Monodelphis_domestica Locus RPL4
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica RPL4
Monodelphis_domestica
RPL4
1
SNORD16
1846..1946
7842
CTAAACCGCGCTTAATCCTGGTAAACTCCTAGGGCTGCTGGTTGCTTAGGGCGCCAACC
CTTCGTCTATAGATGAGGGGCCCGCAAAAGGGGGGTTCCCAGCCCAGGCCCGTTCAGCAG
AAACAATAAGGGCGTCATCAGCGATGATTTTCAGGAGAGAGGCTAGCCCCTGGAGGCCCC
CGACCTTGCCAGAAAGTCCTGGCAGTGGCTTCAGGCTAGGGAGACCAGCAGGGAGCACGC
AATTAACGGCCCTGAATAAAGGGGGGGGGGAGGCGAGAGGCCTGAAGCCCGAGGCCCAAG
GCGCGGGTGACGGCCTGGGCTAGTCGATTGCTGAGCCCGTTCTCATTGCACCGACCGAGA
CGGAGTCAGACAAAGAGAAGGGAACCGAGAGACGCCATGGATCAGGGAGATGACTCACTG
AATAAGAAGGTTGTACAGGCTCGCGGCCGCTTGATTCGTGTCGGGCAGCATTGCGTCTCG
AAGATGCTCGAAGCAGAGATGCTAAAAGACGAGATGCCAAGCCACGTCTGAGCTCCAGAA
CTCGCCCAGTCGCTGACGTCACAGGGTCATGACTCGCCCCGCCCCAACCGGACTACATTG
TGCCTTGAAAGGAACTAATAAGTCTTCTCTACTACTTTTTAAAATAATTTCATTATACAC
AATGCGTTTTATCATATAAATAATATACACTTTTCGTCTGAAAAAAATAAATGCTAATAA
CGTCGAAGAAGATTTTTTACGCGTGACATCATACCCCACCCCCTTTAGGATCACTCCGCA
AAAAATGAGTCCCTGAAGTTTAAACCATATTGGAGGCTTCAAAATTGTTTTAATAGACTA
ATTTTACTCATAGAGGAAATAATTGTATATTTGGAAGATAAATATGGGGTACATAACCGT
TCCACTCCTTTTCATTGTTTCTTAACTGTTATAGCGCGCAGGGGGAGGGATACATATAAC
TGTAAGTCGGTGCTCTGAATTTCCTTTTCCTGTGGGAGCCATCGGGCGGAGAGGAGCGTG
GCTCTTACTCTCCGGTACCCGCCATGGTGAGTGACTGCCTTTTTGGGGGACATCACCCAG
ACTAATCAACTAGGATGAGAGACTTGGGGCTCCAGACAGCGGAACTCAGGCGAAAGGAAG
CAGAGAGAAAACCTAGAGTCCTGAAAAACTCCTGTGGCGAGGGGTGGGTTGTGTGGCAAA
AGGGCAGCCATCTTAGAAGCAACGTGTTCGCGGGAGCAGGCAAAGAAATTGGCATAACTG
CCAGGGTGTGCGAACTATGCGTTTTTAAAGGATGAGGGCACCCTGTTATTGTTGGTTTAC
TGAGCCTCTTGGGTTCCGAGCGGCCCAGATTCGGTAAAGCGCTTTTAGTGGAGCCTGGGA
CCCCATGTTGGAATGAATTTGAGGAAAGGAAGTGTGCTTTAAGGCCTTCTCTGTGTTTAG
AGTATCGATGTCACATGGTTTTAGAGAGGTATTTTTTTTTTAAATCGAGTTTATGAATTT
GCCAATAATATCATAACTTAGTGCATTAAGGCTTATGGTACAATAAGTAGTTTAATCTGA
TTGGTGTAGTTCATCTCTTAATTGAAAGAGAACTGTAATGTTGATGTATTTAATGGCGTC
CTGACCTTATAGAAACTTGATCCAGAACAAGTTTTATTTACTTGGCTTACTTTGAATGAA
TCACTAATAAAATTCAGACGATCGTATTGAAATCTTAAATAACATATTTGGCTGCTTGCT
TGTTAAATTGATTTGAAGATGTTCTGTGGAGCTGGTTCCATTTAAGTCTCTAAAAGGGAC
TTCGGAACATTAAAATTTAATGTTAAAAATTGCTGGGAAGACTCATTGCTATGATGTCGT
AATTTGCGTCTTACCTAGCGTTCAGTGACAGTTGCCTGCTGTCAGTAAACTGGCGCTTTC
TGGGTGAAGACTACTTGTAACTGAGCAATGTGTATGAGACTGAGAAATAGAAAATGGCTA
GGTTTCTTCCTAATATGTGTTCATTTTTCTTTCTTAGGCTTGTGTACGGCCCTTGATATC
TGTGTACTCTGAAAAGGGGGATGTATCTGGCAAAAATGTTACTTTGCCTGCTGTCTTCAA
GGCTCCAATTCGTCCAGATATTGTAAATTTTGTTCATACCAACTTGAGAAAAAATAACCG
GCAACCTTATGCTGTCAGTGAATTAGCAGGTATGGCCACATAAACATACATCTTGGGTTA
TGATTGTAAAAACAAAACAAAAATTTGGAGAAGTATTGGCTTTAAAAGCCAAAAAACTCC
ACCCACCTTTTAATTGTGGCTATAATTAAAATTTTGTATGAGTTGTCTGAGGTGTGGCTG
CAAAGGGAAGCTGTTCAGTGCTACACAGAAATGATGAGATTTCCACTTCATTGGTCCGTG
TTTCTGAACCACATGATTTTTCTGGAAGTTCTGATAGTGTGCACTCTGCATTCACCTAAG
TATTTTTAATGTAAATCACTTGCTCTCTCTTACCCTTTATCTTTATTTTTTCAGGTCATC
AGACCAGTGCTGAGTCTTGGGGAACTGGCAGAGCTGTTGCCCGAATTCCTCGAGTTCGGG
GTGGAGGGACTCATCGCTCTGGCCAGGGTGCTTTTGGAAATGTATCCTAATTCTTTGGTT
TTTTGTTTGCTAAAGATAAATCAGTGATTGAGGGCAGCTAGGTGGCTCAGTGAGTTTGAG
AGTCAGGGCCTAGAAACTGGCATCCTGGGTTCAAATTTGACCTCGGGTATTTCTCCAGCT
GTGTGGCCCTAAACAGGTCACTTAACCCCCATTTCCTAGCCCTTACTGCTTTTCTTCCTT
TGAACCAATACACAGTATTGATTCTAAGACAGAAGGTAGGGGTTATTTAGGAAAGAAATT
AATGATCAAAATTACTTTGGTATAAACCTGTTTTATGGTATTAGCTATATGTGCTTGTGC
TGTTTTTTAGGGCAATCTTATGAAGTGGTTAGTGAAACTGTGTGCTTAGGCCTAGGTAAA
GGCATTTCCCATGGCTTTGCATTTAGTAAATACTGAATATTTAATTATAAAGAGGGGCAG
CTGTGACATAAAAAAATTTTTTTAACTTGCTGTGATGCTGTAATTTGCGCCTTACTCTGT
TCTCAGTGACAGTTGCCTGCTGTCAATAAGCTGGTACAGAAGGTTGCTGAAAATGTTTTT
CTGAGCAAGACCTAAGTAAAGGTTTTTTTAATCTTTTAAGTGGTAAATTTGATTTCTTGA
CTGGAAAATAGATGTGCCGAGGAGGTCGCATGTTTGCTCCCACCAAGACTTGGCGCCGTT
GGCATCGGAGAGTGAACACAACACAAAAACGTTATGCCATTTGTTCTGCCTTGGCAGCCT
CTGCCCTGCCAGCATTGGTGATGTCAAAAGGTATGTTTGGCTGGAATGGACTTTGCTATA
GCATTATAAGCCTCATTCTCTCATTTTGGGTGTCCAATTATATTACCTTATTTGAAACAG
ATTCACTAATATGTTTGGTGACAAAAGAAATAAATTGGATTCTGATTATGTCTTTGTCAC
ACTTTGTGTGTGACTTTAAATATTGCCTGGGTTTGGTTCAGTTACCCCTATAAAGTGTTG
AGAACTGAAATTCTATCACATGGGATCCATATTTTGGGAACCAGGAATTTCAGGGAAGGG
AAGAAAGGAGAATAAGCATTTATGTAGCACCTATTATGTGCCAAGCACTTCATAATAAAT
ATTATTTCATTTGATCCATCTAACAGCCCTGCATGGTTGATGCTGTTTTGTCCCACATTT
TACAGATGAGGAAACTTTAACAGGTTCAGTGACTTGGCTTAGGATCACAGTAAGAGTGAG
GCCAGTTTTCAGCTCTGGGCTTCCTGGTTGCCAGTTTTCTATTCAGCCACCAACTGCCAC
GGTCTTATTATTGTATAAATTGTTTTGTGTCTTATAATTGATTTCAAATGACTAGGGAAA
ATTCCTTGAACTTTTACTATGGAATAGTTGTAGATTCAAAATAATTGATTTTACTCAGGT
CACCGAATTGAAGAAGTTCCAGAACTTCCTCTAGTGGTTGAAGATAAAGTGGAGGGTTAT
AAGAAGACCAAGGAAGCAGTTCTGCTGCTTAAGAAGCTGAAGGCATGGAATGACATCAAA
AAGGTGACTCAATTGGACACACTGTATCATGTCTTCCCATAGTGGTAAACTAAAATGATA
AAAAGTTCAGATTTTATTCAAATCTTACTTTAGAAGCAGTATACTTTAATGAACTAGATT
TGGGGAATTAAGAGGATTTCCTTAACCTTGAAATCTAATACTTTTGTAAGTCACTTAACC
TCATCTAAGAGTAAGCCTTTCTTCTATAAAATGGAATTTCTAATCCCTGTGTAAACCTTG
ATAATGGGCAAAGAATACAAAAATGAAGTATTTACTTTCAAGGAGCTTATATTACATCAG
GCAAGGGGACATAAAGAAGACAATTTTGGAAGTGAATCTAATGGGTGAATTGGGAGTGTT
CATCTTAGGGGGAGATCCCATTCTGAAAGAAGAGAAGTTCCAGGTATTGAGGAGTATCCC
AGTGCAAAGGCATACAAGGGGAGATAGTAATATATGAAGAAAACAGCTGAAAGAGTCAGT
TTGGCTGGACCTGAGGGTTAGGAAGTTGAAATTGAAAAGCTAGATTAGCTTTCAGGACTC
AAGTTTATTCACATCCGAATAAAACTGGTTTCTTTTATCCCAATATGGGGAATAGCCTTG
TAATGATGATATTCCACTTCATGGTCCGTGTTTCTGAAACAATGTGATTTTGTGGAAGTT
CTGAAACTTGGTTGATGGGCTATTAATACACTGGAAAACCCTTAAATCTGTGATGCATTA
ATTTTCTTCAGTTTGAGTTAATTGTTCCTTATTGCTATTTAAAATGTGAAATTATGCAAA
TAAGTTGCCCCATGAAAGACATTTCCTTTTTCTTTCATTTAAAAGGTCTATGCTTCTCAG
CGTATGCGAGCTGGTAAGGGTAAAATGAGAAACCGTCGTCGTATCCAGCGTAGGGGACCT
TGTATCATCTACAATGAAGACAATGGTATTATCAAGGCCTTCAGAAACATTCCTGGTAAT
TTTTAAAATTTTATTTAAGCACTTACCTTCCCTCTTGGAGTCAATATGATATATTGGCTC
CAAGGCAGAAGAGTGGTCAGGGCTAGGCAATGGGGGTTAAGTGAGTTGCCCAGGGTCACA
TAGCTAGGAAGTGTCTTGAGTCCAAATTTGAATCTAGGAACTATAGTCTCTAGGCCTGGC
TCCCAATCCACTGAGCCACCCAGCTCCCACCCCCCCACCCCGCCCCTGACAATTTTAAAG
ATTATGTTCCCATTAAAGTAAGACCTAGGAAGTTTTTTTCCTCTGAATATAGAAAACAGT
TTTGTAATGAAGAGATTCATTTCGTGGTCTCTTTTCTTTTCTTTTTTTTAAACCCTTACC
TTACGTCTTGGAGTAAATACTGTGTGTTGGTTCCAAGGCAGAAGAGTGGTAAGGGCTAGG
CAGTGGGGGTCAAGTGACTTGCCCAGGGTCACACAGCTGTGAAGTGAAGAGGCCAGATTT
GAACCTAGGACCTCCCGTTTCTAGGCCTGGCTCTCAATCCACTGAGCCACCCAGCTGCCC
CCAGTCTCTTTCTTAAATATGTGATTCTGTTGGATGTTATAATTGACTGATGCCAATACC
TGCATTGGAAAGAACTTTGTGGTGTATTATTACACTTAAGCCTAATAGTTGTTTTAAAGT
CCTCTTAATGTATTTGGCACACAGAAAAAAGGTTAGTGGTTAACTAAAAACTCTACCTTA
CAGGTATTACTCTCCTTAATGTAAGCAAATTGAACCTATTGAGACTTGCTCCTGGTGGGC
ATGTTGGGCGTTTCTGTATTTGGACTGAAAGTGCCTTCCGTAAGTTGGATGAGCTGTATG
GTACATGGCGCAGGCCTGCTACCCTGAAGAGTCATTACAAGTAAGTATTTTCAAAGTATT
TAGTATTCCTGAAATAAGAAAATTAGCAGGAATGATGAGTTTCCACTTCATTGGTCCGTG
TTTCTGAAGCCCATGATTTTAGTGGAAGTTCTGATTCTCGTCTTTGGTAAAATTTAACTA
AAATTGTCAGGATTTTCAGTTTAACCACAAAACAGTATGATTTCATAATAAACATGAATT
TTCTCCCCTTTCAGTCTTCCAATGCACAAGATGACCAACACAGACCTTACCAGGATTTTG
AAAAGCCCAGAAATCCGTAGGGCCCTCCGTGCACCACGGTAATTGTTATTACATTTCATA
GTTATTGGCATCTAACCTAATAATTGTAGCCTGGCTTTAGTATGTTGGTGATGGAATGAA
ATTTATGCTATTATAAAATGTCCCCTTTACAGCAAAAAGATTCATAGACGAGTACTTAAG
AAGAATCCTCTGAAGAACTTGAGGATCATGGTGAAACTAAACCCATATGCCAAGACAATG
CGCCGAAATACAATTCTACGCCAAGCTAAGAATGTGAGTAAATCAAATTAAATATGTTGG
TTTTGTTCTTTCATGAAGTTTTTTGGTTCTCATTTTCTTCCCAATCTTTTGCAGAGGAGA
ATCAGAGAAAACAAAAGAGCTGCTGCACTAAAGAAGATTATGGAGGCAAAGAAGGCAATA
GATGAGAAGAAGAAGAAAAAGCTTGGTGGAAATAAGAAGCTTGGAGGAGCAAAGAAGGTT
ACTGGGCAGAAGAAACCAGCAGAAAAGAAGATTGGAGAAAAGAAGGCTCCTGCGGCAAAG
AAGCCTGCAGAAAAGAAGCCTGCGGTAGAAAAGAAAGCACCAGCCCAGAAGAAACCTGCA
GCTGAGAAGAAACCTGCAGCATAAACTCAGCTTACTACTTTATTCATTGGCCCTTAAATC
CATTATGTCCATAATGTCAAATTTCTAATGAATAAATACTCTAAAGTGGTTTGGGGGGGA
AAGAAACTGAAAAAATTCCTGTTTCTTTTCATAAATACAAATCTTTCAACATTTCATGTC
AGTGTTAGAAAATGGTTAATTGATACTTTATTCTAGCTGCTAAACAACAAAGTGGGCTTT
TTAAAAAGTTTTTAGATGGGCTTAGCTGGGTAAATACTCATAAAAGTTGAGAACTTGATA
TTTTTACCAGTCAAAAGACTGCTTGGTACTTCTAATATAAAGCCAGTTCCATAGGGGAGA
CTGCCTGGGTGTGATGCGAAATGGACTATAAACCGGAGGTGCTTTGGGGAGGGCAAGGGG
ACAATCATCTGGTCTGTACTAAGAAGGGGCTGGCAGGAGGCTGGGTGGTGACAAAAGGCC
CGATTGCGGAGCAAGGAGATGGTGGCCCAGTCATCGCTAGGGGGCCCCCTTGTTCTAGGA
AATTGTCAACAGTCAGGCTTCCTGTTACCAAGGAGACGGTACGGAGGCCCTCTAGCTTGC
TGCATATGAAACGTCACTCCGTGAATGATTTATGTGGGGTGCACTCTCGGGATTGGGCTT
TTAGCGCTTACGAAATGTTGGTCAGTTTCTCCAAGCTGGTACTTGGGCCCAAACTCCCCA
GGTGCTGATGGGAGGGCAGGGGCGCTTCCACTTCTAGGAAACTCAAGGAGGCAAAAGAAT
TCATGCCTCCCTCCGAAACAGGTTCCGGTTGTACACTAGGAGATCCCCTAGTGGGAAGGT
CGGAAACCGGAAGTGATTCCCCCGCCCCTTTCTAACATGCCCGTTTGCCCGTCCTCTTCC
GCATGGGGTTTCGTCGTCAGACAGCGTCCCATCGGGCGCGGCCTGACCGAGGGAGGTTCG
GCGAGGGCGACAGGCAGGAAAGATGTTGAGCCGACTGCAGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 2017..2188, 2514..2620, 3251..3389, 4018..4142, 4965..5064, 5823..5979, 6194..6277, 6392..6512, 6594..6842
1001..1045, 2017..2188, 2514..2620, 3251..3389, 4018..4142, 4965..5064, 5823..5979, 6194..6277, 6392..6512, 6594..6842
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved