Monodelphis_domestica Locus RPL4
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica RPL4
Monodelphis_domestica
RPL4
1
SNORD18, SNORD16, SNORD18, SNORD18
1349..1421, 2071..2170, 3721..3791, 5010..5081
6847
GTGGCTCTTACTCTCCGGTACCCGCCATGGTGAGTGACTGCCTTTTTGGGGGACATCAC
CCAGACTAATCAACTAGGATGAGAGACTTGGGGCTCCAGACAGCGGAACTCAGGCGAAAG
GAAGCAGAGAGAAAACCTAGAGTCCTGAAAAACTCCTGTGGCGAGGGGTGGGTTGTGTGG
CAAAAGGGCAGCCATCTTAGAAGCAACGTGTTCGCGGGAGCAGGCAAAGAAATTGGCATA
ACTGCCAGGGTGTGCGAACTATGCGTTTTTAAAGGATGAGGGCACCCTGTTATTGTTGGT
TTACTGAGCCTCTTGGGTTCCGAGCGGCCCAGATTCGGTAAAGCGCTTTTAGTGGAGCCT
GGGACCCCATGTTGGAATGAATTTGAGGAAAGGAAGTGTGCTTTAAGGCCTTCTCTGTGT
TTAGAGTATCGATGTCACATGGTTTTAGAGAGGTATTTTTTTTTTAAATCGAGTTTATGA
ATTTGCCAATAATATCATAACTTAGTGCATTAAGGCTTATGGTACAATAAGTAGTTTAAT
CTGATTGGTGTAGTTCATCTCTTAATTGAAAGAGAACTGTAATGTTGATGTATTTAATGG
CGTCCTGACCTTATAGAAACTTGATCCAGAACAAGTTTTATTTACTTGGCTTACTTTGAA
TGAATCACTAATAAAATTCAGACGATCGTATTGAAATCTTAAATAACATATTTGGCTGCT
TGCTTGTTAAATTGATTTGAAGATGTTCTGTGGAGCTGGTTCCATTTAAGTCTCTAAAAG
GGACTTCGGAACATTAAAATTTAATGTTAAAAATTGCTGGGAAGACTCATTGCTATGATG
TCGTAATTTGCGTCTTACCTAGCGTTCAGTGACAGTTGCCTGCTGTCAGTAAACTGGCGC
TTTCTGGGTGAAGACTACTTGTAACTGAGCAATGTGTATGAGACTGAGAAATAGAAAATG
GCTAGGTTTCTTCCTAATATGTGTTCATTTTTCTTTCTTAGGCTTGTGTACGGCCCTTGA
TATCTGTGTACTCTGAAAAGGGGGATGTATCTGGCAAAAATGTTACTTTGCCTGCTGTCT
TCAAGGCTCCAATTCGTCCAGATATTGTAAATTTTGTTCATACCAACTTGAGAAAAAATA
ACCGGCAACCTTATGCTGTCAGTGAATTAGCAGGTATGGCCACATAAACATACATCTTGG
GTTATGATTGTAAAAACAAAACAAAAATTTGGAGAAGTATTGGCTTTAAAAGCCAAAAAA
CTCCACCCACCTTTTAATTGTGGCTATAATTAAAATTTTGTATGAGTTGTCTGAGGTGTG
GCTGCAAAGGGAAGCTGTTCAGTGCTACACAGAAATGATGAGATTTCCACTTCATTGGTC
CGTGTTTCTGAACCACATGATTTTTCTGGAAGTTCTGATAGTGTGCACTCTGCATTCACC
TAAGTATTTTTAATGTAAATCACTTGCTCTCTCTTACCCTTTATCTTTATTTTTTCAGGT
CATCAGACCAGTGCTGAGTCTTGGGGAACTGGCAGAGCTGTTGCCCGAATTCCTCGAGTT
CGGGGTGGAGGGACTCATCGCTCTGGCCAGGGTGCTTTTGGAAATGTATCCTAATTCTTT
GGTTTTTTGTTTGCTAAAGATAAATCAGTGATTGAGGGCAGCTAGGTGGCTCAGTGAGTT
TGAGAGTCAGGGCCTAGAAACTGGCATCCTGGGTTCAAATTTGACCTCGGGTATTTCTCC
AGCTGTGTGGCCCTAAACAGGTCACTTAACCCCCATTTCCTAGCCCTTACTGCTTTTCTT
CCTTTGAACCAATACACAGTATTGATTCTAAGACAGAAGGTAGGGGTTATTTAGGAAAGA
AATTAATGATCAAAATTACTTTGGTATAAACCTGTTTTATGGTATTAGCTATATGTGCTT
GTGCTGTTTTTTAGGGCAATCTTATGAAGTGGTTAGTGAAACTGTGTGCTTAGGCCTAGG
TAAAGGCATTTCCCATGGCTTTGCATTTAGTAAATACTGAATATTTAATTATAAAGAGGG
GCAGCTGTGACATAAAAAAATTTTTTTAACTTGCTGTGATGCTGTAATTTGCGCCTTACT
CTGTTCTCAGTGACAGTTGCCTGCTGTCAATAAGCTGGTACAGAAGGTTGCTGAAAATGT
TTTTCTGAGCAAGACCTAAGTAAAGGTTTTTTTAATCTTTTAAGTGGTAAATTTGATTTC
TTGACTGGAAAATAGATGTGCCGAGGAGGTCGCATGTTTGCTCCCACCAAGACTTGGCGC
CGTTGGCATCGGAGAGTGAACACAACACAAAAACGTTATGCCATTTGTTCTGCCTTGGCA
GCCTCTGCCCTGCCAGCATTGGTGATGTCAAAAGGTATGTTTGGCTGGAATGGACTTTGC
TATAGCATTATAAGCCTCATTCTCTCATTTTGGGTGTCCAATTATATTACCTTATTTGAA
ACAGATTCACTAATATGTTTGGTGACAAAAGAAATAAATTGGATTCTGATTATGTCTTTG
TCACACTTTGTGTGTGACTTTAAATATTGCCTGGGTTTGGTTCAGTTACCCCTATAAAGT
GTTGAGAACTGAAATTCTATCACATGGGATCCATATTTTGGGAACCAGGAATTTCAGGGA
AGGGAAGAAAGGAGAATAAGCATTTATGTAGCACCTATTATGTGCCAAGCACTTCATAAT
AAATATTATTTCATTTGATCCATCTAACAGCCCTGCATGGTTGATGCTGTTTTGTCCCAC
ATTTTACAGATGAGGAAACTTTAACAGGTTCAGTGACTTGGCTTAGGATCACAGTAAGAG
TGAGGCCAGTTTTCAGCTCTGGGCTTCCTGGTTGCCAGTTTTCTATTCAGCCACCAACTG
CCACGGTCTTATTATTGTATAAATTGTTTTGTGTCTTATAATTGATTTCAAATGACTAGG
GAAAATTCCTTGAACTTTTACTATGGAATAGTTGTAGATTCAAAATAATTGATTTTACTC
AGGTCACCGAATTGAAGAAGTTCCAGAACTTCCTCTAGTGGTTGAAGATAAAGTGGAGGG
TTATAAGAAGACCAAGGAAGCAGTTCTGCTGCTTAAGAAGCTGAAGGCATGGAATGACAT
CAAAAAGGTGACTCAATTGGACACACTGTATCATGTCTTCCCATAGTGGTAAACTAAAAT
GATAAAAAGTTCAGATTTTATTCAAATCTTACTTTAGAAGCAGTATACTTTAATGAACTA
GATTTGGGGAATTAAGAGGATTTCCTTAACCTTGAAATCTAATACTTTTGTAAGTCACTT
AACCTCATCTAAGAGTAAGCCTTTCTTCTATAAAATGGAATTTCTAATCCCTGTGTAAAC
CTTGATAATGGGCAAAGAATACAAAAATGAAGTATTTACTTTCAAGGAGCTTATATTACA
TCAGGCAAGGGGACATAAAGAAGACAATTTTGGAAGTGAATCTAATGGGTGAATTGGGAG
TGTTCATCTTAGGGGGAGATCCCATTCTGAAAGAAGAGAAGTTCCAGGTATTGAGGAGTA
TCCCAGTGCAAAGGCATACAAGGGGAGATAGTAATATATGAAGAAAACAGCTGAAAGAGT
CAGTTTGGCTGGACCTGAGGGTTAGGAAGTTGAAATTGAAAAGCTAGATTAGCTTTCAGG
ACTCAAGTTTATTCACATCCGAATAAAACTGGTTTCTTTTATCCCAATATGGGGAATAGC
CTTGTAATGATGATATTCCACTTCATGGTCCGTGTTTCTGAAACAATGTGATTTTGTGGA
AGTTCTGAAACTTGGTTGATGGGCTATTAATACACTGGAAAACCCTTAAATCTGTGATGC
ATTAATTTTCTTCAGTTTGAGTTAATTGTTCCTTATTGCTATTTAAAATGTGAAATTATG
CAAATAAGTTGCCCCATGAAAGACATTTCCTTTTTCTTTCATTTAAAAGGTCTATGCTTC
TCAGCGTATGCGAGCTGGTAAGGGTAAAATGAGAAACCGTCGTCGTATCCAGCGTAGGGG
ACCTTGTATCATCTACAATGAAGACAATGGTATTATCAAGGCCTTCAGAAACATTCCTGG
TAATTTTTAAAATTTTATTTAAGCACTTACCTTCCCTCTTGGAGTCAATATGATATATTG
GCTCCAAGGCAGAAGAGTGGTCAGGGCTAGGCAATGGGGGTTAAGTGAGTTGCCCAGGGT
CACATAGCTAGGAAGTGTCTTGAGTCCAAATTTGAATCTAGGAACTATAGTCTCTAGGCC
TGGCTCCCAATCCACTGAGCCACCCAGCTCCCACCCCCCCACCCCGCCCCTGACAATTTT
AAAGATTATGTTCCCATTAAAGTAAGACCTAGGAAGTTTTTTTCCTCTGAATATAGAAAA
CAGTTTTGTAATGAAGAGATTCATTTCGTGGTCTCTTTTCTTTTCTTTTTTTTAAACCCT
TACCTTACGTCTTGGAGTAAATACTGTGTGTTGGTTCCAAGGCAGAAGAGTGGTAAGGGC
TAGGCAGTGGGGGTCAAGTGACTTGCCCAGGGTCACACAGCTGTGAAGTGAAGAGGCCAG
ATTTGAACCTAGGACCTCCCGTTTCTAGGCCTGGCTCTCAATCCACTGAGCCACCCAGCT
GCCCCCAGTCTCTTTCTTAAATATGTGATTCTGTTGGATGTTATAATTGACTGATGCCAA
TACCTGCATTGGAAAGAACTTTGTGGTGTATTATTACACTTAAGCCTAATAGTTGTTTTA
AAGTCCTCTTAATGTATTTGGCACACAGAAAAAAGGTTAGTGGTTAACTAAAAACTCTAC
CTTACAGGTATTACTCTCCTTAATGTAAGCAAATTGAACCTATTGAGACTTGCTCCTGGT
GGGCATGTTGGGCGTTTCTGTATTTGGACTGAAAGTGCCTTCCGTAAGTTGGATGAGCTG
TATGGTACATGGCGCAGGCCTGCTACCCTGAAGAGTCATTACAAGTAAGTATTTTCAAAG
TATTTAGTATTCCTGAAATAAGAAAATTAGCAGGAATGATGAGTTTCCACTTCATTGGTC
CGTGTTTCTGAAGCCCATGATTTTAGTGGAAGTTCTGATTCTCGTCTTTGGTAAAATTTA
ACTAAAATTGTCAGGATTTTCAGTTTAACCACAAAACAGTATGATTTCATAATAAACATG
AATTTTCTCCCCTTTCAGTCTTCCAATGCACAAGATGACCAACACAGACCTTACCAGGAT
TTTGAAAAGCCCAGAAATCCGTAGGGCCCTCCGTGCACCACGGTAATTGTTATTACATTT
CATAGTTATTGGCATCTAACCTAATAATTGTAGCCTGGCTTTAGTATGTTGGTGATGGAA
TGAAATTTATGCTATTATAAAATGTCCCCTTTACAGCAAAAAGATTCATAGACGAGTACT
TAAGAAGAATCCTCTGAAGAACTTGAGGATCATGGTGAAACTAAACCCATATGCCAAGAC
AATGCGCCGAAATACAATTCTACGCCAAGCTAAGAATGTGAGTAAATCAAATTAAATATG
TTGGTTTTGTTCTTTCATGAAGTTTTTTGGTTCTCATTTTCTTCCCAATCTTTTGCAGAG
GAGAATCAGAGAAAACAAAAGAGCTGCTGCACTAAAGAAGATTATGGAGGCAAAGAAGGC
AATAGATGAGAAGAAGAAGAAAAAGCTTGGTGGAAATAAGAAGCTTGGAGGAGCAAAGAA
GGTTACTGGGCAGAAGAAACCAGCAGAAAAGAAGATTGGAGAAAAGAAGGCTCCTGCGGC
AAAGAAGCCTGCAGAAAAGAAGCCTGCGGTAGAAAAGAAAGCACCAGCCCAGAAGAAACC
TGCAGCTGAGAAGAAACCTGCAGCATAAACTCAGCTTACTACTTTATTCATTGGCCCTTA
AATCCATTATGTCCATAATGTCAAATTTCTAATGAATAAATACTCTAAAGTGGTTTGGGG
GGGAAAGAAACTGAAAAAATTCCTGTTTCTTTTCATAAATACAAATCTTTCAACATTTCA
TGTCAGTGTTAGAAAATGGTTAATTGATACTTTATTCTAGCTGCTAAACAACAAAGTGGG
CTTTTTAAAAAGTTTTTAGATGGGCTTAGCTGGGTAAATACTCATAAAAGTTGAGAACTT
GATATTTTTACCAGTCAAAAGACTGCTTGGTACTTCTAATATAAAGCCAGTTCCATAGGG
GAGACTGCCTGGGTGTGATGCGAAATGGACTATAAACCGGAGGTGCTTTGGGGAGGGCAA
GGGGACAATCATCTGGTCTGTACTAAGAAGGGGCTGGCAGGAGGCTGGGTGGTGACAAAA
GGCCCGATTGCGGAGCAAGGAGATGGTGGCCCAGTCATCGCTAGGGGGCCCCCTTGTTCT
AGGAAATTGTCAACAGTCAGGCTTCCTGTTACCAAGGAGACGGTACGGAGGCCCTCTAGC
TTGCTGCATATGAAACGTCACTCCGTGAATGATTTATGTGGGGTGCACTCTCGGGATTGG
GCTTTTAGCGCTTACGAAATGTTGGTCAGTTTCTCCAAGCTGGTACTTGGGCCCAAACTC
CCCAGGTGCTGATGGGAGGGCAGGGGCGCTTCCACTTCTAGGAAACTCAAGGAGGCAAAA
GAATTCATGCCTCCCTCCGAAACAGGTTCCGGTTGTACACTAGGAGATCCCCTAGTGGGA
AGGTCGGAAACCGGAAGTGATTCCCCCGCCCCTTTCTAACATGCCCGTTTGCCCGTCCTC
TTCCGCATGGGGTTTCGTCGTCAGACAGCGTCCCATCGGGCGCGGCCTGACCGAGGGAGG
TTCGGCGAGGGCGACAGGCAGGAAAGATGTTGAGCCGACTGCAGGAGCTCCGCAAGGAGG
AGGAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1172, 1498..1604, 2235..2373, 3002..3126, 3949..4048, 4807..4963, 5178..5261, 5376..5500, 5603..5668, 5693..5847
1001..1172, 1498..1604, 2235..2373, 3002..3126, 3949..4048, 4807..4963, 5178..5261, 5376..5500, 5603..5668, 5693..5844
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved