTCTTAA
TCTGTTAAGTATAATTCAAAAACATTTCACAGGAGTTGAGAGGAAATACAGTGGTAAGTT
TAATTTCCTTAAAGAGGGCTTGTTCCCCCTTCCCCATCCTTTTTACCCCTTTTAAAGCCA
AATTGGCTCCTCAGGAATAGTTTGTTTCAAAGGGTACCATCTGATTGAAGTGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 7091..7192, 26034..26105, 26169..26241, 30829..30893, 31579..31654, 34418..34551, 40642..40865, 41033..41064, 41391..41443, 41608..41697, 46107..46214
1001..1030, 7091..7192, 26034..26105, 26169..26241, 30829..30893, 31579..31654, 34418..34551, 40642..40865, 41033..41064, 41391..41443, 41608..41697, 46107..46211
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved