Monodelphis_domestica Locus ENSMODG00000009316
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000009316
Monodelphis_domestica
ENSMODG00000009316
1
SNORA19, SNORA19
22185..22317, 25101..25231
35719
CGACACAGGATGGAGGCCAAGGACACAAAACTAGGACAGAGCCAGGATAGAAACAAAGG
TCACCCAACACTTGGTCTAGTGCTATTAAATTTTTATTATCAAAAATATTAACATTTAAT
TTTCTTTTTACTCCTAACTTAACAATGACCTAATAAAACAAGCACTCTGTACAACGGGGA
CGAGGAGAATTGTATATGAAACTGCTTTCTGTCCATCATGAATCACTATATTTTAAGCAC
TTGGAGTATGGGGGTTTATGCACTCACTTTTTTAGGAGAATGATTCTTAATGAAAAAAAA
GCACTTGTTGACTTCTTAGACTAAGGTTAACAGTTACCCTTCCCCTACCGTGCATCACAT
ACCAAACGATGCGAGGAAGGTGTCTGTGTACAAAGATAAAGCGAAAAAGACTCGACAAAG
CTTTAAAAGGAGACCTACAAGCTTTTAGCAGAGATAACACCAATGAGTCTGATATGGGCA
CTTTTATGTGAGGGTATGAGCTGAAGCACCACCTCCCTCCTTTTAATTTAACAATTGTGA
TTGTTTTAAACACGTTTCTTTGTGAATGACAGACTATGATCTTTTAAAGTGGCACAAGGA
AAGCCCGCGCTTCAGAAGATAGAGCCAGAGAAGGTCAAACCCACGCTTTCTCAGTTCCAC
GTGAAACCGTCCAAGGCCCTCGGCCACGTAAGCATAGGCGCGTGACGCCATCACGTCAGC
ACGCAGCGCGGCGCGGCACGGGGATGGGACCAGGCGTGGAACACTGCAGGCGCGCCGGCA
CATCCGGGGCCTGGGAGGCGGCGGCGCCCGGCGGGGGTCACGTGGGCAGTTCCTTTCCGT
CTCTGGCAGGCTGGGGCGCTGGCGGAGCGCGTGTTGCTCGCCCACTCGTCTCCCCTTGTC
TCCGCCACCCCCCTCACCCGACCCTCCGCCCGTGGAGCCGGTGAAGAGGTCGCGGACGTG
TACCCTGTCCAGGTCCGGAACACGGAGTACCCCGTTGCCGCCGCCGAACGCCGCGTGAGC
TGACCCCGCCGCCAAGATGCCGGCCTATTTCCAGAGGCCGGAAAACGCCCTCAAACGGGC
CAACGGTGAGTGAGCCCAGGGCGGGCAGGGGAGGGTGAGGGGCCGTTCTGGGGAAGACGA
AGACGTTCCGCCGCACTCTGGGAACCTAGCGGCCGGGGCTCACGCTGCTGCCGCCGCCGC
CGCTTTCGGCCCCGGCCGGAGGCCCATCCACGCCGGCCCTGCACGCGTCCTTTCCATGCC
TTGTTGGGCTCCAGGACTCTCTGGCTCCTGGGCAGTTGAAGGCCGGTGAACCGCAGGGTT
TTTCCGTGGCGGCCTGACCTTGCCCTCCCTACCTATTCCCCTTTGGGGCCTCCTCGCCCG
CGTCTCCCAACGCGGCCCGCCGCTTCCTCGGTCCTGCCTGCAGGCCTCGCCCCTCCCCCA
GCCGCCTGTCCCGTCCCACGCCGAGGGAGCGCGGCCGCCCCGACTGGCTCCCTTCCTCCC
TCGCCCGGGCTGAAGCCAGGCCTTCCTGCCGTCCCCTCCGGGCGGCCCTCGTTTCCGGGA
GGCCGCCCTCTACCGGGCCACTCTCCCCGACTGCCAGGATTCCCTTTTCGCGGTGCCGCC
ATCTGGGAAAACCGGGAAAGAAGAAACATGGCTCCCGGGGACAATGCACGCGGGGACCAA
GGCTCCACCTCCCGCGGGGGGCCCCTGGCGCTGACAGCTTCTTCCTCTTCCCGACCTCAT
GGAGCCCTCCCCCACCCTTTCTCGTTCCTATGGCCCCCCTTTAACTGCTCTTGGGGTCCA
GTTTGGTCTCGGGTCATTCCTACTTTACAAACCACATTTTTTCCGTATGGAAGACACTCG
ATCTATTCTTTTTTATTTCCTAGTTATTTCTCAGCACTGGGAAGCACCCTTCTCCCCACA
CCTGTGGCCTGGCCTTTCTTCCACAATAGGTCAATAGTGTTTGTAGTTGGAAGGATCTTT
AGTAATCATCTAGTTCAAAGCCCTTTATTTTACTGAGGAGGAAGTAGAGAGGTGAGTGAC
TCGATGGACCCACACAGTTAATTAGTAGGAGATCTGATTTTAGCACACAGGTTTCCTGAC
TTTGAGGGCAAAGCTCTCCCTTTATTATGCTGCCTTGGATTCCTGCCACCCATATGTGTC
TACCCATATGTAGTAGACTTGCAGAGTTTGTGTGTGTCCCCCAAATTGATGACAAGGATT
GGAGGAGGATACAGGACACAGATTCTTTATTCAGCTGCCAAAATTCAGCTGCACGCAGGT
CACTCTTCTGCTTAAAAATCTTCCAATTGTTTATAGCCTGGTATTTGGTTTCAGCCTCTC
TTTTTAGCTTTATTTTGATTATCATCACAAATTCTTAAGTTCTCCTGTCATTCCATCAGC
ATTTGTCTATTGTTCCCCATGTTTCCTTCCTGGATGTTTCATCTTTGACATTTTTATTCA
GAACCCCTTCTTGAGGTATCACTTGTATCATGTAAATTTTCTCCTCAGAAAAATGTCTTT
CTTAGGTTTTTTAAAAAAATACTTTTCATGTATTTCCTATACCAATATCACATTCTACTT
TGTATCATACTTATCTGGTCTTATCCTTTTATGTGTTTGTTGTTTTTTCATCTTTTTATC
TCTAGCCTCTAGCACTGGGCCTTCCTATATCTTCCAGTCTTTGAGAATATTTCTGTATTG
TGTTTTCATTTTAAAAAGAAAGAAAGATACATTTCAAAGTATTTGAGACACAAAGCCTTG
GTTCTGATCTGTGTTAATGAGTATTCTGGACCTGTTATCAATCTTAGTTAACTGATGGGT
TTTTTTATGATTTGTCAGAAGTTGTTTTTTTTTTGTTGTTGTTTTAGAGGAATCTGGCAT
AATTAAATTTATATCTAACTTCTTTAAAGAGTTGCATACCTTTTATAAATTGCAATTTAT
GTTATCGCCCTTTGATTTTATTTTGAGTCGTTTCAGTTAATCTTTGTGATCCAATTTTTT
TGACCCCATGGTTTGAGGAGTAGTCAGATAGATATTAAGGGCGGTGTATCACGCACTATT
ATTAATCCCTTAGTGTAGAAAGGCAAAAGACAGTCCTTGCCTTCAAGATGCTCATAGGGA
GAAAAGCAAACAAATACAAACTATATAGAGGATAAATAGAAAATAAAAGAAGGAAGGGAC
TAGAATAAAGAGGTATTGGAAAGGTTTTCTGCAGATTATATTTTAATTAGAACTTGAAGG
AAACTAGGAAAGGCATTAAGCTTGAGATGAGAGTATTCTAGCAGTAGGGGGCAACCAGAG
AAATTCCTGGAGCTGATCTTTTTTGTGATTTGTCAGGGTGCAAGATCATCTGGCAGAGAC
CAAAGTACAAGAAGACTGGAAAGGTAGAAAGGTTATGAAGAGCTTTGAAGGCCAAGCAGG
ATTTTGTGTTTGATGGAGTACTGAATAGGAGAGTATTTAGTGTAGTCTGTATCTGGAACA
GACATTTATTTAAAGAATTGATGCCATAACTGATTTATTATCACCTTATGCTTAACAAAT
ACATTAGTGTTTGGAAAACTTGTTAATTTTGTGATGATGTGAAAACAATCTTGAGGAAAG
AATGTTTTAATTGGTAATTTTGTATTTGTGAAATGAGGTAATTACCTAGATGAACTCAAA
GGCTGCTATTCTTAAGCTTACGCTTCTATAAAATGAATTTGATTAGATATCACTTAAAAA
GACATGTTAATTTTCTATTATAATGAACCTGGAACAGTCTTAAGTTGTATAAAATGTTCT
TGTGTAGAATTCATACATGGTTGTAAAATAGATTTTTGTATATTTTGATGAGCATGTTCA
TGTGCTTCACTAACAGTAAGGTGACAGTCATAATTTATTTGGCCTATATGCCAAACATTG
GTTTTCTTAGGCTTTTAACTGACCCCAATTATTTTGGCTACGTGTAGTTGTTAGCTTTTT
TTTTTTTAAACCCTTACCTACCTAACCGTACCAACACTGTGTTTTGGTTCCAAGGCAGAA
GAGTGGTAAGGGCTAGGCAATGGGGTCAAGTAACTTGGCCCAGGGTCACTCAGCTGGGAA
GTGTCTGAGGCCAGATTTGAACCTAGGACCTCCCGTCTCTAGGCCTGGCTCTCAATACAC
TAAGCTACCTAGCTGCCCCCTACTTGTTATAATCTTAACATTAAGTAGTAAATCACATAG
GTGATATTTAACATTTTATTTGACTACTTTGTGAAATGATATTTTGCAATGCTCAGTTGT
GGATGCCATAAACAATATTTGGTGGCAAAATTAGGGAATCGATTAAGAATATTGAGACTT
TGCAAAACTAGTCTTGTGGCACCATATGGAGAAATGTGCAGTAGTGACAGGTTACCTGAG
GCAGTTCTGTGTATACTGAGGATCATTGAATTATAGGAACAACTAAGCTTATATCTTATT
GCTATTGAGCTTTCAAACAACTAGAATTTGATGAAAAAATAGGAATTATAAAATTTTGTT
TCTGCTATGTTCCTTGCCATTTTAATTAAGTGATGTGGACCCCTTATCATATGTAGAATG
AAGTAGTGGAATTACTCTGCATGAGAAATTTGTGTTTCCGTTTCAATACTGTAAATTACA
CTGTTGAATATGTCCTGTAGTTTCATTAAGTGAATTAATTTGCATGATAATTAACTTTTT
TATCCCTAATTATTAATAATCCATTGACACTCCTAATATTTCCTGAAATTTCCAATATCT
CTTTCACTTCTACTTTTGAGTTTGATAGGTTTATTTTAGCAACCTAAATCTAGAATTAGG
TAATGTTAACATTAAAAATCACCACTTTTGTAATTGCACTTTTTTTTTGATCATCCCTTC
CATGTAAAGCACCAAATAAAAGTTGCTTCATAAACTTGTAAAAGCCTTTTCCATTACATT
CTACAACAGTGACTTTTAAAAAATTTTAAGTGGTTGTGGCAAACCCAAAACTTGAGCAAC
ACTGTAACTCAGTCTGATCCACAAGAGTGTAAAAATGACACAAGCCCAAACTTAACTCTT
AAGAAGCTAGATACATAGTTTCAATACTTTGATGACTATTGTTTCAATAGCGTATAGTAG
CTATCCTTTATACCAGTAAAGGTAGTTGAAAATTTATATTAAGAATTTTTTTTTAATTCA
CATAGATTTAGAATTATAAAAATAATGTAAAAAGGTGTATGTTTATTTTTGCAGCATCCA
TTCCCTTCCCCCCCCAAAAAAAACATCTTGCTATTAATGCCATAGAGATTCTGGAGTGTT
TTGTTGCCTTTGAAAGCCTCACCCACGTATGATATTCTGCTATATACTATACTTTTTTTT
TTTTACTATAATAACCTGATTTCTAATTTTGACTCCATTTTTAAGCAGTTTGATTTGCAG
GCCTCTAGGCAAGTCATTTAACAACTTTGGACCTCAGTTTCTTTTTCTGTGGAATGAAGA
GGTGAGACTAGAGGGCTTTTAAGGTCTCATCCAGTTGTAAAATTGGTCCTCCCCCTCCCA
AGTCCCAATTAGATTGCAGTGTCTTTGAGGACTAGCACTGTACCTTCCACATTTTAGTAT
TCCCCGAACATAGAAATTCTCACTTGGGCTGTTAATACATTTACATATGTTGAATTGATC
CCAAATGAAAATGGATAATTTGTAGTCTTTACTAGTCGTAATACTTATGATTGGAAGCTT
AGGGGGAACAAAATTCCCTTAAAGACAAGCAATTGTTATTGTTTGAAGGCCATCTTAAAG
AGATTTTTCAATTTAACACTAGCAAACATTTCTATAGCTTAATGAAAGTCTTCACACATT
AGTAAAAATTAAATTCCTTTTTAGGTTGATGCAGAGGTTGCTTTAGTTTATCAGTTACCA
AAGACAAACATCTTGACTAGATAAATTTCTTGTCTTTTATCTTTTCTCTCTGCTGCCCTA
TTTACTTGGAAATTCTGGTCTCATTAAAAGCTCTTTTAAGTACTGCAGAAAGTATTCTTT
TAAAGAGAGCTTGACTTGCTTTATTTTAGTTATTGCCTTTTGAGTTTAAAAGTATGGTGA
GAGATGGGAAAATTCTTGAAAATTTAAAAACAAGCAGAAACAGGCTGGTGTGTTTTCTGA
ACAAAACTTGAGAGAGTTAAAAAATAGGTGCTCATGGAACAGTCTCTTGAGTTGATTCAG
ATATGGCTTTAACCTTGTTTCTAAGGTGTGTACCTTTCCATTTTTTTTTAGTTAAGTCTG
AGCCATAATTTTTAAAAAGAAACTAGGTTTCTCTTTTGAAAAAAAAATTTAAGAAATGAA
TTATCTGAAGTACATGTGTTTATTCATTTGTACCAACAGTGTTTCAAAAATCTCAGTCCG
CTGAATTTAATTTAGTTACTGTATTAAAATCATTCCTGGAAGTCTTTAGTTTTAGATGCC
TTAAATGAAACTATCCTCAGATAATGGGACTACCATAAGTGAGGTTCTATCTTCAGTTGG
ATCTTTTTATGGTCTACATGACTTTACAAGTAAAATGGCATTTTGCAAATAATGCTAATG
AGATGGACTAGTTTGAAGATTGGGAGATTGAACTAGATGATTTTTGTCTAAAGTCTTTCA
GTTATGATATTCTTTTAATTATGAATCTGGTTGAATTTAATGGATACCAGTTCCATTAAA
GAAGTAAAACATTTAAATCAAGGTACTAATAGGCATGGCCATATAAATATAAATGGAATG
GAATTTAAATAATATGATGAGAAAAAATGGAGTTTAAACTCATAAAGTACCAAATTGGAC
TGAGGTTTTTTTTTTTTAAGTGATTTGCATTTGATTAGAAATTCAAACTGGGAGGAAGTT
GTCTATGAGCTACTGAAAATCTATTTAGATAAGAATCTTCTAAATTAAAAGTAGACCATT
TCCCTTATAAAGGCAGAATTGGCTTTGTGATATGTTTAATTTCCTGAAATGTTGGAGGAG
GAAGGTGTCACTGTTAATGTAGTGTACTGGTAGGTTGTCAGTATGTGAAACTAAAATTTG
GTTATCTTTTATATAGTGTTACACAAAGTGTTGGAAAAGAGAACATGATTCTACTTCAGG
AGAACTTCTTCCTATCCTCTAGATTCTTGTGATTTCAGTTTATCCCTAAGATGGAATTCT
GTGTTTTCATAGTTTTCCAAAAGAATTCAAGACACCAAGAATAAAGGAATCTGGGGAAAG
AATTAAAGTAAAAAAGGAGGTGGCTGAGAATAACAATACAGAAGACATATTGTACAAATA
AATTTTGTTTTCCAGGGCACAAGGACCTGTCATATACTGTTTTTGAAGACAATATTGGGG
AATGAACCTTGGTTTTGTAATTAGGAGACCAGAATTCAAATCCTGTCTTTGGTGACTGTT
AGCCACATAATTCTAGGCAAAATAAGATTCTTATCAAGCAGCAAGTATTAAATGCCAGGC
AGTAAACTCACATTACACATTATAGTAATGTGGGGGGGAGACAAGTATATAAAGAAAAGC
ACATGGTAAATATAAAATTAATCAAGATAGATAGGAGTTAAATACAAGGCAGTTGAGGAA
TCAAGATGTCCATAGTTATGATGGGTGATAAATGTGTAGAGGCTTCATGCATAAGATGGT
GTCTGAGCAGCATCATAAGGGAAAAGAAGGACCCTTTGAAGGAGTTGAGGATGTTGTGAA
CTCTAACCAGGGGGAAAAGCCTGGCTAAAAGCCCGGAGATGAGAATGTTTCCTTTCAAGG
CAACTTGGCCAATTAGTTTTCCAAACTGCTGGAAGAGGAATATTGTTCAAGGAAACTGGA
AGGATAAGTTTGGGACCAGGTTATATGGGGCAGCTAAGGTGACACAGTAGATAGAATGCC
AGGCCAAGTCAGGAGAACTTGAATTCAGATCTGACTTCAGACATTTTTGCAAGCTGTGCA
ACCCTGGGCAAATCACTTAACACATTTTTCCTAGCCTTTGCCCTTCTGTCTTAAAACTGA
GACAGAAAGTAAGGGTTGTGTGGTTTTTTTTGTTTTTGTTTTTTTTTTTAAGCTTAAAAG
AGAGAGTAGTTTGTTATATTCTAGTGGCAACCAGAAGCCATTCCTATTGAGAAAGGGAGT
CAAATCGGTGTTTTGAGGAAAATTACTTTGGCTGTAGTGTCTCTAGGTTGAACTGGAGTG
TGGAGAGATTTGAAGCAGTGAAATATGCCAATGAAGATATTTTTAAAATAACCAATAATA
TAGGTGAGAGGTGATGAAGGCAATGAACCTAAGGTAGTAGCTATTTTGATTTTAGAGGTT
ATGTTGATTTATGAGATATTGTGTAGTATTTGACCATTGATTGGATATGTGGGGTGAGGG
AGAGTAAGGAGTTCAGGATAATGATTAGAATACAAACTGAGAAACAGGAAGAATGGTGTG
GCCTTCAAAAAAATAAGAGAAATTTGGAAGAGGAGTGTTTAGGAGGAAAAGTTCATTAAT
TTTAAACATGGGTGAGTTTTAAGATGTCTGGGATAACCTATTTGAAATGTTCAGTAGGCA
AATTGTTGATAAAGAACTAAAGTTCAGAGGAGAGACTGCAGCTGAATATAGATATGAGTC
GTTTGCATAAATATAACAGTCCAAGGAAGTTGATGAGATTACCTAGAGCAGGGGTTCCCA
AACTACAGCCCATGGGCCACATGTGGCCCCCTGAAGACATTTATCCAGCCTCCACCCCAC
TTCCAGAAGGAAGGGGCACCTCTTTAATTGGTGCTCCTGGAGTACTGTATGTGGTGGTGC
ATAGTAGTATAGTACTACTTCTGGTGACAATCCTTTGCGTAGTGCCTTGTTCTGAGAGTA
GCTGAATGAGAAAGAGGCACAAAGAATTATGTGGCTGCACAATGGAAGACGATCAGCATG
GTGAGCATTGATCTGGGGGAGAGGATTCCACACTGTGTATACTGCTGCCCCCGATATAGT
GGTGGCAGTGATGATCCTGTGCAAGGTGTGACAGGCCCATCACAGCCAGTACTGCAGCCT
CTGCTATCCCAGACAGTGATATACAGATTTGTTCATAGTTTTTTTTTTTTTATAGTTTGA
CCCTCCAACTGTCTGAGGGACAGTGAACTGGCCCCCTGTGTAAAAAGTTTGGGGACCTCT
TATCTAGAGTATAGAGGGAAAAGAACCTTGGGGGATACCTTAAATTAGAGGGCATGATAT
GAGTGATGAGTAGCCAAGCCAGCAAAAGGAGATAGAAAAGGAATAAGAAATAGCAAACCA
GGAGAGAGTAGTGCAATGAAGACTCATTGAGGAGTATCTAGGAGAGTGGGCAATAACTAA
AAATAAAGCAGACTAAAAATATTAGATAATCAAATTGTGAGTTGAGATTATTAGAAACTT
GTACAAGGGGCAGGTTATGAAGAACTTTGACAAATAGAATTTTATATTTGGCCCTGGAAA
AGAGGCAGTTTGTTGGATATCCTAGAATTTATTGAATAAGGGTATTGACATGGTTCAGAC
CTGCACTTTGTGAATATCAATTTTTTGAGGGCACATATACTAGATCTTGTATTATCCATA
AATGTTCCATTCCCTAATTAGAAACTGACATCTCCCTATGTGACCATAACCTGTCATTCT
ATCTCTCCTCTATGCTTTATCTTTCCTCCATATTCTTTGCCTTGAGACCACCAGTCTTGC
TCCTCATTACTTTGTCAAACCATTATCTGGACAAACTTCCTTTTTTCCCTTTCTAAGGAT
TTAGCTATTTTGTTTCAGTTTTATACTTTGAATCATTTTGCTTCCTTGTTCTGTCACTGC
TTTCTCTTGCCCTTTGGATTAGTCTTGCCTCCTGTCCTCATTAGACACTGAATAAAAGCT
TATGGATATCTTTACAACCATCTTGATTATTGGATACATTACAAAGTTATGTATTGTAAC
CTCAACTGGGCCCTCTACTGTAGCAAGGCATTCAGTCCCCTTTTATTTCCCCCTAACTGA
TTTTCTATTTCAGTCCCTATAGATTTCTTATCGCTATCTCCCACTTCTTTAATCTGAGAA
ACTTGCCTCTGTTGAAAAAAGTTGAGGCTATGTATGTGAACTCCCTCTTGTCCGTTGTCT
TAATTTCAAAACCTGTTGACATTTTCTCTCATTCTCTCTTCATCTCAACAATCACAAAGA
AGGTACTCCTTCTACTTGTCAAAACTCACTTCCTCTGTCCTCAATTTGGTCTCACACACC
CCCCCCCCCCCCAATCTTCTCTAGCAGATTACAAACTTGGCTGTCCTCTTACTCTCACAA
ATCTTCAACTCCTTCCTGTCTACTGGGTCTTTCCTAGATGTTTTCAAACATTCCCAAGTA
TCCCCTCTCCTTAAAACCCCAAAAAACCACCCATATCCCTTCATACTCTTGTCCTTTGTC
TTTTCTTTGGTCAGTCAGTTCAGCAACTTAATAGCTATATGATCCTGGGCATGTCATTTT
AACTTTTCTCAGGCTCATCTTTAAATTGAGGATAATTATATTGCCTACTTCACAGAACTG
GGATAAACAAATGCAATAATATGTGTAAAGAACTTTACAAAAACCTTTTTTTAACTTCAT
AAACTTTAAAGCACTGTATAATGCTAGCTCTCACTATCTCTACCATTCATTCCTCTGAGT
TCATTCAGTCTTATCACCAAATACAAATCTGGTAGTTGTTGTCCACAGCTTCCAGGACCC
TCCCCTTTCCTTAATGAGTTCTGGGTCAGACTTATCAATTTCTTCTATCTAGTACATATT
GATTTGCCTTAAAGACCCTAACCTCCCAATTCCTCAGCTTTTCTATATCTTCCAGCCCAC
CTCACCTAAACACAAATGACCATACCCTTGTCATCACCTGTAATATATACTTCTTCCATG
TTTATGAACTTTGCAATTCCCTTATCTGCTCTTAATCTATTGATGTTCTGCCTCTTCTGC
CTTGGAACCATAGATCCTATTCTTTATCTTTACTATGCTCTCTAGTCAGTCCCTAGTTAT
TTTCTAGGACATTATCCCTGGACTGGCTCTTCTTACCCCATCTTGATCCCTGGAACCAGA
GAGATGGGATGGATGATCAGGTGAGGGTATTGAGGATGAAGGAGTTCTAGGCATGCTTTT
AGACAATGGGGAAGCACCTAGAAGATAGAGATTAAAGATAGGTGACAGAATAGGAAAGAT
TCAGGGTACCAATCAGCTGATAAAGATGAGATTGAATGGGATCGGTTGGTGCATATAAAA
GGCCATCATTGCAACAACAGCAAAAAAAAAAACCAGTAGAAAGAAAAATGTTCTGTCTAA
ACCATTTCATATACTACCACTTTTGAGATAAGCTTTACAAAGTTAGAATTAAGTTACGTA
GCAACTTTGCTAATATGATTTTGGAATAAGTTTATTACTCAATTCAGCAATTTATTGAAA
TCCACTATCCAGTTTAATTCTACCATCTCCAGTTCCTTGCCACCTTATTCTATTACCCAT
TTCAGCCTGCTGAGCTTCAGTCCTTGTACTACTCTCAAAAGATCTTTTGCTTTTTTTTCT
TGGTATTATATGAACCTGGAGAAAATCATGAAACTAGTACTGACTGAATCCCCTAGAAAT
TTTAAAAATCCCAACCAGACTCTTAATGTAGCAAGGCAGTCTTTTTACATTTTCTAATTA
ATGTACTATCCCACTCATCGGTTGCTTTTTCTAAACTTTTTCATCCCTGAAACCTCCCAT
GACTTTCCTCCTCTCATCCTTTCTTAGCTAGGAGCCTTGTCTCATATATTCTTCATTGAA
AAAATTAAGGTCATTTATTGAGGGGCCTCTCTTTCTCCTCCCTTTAACTGACATGCCTTT
TGCCACTGTCTTCAGTCTCCTACCTTATTAAAATTTAGTAGGAATTTTTGATTAATAAAC
TTTTTATGATAGTATTAGGATAAGATGTTATATATTGGTACTCATGACACCATGAATAAA
TGGAAAATCTAGGGCTAAAATCCACACTTGCCTAATACCTAGATGCAATTCTATTTTACT
ATGCTTTTATGAGTCAGTCAGGTTATATTTTTAAATTATATTTTTCAGTAATGGGAAAAG
GATGGGATGACACCCAGTTTTCCCTGATTTTAAATTCTTCTGGAGTTTAGTCTCTAGTAA
AAGAGTTTACATTTAAAGATAGCTTGTCCCTATAATGTCAGCGAATTTTTTTTGGGAAAA
TTATTTTGTCTTCTAAGGATTTTTTAAGATACTGCAAGTCTCTTGATAATTATGTAAAGG
CTAGGTCTTTGTTTTAACTTCATAATTACATATATTTGAACTATTTGGATAGTCAAATAA
TAATAGCTTGCATTTACATAGCATTTTAAGTTTTGTAGTATATTTTAAAATACATGATCT
CACTTGAATCTGCAGTTTACTATCTCCATTTTCCATTTGAAAAAACTTGAGTCCCTGAGA
GACTAAATGGGGTTACCTCTGAACCTAGCTAGTAATGTGAGGAACAGGATTTGGAGCTAG
TTCTTTATGATATTAGGTCCAGCTTTCTTATCTACTATATATAACCTGCAACCACAGAGT
CACTTTTTGTATAGCAACAAGTTCAGAAGTAGTTCTTAAAAGTGAATGCTTAGCCTTCTT
GCAGGAGAGGATGGGAGTGTGTATAAATATGGAAGGTTGTGTCAGATTCATTCATTGTCC
CCTTCTTTGACTTTTTAATTGCTTTTCTTCCTAACAGTTCATGGGAGTGGGAACTCCCGA
ATGTGTGGTGATACCTAGAAACAACTGGTGTAAAAATAAAAGGAATCAAATCTTTTAAAA
ACAGACTTTGAAATTTGGTATTATTTATGTAACCAATTCTGATCTTCTGGATTAATTTTC
AGAATTTCTTGAAGTTGGCAAGAAGCAGCCTGCCCTTGATGTTCTCTATGATGTTATGAA
AAGTAAAAAACATCGGACATGGCAAAAGATACACGAGCCTATTATGCTGAAATACTTAGA
ACTATGTGTGGACCTCCGCAAGAGCCACCTGGCTAAGGAAGGATTATATCAGTATAAAAA
TATTTGTCAACAGGTAAATTTGCGAAAGGCAAATACTTACTCTTCTCATTCATAAGAATT
TTAATATACTCTTACTGATAAAGGTACTTGCTTTTTTCCAAAATTTATAATTGCTGTCTC
TTAGAATAAGCCTGTTATATGCTTTTTAAGAATTTTCATTTCAGAAGTGTCATGAGCTTT
TGAGTGAAATTAATTTCATATGTTCTGACTATGCATACCTGTAGGTGAACATCAAATCCT
TAGAAGATGTAGTTCGGGCGTACTTGAAGCTGGCTGAAGAAAAAACTGAAGCTGCTAAGG
AAGAATCACAACAAATGGTCTTGGATATAGAAGATTTGGATAATATTCAAACTCCTGAGA
GGTGTGTGCCATTAATTAAAACTAAATCAGGTGACAAGTACCAGCCATCCTTGCCATCCT
TGTTACTTGCTTGTATACTACACATTTAACAGAGGGAAAGTTTCTTTAAGAAGTTTACAA
AAACTTTTATAAATAACATTCAATATCTGAGTGTATTGAAGACTTTGAACATTTCATATA
TGAATGAAATAAGCTTGGTAGATAAAAAGGTCAATGCTGCACTTTCCTCTCATTAATCTG
CATATCATCTGGGTAGAGGAAAAAAATCTGGCAAGTATTAAAATCATTTGGCATAGATTC
AGTGTAATTGTTTTGGTATGTGCATATATGTGTTTTAAGTATCTATATTTGTATACATTT
AACCCTCCCTGTCTTCCAGTTTCAAACTTTTTGAAGGAGGAAGATTGAGGCCCTTTGATT
GTATCCAAAATGTCATTAATGGATTAATTTCATTTTGAGGGAATTTGTTACTAGAAGGTT
TTAGTAATGTCTGTAGACTATGATGAATACAAAGAAGGAATGCTTGGCAATTCATACATG
CTATTTATTTGAGAGTTGACATGAATAATAGAATCCAATAAAAGAACTTGGCAAGCTAGG
TTGTTAGGCTAGATCTAATAAGAAAAAAATTAATAGGGGCAAATGTAAAGACCTGCTATC
GGGTTTAAAAAAAAGCAGGGGGCAGCTGGGTAGCTCAGTGGATTGAGAGCCAGGCCTAGA
GACGGGAGGTCCTAGGTTCAAATGTGGCCTCAGACACTTCCCAGCTGTGTGACCCTGGGC
AAGTCACTTGACCCCCATTGCCTAGCCCTTACCACTCTTCTGCCTTGGAGCCAATACACA
GTATTGACTCCAGGACAGAAGGTAAGGGTTTAAAAAAAAAAAAGCAGACAAAAATATAGG
ATTGAGATGGGATCTAACAGTTGATGTGAATGAGACAGAATTTGGGAGTTTTAGTAGAAT
GAACGGTCATTGTGAGTTTAGTATGCTATTTCAGTAAAAGTAAGGCTATCTTGGATCAAG
AACAAAGGAGGTGACAGTGCTGCCATATTTCCTAATCAGACTGTATTGAGAGTATTGTGT
TCATTTCTGGAAGCCTCATCTTAGGAAGGATCTTAAACTGGAGTTGTGTTCAAAGGAAGG
TAATTGGTGCCTTGTGGAGAGTTGGTTGAAAGAACTTTGTGGAGGTAGTGCAATGGAGAA
GACTTGAGTGAATGTGGTTGTCTTTAATTTTAAAATTTGAACGTTTATTGTTTGGAATAG
TAGTGAAATTTTTTCTTTGCCCCAGAGGGCAGAATTAGGAGAAGGAAACAAATTTAGACC
TCGATGGGGGTGGGTGGTGCATTGAAATTCCTAATGATTAGAGCTGCCCCAAAGGAAAAG
GGTTTCCTTACAAAGTAGTGGATTCTCAATTTCTAGAATATTTCAGATGAAATATATGGA
TTTGTCAGGTATGTCTGCAGAGGAGATTTCTTTTTAGGTTCAGGTTGAACTAGATTATCT
TTGAGGTTCCTTCCAATTCTGAGATTCTATTTTGACCAGCATAGTAAGATTTTAGTTAAT
AGCTATTTATTTCTCCCATGAATAAAATTACCATAGTAGATATATGCAAAGGTAGTAAAA
CCTTAAAACACAATTTTATTTCAACTTTCAGATTTATGAACTACTTATTTAACTTATATT
GCCAATGATTAGAAAATATCCTTTTTGACTTATAATTGTTAAGATTAGGAGTAAACATTT
TGCAGAACGAACAAAAGCATAGCAATGTTTGATTTAGAGCAATATGTATTTTGGCGGTCA
TTGGTGGTTTTAATTTTTTGATTCAGATGATGTGCAAAATTGTTTACACTTAATATTTCT
TCCTACTTGTAGTGTTCTCCTAAGTGCTGTAAGTGGTGAAGATACTCAGGATCGTACTGA
CAGATTGCTTTTAACTCCCTGGGTTAAATTTCTCTGGGAATCATATCGACAGTGTTTGGA
CCTTCTTCGAAATAATTCTAGAGTAGAGCGTCTCTATCATGATATTGCCCAGCAAGGTAA
AACAGACATAGAATCTGAATGAAACCATTTGAAAACTTGATTTTAAATGTAGATTATTTT
ACAGATAACCTATTTTCAAATCATTAAACTCCTTTTCTTGAAAATTGCTTAATTGATTGC
ATTTATTTGCTGTTCTTTTAAGCCACAATGAAAAATGACCTACATAAATGTAACTGAAAT
AAAAGAATTGGATTGAACTGAGTTTTATATAACTTTGTGAATGAAAATGTTGTACATGGG
AGCTAGAGTGTTAAATGACTTGTTTAGAAAACCATTACAGTAGTTCTGAAAAGGTACTGA
AATATTTCTTTCATCTGACATGTTGAATTTTCTTGGAAGCTGAATCAGCTCCTTAAAGTA
GCAGAATTTAAACATTTGTAGTGGAAATCCTAAAAATACTATATTTTTAGAAAAAAAAAT
TTAAACCCATACCTTTCTCTTAGCATTAAAACAAAAGAGTAGCAAGAGCTAGGTAATTGG
GGTTAAAAGAATTGCCCAGGGTCACAAAGCCAGATGGTATCTGAATTCATATTTGAATCG
AGGGTCTCCTGTCTCCAGGTCTTAAGCTTTTATCTATAATGCTACCTAATTGCTCCTAAA
AATACCATTTGCTTCTTAAAGTGCATTAACTTTCACATAACCTAATGAGGTCATTTAGAA
GCATTATTAGTTTTGATTTAGTTTATGCTTTGCAATTACAATCTCGGCTTTTTAAGGTTT
GTAGAAATTTTTGCTGTCTTATTGTCACTTTTAATGATTCTGTGTTTTATGTGACTATAA
TACATTACCTTTTACTATGGTTGACTAAATGTCAAAAAGTGGCTCTAAATTTTCTACAGA
GCAAAATGCATGAAATTTGGGCAGCTATTTCCCACCTTGGGAAATTTAGGTTTATTAGAA
CTTAACTAAACTTGCTGGAAGTCTTATGTTCAGATAAATAGGTTGTTACTTCATTACTTT
TTAGTATTGGTAGTTCTTGGGAATAAAGTTTATTATGCTCTATACCACAATATATTGCTT
CCTCTGTTTAATATTTGTTAAAAACTAATACTATTTTTGCCAAATTAGGACTGTTAGTAC
AACCTGTTCTTCATTGTAAATGAACCTGTATAGATCTTATTTTCTTTACTGCTGAGTAAC
TTATTTAGCACTTTATTGATAATAAATTCCATTAAGTTGTTATTTTGCTTTGACTTAAGT
AGTCATAATGAGCATCATATACAGGATTTCCAAACCTCCCAAATTTATTTTTCTTATGTA
ATTGTGTTTTTTATCTTTTGACTTGTATGATAGACTGTTAGAGCTAAATAGTAACTGGCT
CAAACCATATTGAACCATGTATTTTTATTTAAGTTTATTGATATTAACATCTATTGAGAT
GAGCAGTACTGTTAGCTTGTCTGTTTACATTAATTTTGGCCATTGGTTATATAAAATGTC
TGTGTTTTTTAAAGATACCCAGAAAAATTTTTATCTATTTATTCATTCAGCCATTTATTT
TTAGCCCTTACCTTCCATCTTGGAATCAATACTGTGTATTGGTTCCAAGGCAGAAGAGTG
ATAAGGACTAGGCAACTAAGTGACTTGCCCAGGGTCACACAGCTAAGAAGTGTCTGAGGC
CAGATTTCAACTCAGGACTTCCAGTCTCTAGGCCCGGCTCTCAATCCACTGTGCTACCCA
GCTGCCCCCTTAAAATCCTTTTTAAAAGAGCAAGATATTCATATATCTTATGTGTTCAAT
TAAATACTAGTAGAAATTCCTTACCATGTTGTTTTTCTTAAAATGAAATTATAATGTTTT
CAAAAATACTGGTTATTCTTTATGATATTGATTGTTCTCTTGTTAAATTAAAACCTATTG
AGAATAAAGCATTATTTTTTATAGATTTCAAAACTGGGAAGCTTGACAATTCATTTTTTA
ATTACAGTATATCTTTAGAGAAGTCTAAGTGTTCTTAAGAGGTGTTTGAGACACAGCCAT
GATGGTGATGGGTCTGGTACCAATTCAATTTTAACTTGTTATATATCTTAAGTATGATCA
AACATCCTCATATATTGAATTCCTCCAAAACTTGTCGGCAATGGAGAGATACTAATAAAT
TTAATGATTTTATCCATAGCTTTCAAATTCTGCCTCCAGTATACTCGTAAGGCTGAGTTC
CGTAAGCTGTGTGACAATTTAAGGATGCATTTGTCACAAATCCAACGCCACCACAATCAA
AGTACAGCAATCAATCTTAATAATCCCGAGAGCCAGTCTATGCATCTAGAAACAAGACTT
GTACAGTTGGACAGTGCTATTAGCATGGAACTGTGGCAGGTATGGTTTGTTTTTCTTTTT
AACCCTTCTAATAATTCTAAGACAGAAGAACAGTAGAGGCTGGACATTTGGGGTTAAATG
ACTTGCTCAGGGTCACACTGCTAGGAAGTATCTAGGGCCACATATCAACCCAGGACTTCT
TGTCTCTAGGTATGGCTCTATCCACTGACCCACCTAGCTGCTCTAATCATAAACTCTGAA
ACCTTCCTAGTAATGAAACTGGTACATATTTTGTTTACTTAATGAGTAACCCCTAATGGG
TACTTTATTGATAATGAATTCCATTTGACTTTTAACATGTTGAACATCATATACAGAGTA
ATGTTTATTAGTGAGCCCCATATAAAAAACATGTAGTACGTCCCAAGCATGTATCTTTTT
GCTTTTTTAATTGTTTTTCACTTATTGTGTTGTTGTGCATGCTGATTTTGAGTTTTATTT
TGATTTTTCAGGAAGCATTCAAAGCAGTAGAAGATATTCATGGTTTATTTTCATTATCTA
AAAAGCCACCTAAACCTCAGTTGATGGCAAATTACTATAATAAAGTTTCAACTGTGTTCT
GGAAATCTGGGAATGCTCTTTTTCATGCCTCTACTCTCCATCGACTTTACCATCTGTCTA
GAGAAATGAGAAAAAATCTTACCCAAGAAGAGATGCAAAGGTAAAGTGAGATTTAATTTC
CCTTTCAGGTTTGTTTAAATTTTCATGTTTTAGGTTTGTTCATAATAAATCTCATCCCAA
TTAAACATAAATGCAGAGCCTGTTATCTGAATGTCCTTACCTTATAAAGAAAGCTCTTGG
CAATTCTCATTTTGAATTTGAGAAGAGATAAATTCTTTGGAATTTCCTTAGAATGGAAAA
CTTTTCACAGCTGAGCCCTATGTCCTTTGCTTCAGATTCTTCTGTGAGGTTAGTGGCCTG
TTTTTCTACTACTGCCACTACTATATATAGCTCCTATGGGAAAATTGCATTCCCCTTAGT
TCCTTAGGGTTGAGTGGTTAGTCCTTTCCTTTATATATCAACAGACAAAGGTTGAGGTTT
TGAAAAGCAGCTGTGTTATACCTGAAAGCAAAATGAAAAGAAATCGTTAAATTTAGAATT
GACAGGTCTGTAAAACAAAAGAAGCCTAATCGTGTTTTTTGTCTTTGCCCTGTCTAAAGA
ACTCCTGAATGTGATCCTTGATGCCCTGCAATGTCCTGGCTTGAGCTGCCTGCCTTTGTA
AGACTGGTGTATATCTTCTCTCCTTCCCAGATTTGCCAAGGCTTAGTTCCTAGATGTCAA
GACTATTGGAGGCAGGCCTAGATTCTTGTAGATTTGACTGCAGTTGCCCTTTGAGCATTC
CTTCCAGGTTTGAAATACAGGCAATCCTCACTTTATGTAAGTGGATTGTTGTGCAGGCCT
CTACATGAAGTGATTTTCATGTAATGTGAATTTGGAAGGGAAAGATATAGGAAAACAGGT
GGGGAGACAGAGAGCCAGGGACAGAAAAACCAGCAACATGGGACCTGGTCAGGCCTGAGA
GAAAGTGCAAGGACAGACCCTTGGTTCCCCAAGCCCAAACTGGCAGACAGATTGAGTTGA
GCAAAGGTGTTCTTACTCAGAGCAAGGTCTGAAGCCAAGCCTCCTGATCTGGAGACAGTG
GTAGCTCCACGCTTCCATTCTTTTTAAGTTTTTCATTTAAAAAACCCTGACCTTCTGTCT
TAGAATCAACACCATGTACTGATCCATAGGCAGAAGAGCAGTAAGGGCTAGGCAATTGGG
GTGGGGGGTTGGGGTAAGTGACTTGCCCAGGGTCACAGCTAGAAAGTGTCTGAGGTCAGA
GTTGAACCCAGGACCTCCCATCCCTAAGCTTGGCTCAACCCACTGAGTCTTCTTACTGTT
CCCATGCTTCCTCTTTTCTCCTTTTATTTGGAGAGAGGTATGTTGGGGTTTTTGAGAGGA
TTTTTTGATGTTGGAAGGTGAAAGAGGCTGCAGAGCTGAGGGGCAGAGGCAGAGAGAGAA
AATAGACCACAGTAAAGTTAACAGATCTTTTTTTTTTTTTGAATGAGGATTTTTTTTTCA
GAATTCTTTATGTAAAGTGGAATTTGAATAATCAAATCAAGAACTAAATCAAGAACTGTC
TCTACTATTTTTTCTTCTGTTTTGTTTCCAAACTTTTTCCTATAAGATTTCCAGACGGTA
ACTAGTTGTCTAGAATTCAACTAAGTTTTTGAAATACCCTACATATTTCAAACATAATAT
TATTAGGGAGCCTATTTCCCAAAAATAGTAAATAAGGGACCATTTTGTCAGAGTGACTGA
AACTGTGGAGGATTTATTGTTGTGTAAAAGAATGAGAAAAATGAAAATTTTTTTATTATG
GTTCCAAGATTGAATTTAATTTACAAATCATATTTGTGGAATTGTCTGTTTTAAATAAAG
ATGAATGCAAGTAAGTTGTTGCTATGGGCCACCAGTCAATATCCAGTATTGAGAAATAAA
AATGTTAAAGGGACATGGATAGAGAGAATAGACAATACTTTACGAATTGATACTCTCCAC
TGGAGTTTCAGTGATGTTGGTTATCATTTCTTTTGATTACTTTTTAAATGAATTTTAAAG
GAAATGCTAAAAACTCAGTGCTTAGAAATCTGAGCTACATTTTTTACTTGCACCATCTTT
GGAGCATTTATAAATAATCTATTAATTATCTTGACATTCAATTATGAATCATAAAATTGA
CATGATGGCTGTCATTGCTTGCTCTATAAAGTTTATCATGAAGTGAATGGTTTCTCGGAG
AAATTTTGTTGTATGATTCTTTTATCTTCTATGTATTGGTTCTGGTTATTAAGTGACTAC
ATTGTTGTTTCTTGTGTTAAACTATGCCTCAGTAGCTGACAGTGGAATTAACTGCAGTAT
CTTCCTTTTATGAGTCATGATGCATGAAGAATTCCATATGGATAATTACTGACTAATGCT
ATATTTCCATGTGTTAGTGTATGAGTTTATAGTTCTTGATTGTGATGTGTTTACGTCATA
AGTTTCTGAATTCCCATAGTAAGTAGTCTAAATTTTACTTCCAAGTCCTTATGCAAAAAT
TTGAAATTTTTGCTAACTACATTAGAATTCTCTACTAGAAAATTCTACATATCATGTAAC
TTTTAGTTTGTCATAACGGAAACATTGACTGCAACTTGAATTTATTGTCAAATTAATTAA
AGCAATTGCTATGTGAATATCAAGCTCTATAAAAGGTTCTTTTGTAACTATTTTCAACAG
AATGTCAACTAGAGTCCTTTTAGCCACACTATCCATTCCTATTACTCCAGAGCGTACCGA
TATTGCTCGACTTCTGGATATGGATGGTATCATAGTTGAAAAGCAACGTCGGCTTGCAAC
ACTGTTAGGTCTTCAGGCTCCACCAACACGCATCGTTCTTATTAATGATATGGTAGGTAT
CAGTTTGAATGGTTTGCACCCTATAACTTCCCTCAGGTTTTTTTTTCCTTTTTAAAGGAG
TAATTAATTGACTCAAATTCCTGACAGAATTACGAGAAAAGTGATTCTTATTAACTAGAA
AAATTTCAAAATGCTTTGGCACACTTAAAGAACAAAACCCTTTTTTATTTTGTATGGGGA
GAAATTTTATTATAAGAGATAAGTCATACCAATTGACTTTGGTGTTTGATAGTGTCATGG
CAGATACACATATAACAAAGCTAAAGAAGATAGGTAAGGAATTTGTTCTAAAACAGTCCC
TTTTTAAAATGTTTCCCCCCCTAATTACATGTAAAAACAATCTTTTAACATTCATTTTTA
AAAAAAAAGTTTGGGGTTCCAAATTCTCTTCTTCCTATCATCTCTTTTTTATTCTTTCCT
ACCTCTCCCCCTTTTCTTAGGTGGTAAGCAGTCAGATACAGGTTTTTACATGCTCAATTC
CATTAGTCTTACTAATGAATTTTAATCCATGGCAACTAATTATTGTATAAATAAGTATGA
TACTGTAACTTAGAAATAGGAAAATCATTCTCTTTTGTAGTAGATGTAAGATATTTATAT
AATAAATAATTTAAACAGTCAACAAGCATTTATTTAGTGTTTACTATATGCCAGGCACTA
TGTTAAGCACTGAGATTGTAAAGAAAGGCAAAATAGATGGTTCTGACCCTCAAAAAGCTC
ACATTTTCGTGCAGGAGACAAACTGCCATTAACTATGTACAACATCTATACAGTGAAAAT
GGAATGTAATCATCAGAGAGAAGACGGTAACATTATGTGTGGGGAAAGAAGAATGGGAAG
TCTTTCTGCAGAAGGTGGAATTAAAATTGAGTTTTAAAGTTAGCCAAAGAAAGAGAGCAT
TCTAACCTTGGGGAAATAAGTCCAGTGTTGTCTAAATTGAATATTATTTTAAGACTATTT
AAATGATCTTGCAAGTTGTCATTTTATTTTTCCACAGGTATACTTCTGCACATTTCATTG
ACCTGCTTTCGTTGTATTGTGAGCAGTGTTATTTCTGATGTGCTATATAATTTGTAGAAG
GTTAATTAGCAGCATAACTTGGAATATTAGTACTGCTGCCAGTCCCCTTCAAACAAATGC
AGTATTTTGATGAAAAATGTACACACTGTTCTAAAAAAAAAATTAAATTTCTTTATAAAT
AATGTACTTGTATCTTGATTTTGAAAGAATTTTGTTCATTTGTTGAAGTTCACATAAAAC
CCATAGAACTTAAAAGGGAATTGTGTGCCAAAAATATAGTGTTCTTTAAAAAAAAAATTT
TTTTTTAACCCATACCTTCTTCTTTAGAACCAATACTAGTGGTTCTGAGGCAGAAGAGAA
GTATGGGCTAGGCAATGAGGGTTAAATGACTTGCCCAGGGTCACATAGCTGGAAAGCGTC
TGAGACCATATTTGAACCCAGGAGCTCCCATCTCTAGGCCTGGCTCTCAATCCATTGAGA
AACAACCCCCCCCCCCCCCCCTAGTTTTTAATAAAGGATTTTATGGAAATGCTGACATAC
TGGGCAGTCAGGGTTTGTTAAGCAGTTGTTTCAGTACTATCTGACTCTTTGTGACCCTGT
TTGGGGTTTTCTTGGCAAAGATAATGGAATGGGTGACCATTTCTTTTTCCAGTTTATTTT
ACAAATGTGTAGACTGAGTCAGACAGGGTTAAGTGACTTGTCCACAATCACACAGTGTCT
CATGCCAGATTTAAACTCAGGAAGATGAGTCTTCCTGACTTCAGACCTGGCATTCTCTCT
ACTCTGCCACCTAGTAGCTCAGTCAATATTAGGCACAATTTAGTAGAAGTAGTAATATGA
AATTAAGGTGAGCATTGTGGGAAATCATAGGGATAAGAGATGTCTAGGCAGGGATAATTA
TATGATTCACACATTATGGTCAAATCAGCCCTTCTTAGAAAAGTATTCCTTTGAAATTCT
GCTTTTACTCATTAATACTCCTAACATTATCATCTACTTAAAAGACCTAGGCCTGGCTCT
CAGTCCACTGAGCTACCCAGCTGTCCCCAATAGGGGTTATTTTAAACAAAAACAAAACTT
ATGGAGAGAATCAGATTGGAGTGAAAACTGGAATAACATGAAGAAAGATGATAGTAAATT
TTAGCATTGTGGCTAACTCTTGTACTTGAGCTAGTGTTCAAGAGATGAATGTCAGAAAAT
AGTTCATTTCTAAAGGAAGTCTACAGGCTTAGAGACAGGTGGTCTTAGGTTCAAATCTGG
CCACAGATACGTCCCAGCTGTGTGACCCTGAGCAAGTCACTTAACCCCCATTGACTAGTC
CATACCACTTTTCTGCCTTGGAACCAATACACAGTGTTGATTCCACAATGGAAGGCAAGG
TTGTTTTTTTTTAAAGGAAGGCTAAAATTCTCTTAAATTTTCAGTGGTAAAGAATTGTTT
GTAAAGATTATCTAAAGGGTTTTTTTTGTTTTATTTATTTTTTTTTGCTTAGACCAGCTA
AGAATCAATTAAATAAAAACCAAAAAAAATATTATGGCAAAGTTATTTCTTTAGATATTC
TTCAGTTTTAATTTGTAACTAATTTTTAAATGATCATCCATTAGGAAATTTTTCTATGAG
ATCTCCAATTTTAAAATGGAAGTTAATGGGGAAAGAGAAGTTATAGCTACCTGTATAATC
AAGAATTCAGCAATTCTATAAAGTGAATTATAGCTGTATGGGGCGTCAGTCCTTTTCACC
TTTCCAATCCTATGAGTCTGTTTCTAATTTGGAGCTAGTATAAAATTAATTACTTTTATG
TGTTACTAGTAAACTATAACATTGGTGCCAATTTTTCATTGCATTTACTTTAGGTTAGAT
TCAACGTATTACAATATGTTGTTCCAGAAGTAAAAGATCTTTACAATTGGCTAGAAGTGG
AATTTAACCCCCTAAAGCTCTGTGATCGGGTTACAAAGGTAAGTGTTCATATTGTAGAAA
ATTTTAGGTTTGGTATTGGGGTAAAAAAGAGCTGACAGAACATCTTTTTTCTTGGAGGTT
GGGCTAGAATTGTCTGGGAAGAGTAAAAGCTTCCCAAGAAATGTATACCATTTAATAATG
GTGTTTTCCAATGAACTTTGTGCACATTTCATTGATTTTTCTTGTCTTTTTAGGAGAAAA
GGTATTTCTCATGTACTAAATAAAATTTTGGAGGTTAATTAAAAAAAAAAACCCAATAGT
TATTTTTGTGTTCCTTTTAAAAAGATGAGAAAATGATGAGTTTTTATGTCAAAATTATCA
TTCATGCAATAAAGTTTTCTGAAGTGTTTTCCATGGTGTTACTGTGGCTTAATGATATGG
ATTTGTATTTTCAGTATTATTTTATGCATTATACAGCTTTTTTTCTTATTCATTCATTCA
TTCGTTTATTATTTGTTTTTTAGGTTCTAAATTGGGTGAGAGAACAAGCTGAAAAAGAAC
CTGAATTGCAACAGTATGTCCCACAATTGCAAAACAACACTATTCTCAGACTTTTGCAGC
AGGTATAAATGCAAAGTGAATATTTTAAATGAGAAAAGTGTAAAAACATCAAGTCCAGTG
TAACTTTGATTACATATTTTAGAACAACGTTGACGGTCTTCTTTTTCCCTTGTCTTTTGT
TTTTGGGCTTCCATGATTTGGTTGTTGGGGACAAAATGATCCCTGGAATCAGGGAACCTA
GTTTGAGTCCTGACACTGACACCTTTTAAACTATTGGGAAATCATTTCACTCCTTTTAGG
CTGTTTGCTCACCTCTGAAATATGGAGAGTAATACTTGGAACTACCTACCCCACAGAATT
TTTGTTGGAATCAAATGGTAAAATGATTTTAAAATCTTAGCAGTATTTAAATGGATTTCT
TTTTACACTCTTTGTATCCTTGTGCACGTTTCATTGACCTGCTTTCATTGTTCACGAAAG
CAGTGTTATTTCTGACGTGCTATACAATTTATAGAAGGTTAATTAGCAGTATAACTTGGT
ATAGTAATGCTGCCAGTCTCCTTCAAACACACACAATATTTAGAACAAGGAAAGAAACCC
AAACAAAACATTTCTTATCCGAGTTTTTCCAAAACAAGTGAGAATGCAACCATAAAGATT
TCTTTATTTTAGTATTTTTTTTTTTGGGTAGGATCAAGAAGAAAAAAATAATCATGTGTT
CTTATGCAGGTGGCACAAATATATCAGAGCATTGAATTTTCTCGTTTGACTTCTCTGGTT
CCTTTTGTTGATGCTTTCCAACTGGAACGTGCTATTGTAGATGCAGCCAGACATTGTGAT
TTGCAAGTGAGTGCTGGTGAAAAAATTACTGTAATTTTTAGGGGGAAAAGGGAAGAAAGC
CATTCTGAATATTTTACATGAATCTGTTACTACACTGTTAACAATAGTAGCAATGCTGTA
GAGGAATCATAAATTGTTTTGGATAACTTAAATCATGATTTTAAAAATATGAATTCTTTA
CCTTATAAATTAAACTTGTTCATTCTATCCATCTAACCAAGGATTTTTAAGGGCCCACAT
GCCAAGCACTGTGCTTGGGCATTGGAGATAAAGGAATGAAATAATTACTACTCTTAAAAG
AGTTTACAGTCTTGTTTAATATATATTGCGAAGACCAAAATAAGAATCTCTTTTAATTCA
TACTTTAGAATTTCTTTCTGAGTTGACATTTTGAATTTGTCATATCTGGTCAACCTATGT
GGATATTTGGGCCTCACAGTTTATAAGTTTAAGTACTGAGTTTTTTTTATCTAGAAACTT
TATTAATCATAATTCAATTTAATTTGTAAAGGTTCGTATTGATCATACTTCAAGAACATT
AAGTTTTGGATCTGATTTGAATTATTCTACTCGAGAAGATGCTCCAGTTGGTCCTCACCT
TCAAAGTATGCCATCTGAGCAAATAAGAAACCAGCTGACTGCTATGTCCTCGGTGCTTGC
CAAGGCATTGGAAGTTATTAAACCTGCTCATGTTTTGGTATGTATAAACTTTCTAGGTGA
AAATGTACTGTAAACATTATGAAAGAAATAGAACTATTAACTGTATTTTTTGAAGACGGG
TTATGAAAGACATTTGTTTCTTTCCCATTTCAAGGTTAGTATTGTATCACATAGGTCTTT
CAAATAATTTTACCCTTTTTTTGTTTGGAAGTATTTGAGAATTCTTACTCGGGTCCAGTC
TTTTCATTAGAAATGCTAGAAATTTTATTCCATTAAAAGTACTTATCTGCCTACAGGATT
ATACTCCTTTGTAGGCAAATTTGTTTTTAGTTTAAGCCTTTTTTACCATTTGTAAAGCTG
GCAGGTCTGGTGTCATTCTGTATGTCCTAGTACTTAAACTTTGGAGTGTTGGATTTTGGT
AAGATTCTCCCAATACTTTTTCTTTTCACATTTCTTTTAGGAGGTGCTTGGTAGAGTTGC
CCTCTGGTTCTAAGATCTTTTTTTTGTAAGCCCTTAATTTCCGTATTAGAATCAATACTC
TGTATTGGTTCTAAGACAGAAGAGTGGTAAGGGCTAGGCAATGGAGGCTCAAGTGACTTA
CCCAGGATAACACAGCTAGGAAGTATCTTGAGGCTGAATTTGAACTCTTGTCTCTGGGCC
TGGTTCTCAATCCACTGAACCTCCCAGCTGCCCCCACTCTTAGTATTTTTTAAAGTAATA
GTGTCCAGACTTTTAAAAAAATGATGATTCTCATGGAATCCAATCTTTTGAATTTTTTCT
AATATTTTTTGCTGTTAGAACTACTGATTTCTGTGTAGACTTATAGTGTTTAGGAGTTGG
TTACCTGGTAATGTTGACTGCTATTTTCTAAGCTATTCTTCAAGGTAGTTCTTGTGGAAG
ATCCAATTTTGCTTTGGGTCTTTGTATTTGCAAATAATGAATTTACTCCTCTTTTGGAGA
TCTCTAAATTTGTAATGCTGTTTTAATGCTAATTGATAGGTTTTTTTTTTTAGTGGTATT
TCTTCTCTTGATTTATTCATCTCTCTAGCTATTTCCTGAGTTGAGGATTTGTGCCAGATT
CAGACCTCCTTAGTTTCTACCTATATCTCCTGCGTTTCTGTGCTCACCCTTTTGTTCTCA
TGGATTTTAATCCCTTCTTCCCCTCATTCCTGGGATCTTTGAATTTCAGAGTGCTCAATT
TTCAGGATGCTTTTTGGTGTCTTAGGTGAAGAATATTAATGACTTCAGAGTTCTTGAGCC
TGGAAGCCTCTCAGTTTGATGCTTCCACACTATTCTGGTCAATGTCTACTTTTTTACTGT
ACAGGGTTTGTAGGGTTCTTATTGTTATTTATTCATTTTCAGTCATGTCCTACTTTTCTT
GATCCCATTTTGAGTTTTCTTGGCAGAGATACTGGAGTGATTTGCCATTTCTTTCTCTGG
ACTCATTTTATAGATGAGGAAACTGAGGTAAATAGGTAAAAAAAAAAGTGACTTGCTCAG
GATCACAGCTAATGTCTGAGACCAGATTTGAACTCAAGAAGATTAGTCTTCCTGATTCTA
GGTCTAGCACTCTATTCACTGCACCACCTACTTGCTCAGTACTGGAGCTTTTTTAAGGGA
GCTTTTTACTCTTGCTACTTCCAGACATGAGCTTTGCATGCTACAGGTTCCTCTGATCAT
ATGTGGCTTGTAGCCCTTAGTCTTCTGGTAGATATCTCTAAAGTCTCAAGGGTGGAAGAA
ATCATATATTCTCGTTCTTACTGTATGTATTTCTTGATTATTATTCATCTCGTATCAAGT
AGACTTAAGTTTGTGGGAACAGGATGGCTTTCCTCTTTGCAAAGCAGCCATTTTAGTTCT
TCACAGAAAATTATACATGAACTAGATTTTAATAATTTATAGCAAGCTTTGGCATTTAGG
AAATCTTTTGTCTTGAGCAGTATTGACTTTGGAGTAAGCTAGACTTTTAAGTTCAGATTC
TGCCTCAGATACTCTGTGATCCTGGGCACTGAGTCTCTGTAAAATGGGGATAAGATCTTA
ACCAGGTGCTACTACAAGGGAGAGACCAAATGAGAATATGTGAAAAGCTTAAAATTCTCT
ATTTTTTTTATTAAATAATAGCAAGAAAAAGAAGAGCAGCATCAATTGGCAGTCACTGCT
TATCTTAAAAACTCAAGAAAAGAGCATCAGCGCATCTTGGCTCGCCGGCAGACTATTGAG
GAGAGGAAGGAACGCCTTGAGAGCTTGAATATTCAGCGTGAGAAAGAAGAGTTGGAGCAA
CGAGAAGCAGAGCTACAGAAAGTTCGGAAAGCTGAGGAAGAGAGACTCCGCCAAGAAGCC
AAGGAAAGGGAGAAAGAGCGCATCTTACAGGAACATGAACAAATCAAAAAGAAAACAGTC
CGTGAGCGACTTGAGCAAATTAAGAAAACTGAACTTGGTGCCAAAGCTTTCAAAGATATT
GATATTGAAGTGAGCGTTTTTTTTATAAATCATGTTCATTCTTGTGCTGATCCTTTTTTT
TTTTTTTGACTCAAAAATCAGTAACTTTTTATTGCTTTCCTGATTTTTAAAGTAGAAATA
ACTACCTAAATGTTTGCTGTAAAAAAAATGAAAATGTGAAACTCATTGCTTCAATACCTT
TTTGGAACCAATATAACTATTGTTTTCTGTATACCTTTCTTGGATAATTGAATAATTCAT
GTGTATTCACTTCTCTTAGGACCTTGAAGAATTAGATCCAGATTTCATTATGGCCAAGCA
GGTTGAGCAGCTGGAGAAAGAAAAGAAAGAACTTCAAGAACGCTTGAAAAATCAGGAGAA
GAAGGTGGCAAAAGGAGGGGATTTAAATGTTAATATTGCCAGCTTCCAAGTATTTATTTC
ATGTATTCTACAATAATCCTTATTTTGCTTAGATTGACTACTTCGAAAGAGCAAAGCGAT
TAGAAGAAATACCTCTTATAAAGAGTGCCTATGAAGAGCAGAGAGTCAAAGATATGGACC
TTTGGGAACAGCAGGAAGAAGAAAGAGTAAGCTTTTTTCCCATCACTGCTCAATTTTTGA
CTCTTTTGTAACCATACTATTTAGAGCCAAGGTTATAGAAATAGCATAATTCCAGAAGTT
ACATTTCTTTATAATTGTTTGGACTGTACTACAGAAATATTCCAAAGATATTCAAATGGA
CTTTGTGTTTAACGATCTTAGTTTTAGGCTGAAATCTCTAAAGTTGAAACTTGAAAACAG
ATACTATCTGTCTTTGCTGCCTTAGCCCCCACGCCACTTTGTTTCCTTAACCTTTCTTGT
GTCATAGACTTCTGAGGGAGGATGCAATCAAAGCTATTATATTGAAATGTAGTTTACAAG
TTATTTTTTAAAACAATAACAAAACAAACTTATGGATCCAGGATAAGAACTCTTATTCTA
AATTGATCCTCTGATAAATATTCAAATTTTATTTATCTATTTCTCTGATTTGGCTTCTTA
TTTTACTCATTTAACTTCGTGTCATGGAGCATGTTAAGGAATTTTTTTTTTAAACCTTTC
TGTCTTGGAATCAATACTGTGTATTGGTTCCTAGGCAGAAGAGTGGTAAGGGCTAGTCAA
TGGGGGTTAAGTAACTTGCCCAGGGTTACACAGCTGGGAAGTGTCTGAGGCCAGATTTGA
ACCTAGGACCTCCCATCTCTAGATCTGCCTCTCAGTCCACTGCCCAGCTACCCCCATGTT
AAGGAATTTATAATTGCAATTGTTTGGCGCTTAGAAATGGGCCTTTCAAGGGTATTCTTA
AAGTGTAATTCACCAAACCCTCTGATCTTCTTAAAGGGTGAAGTCTTCAGGCTTTATCTG
TTTACTTAAATTTTTATATAAAGTTAAAATACAACAAATATAGGAATTTCTATAAATGAT
CTTGCCCTATTAAAATTATGGGGATCATAAGGATTTCTGAAAAATGGAAGGTCCTTGATT
CTCCTTGGTACTATAAAGCCAAATAGAACCATGGTAGGGGTCCGTTCTCTTACTTTGCAG
TTGGGTATTATTGTAGCAACATTGTAATTGAGAAAAATACCTAGTAATCCTCACACATTG
GAGCAGAGTAATCTAATAAAAGTTCTAGGAGGTCTAGAGTAAAATTTTAATAATCTTCTT
ATGGACCTACTAAGTTTATATTGGTGAGATAATGAAATATTTAGTCAACAAATCCTACAG
ACATGGTAAGGTCTATGGAAACTACTAGTTTTTAGAGAATCAATTTAGAATGAATTTAAG
TTTTGATGTTAAAAGTAGAGGGATTTGGAAGCAGCTGGGTAGCTCAGTGGATTGAGAGCC
AGGCCTAGAGATGGGAGGTCCTAGGTTCAAATATGGCCATAGACACTTCTCAGCTGTGTG
ACCCTGGGCAAGTCACTTGACCCCCATTGTGTCTAGCCATTCCAAGGGTTTTAAAAAGGA
AAAAAAAATAAGTAGAGGGACTTTTATGAATTTTTTTGAATGAACTAATGATGGGTCTAT
ATTTTCCAGATTACTACTATGCAGCTGGAACGTGAAAAAGCCCTTGAACATAAGAATCGA
ATGTCCAGAATGTTGGAAGATCGAGATTTATTTGTAGAGAGACTCAAGGCAGCACGACAG
TCTGTTTATGAGGTAACCACCTCCCTGGTCCTATCAGTGAAGATCTTTACAAAGGGCTTT
TGCACTACATCAGCAGGCCTATGGTTTCATTTGTATGTGTATTCCTTACACTGTTGCAGA
TTACAAACCATCCTCTATTTCTTATCTTTTTCTCTTGCTCATTTCTTGTACCTATTTTAT
ATCTCCTTCATAGATGATCTTGTCACTGGTGGCTATCCTCTGGGTTTCTTGGACATTTTG
TGGGGTACTAGAACAACACTTTTTATAATCTTTATTGTTAAATGACAAATCTTTGTTTTT
AGATTACTCATTTTTGAGAAACTCTTTAATGACATTTATGGTCAACCAAGTTATCATTAG
TAATGTGCAACATTTAATTTAAACCTGTTGATTTTTTGTTGGGCTACCTGAGGTCATTAC
CAAAACATTGTGGCAAAAAAATGATTTTATACCATGAAGTAGCTTGGATTTATTAATGTT
GCCATGTGTGTTTCCCAGATGGAATTTGTCTCATTTTCCAATTTTCAGACCAGCCATAGT
GTCAATGAAGGAGCAGAGGATTTCCCATCTAATATTAATTATCTAAACAAAAGGCAACTT
TTTGTCCTGTGTGTGGATTATTGGACTGAGGCCATGGATCTCAGAGACCTGGGAATGTCT
TCACCTTGATGGGATTAGCAACATGATATTGACTGAGGGCTTAGTTATTACTTGAGAATC
TTTTCTGATTTGACTCTTAAGGATGAACTCCCTGACTATGTCTTTTTGAACTTTCTCTGA
TAATTAGTTTATAAAATAATGGATTCATCACCATTCACATTCCTACCATCCTTTGGAGGT
GGGGACTTTAGCTGTTGGATGTTGATAGTACTATCAGTGATTTCTGTTCAGTAATAGAAC
TCTGCATTTATACACGTTATATTTCTAAATATTGTTTACAAATAGACACTTGTAAACAAA
AGAAAAATGGTTAAAATTGTTGCTTAATTCCCCATGTAGTTCTGTACAACAAATGTTTTG
TCTGGTCTACAACATTATCCTATTGTTTCAGGCTTTAGCAAGAGGTTTCATCCCCCCCCC
CCCCCCCCCCAATGTGTTGCAGGAAAAACTTAAACAATTTGAAGAAAGACTTGCTGAAGA
AAGGCGCAATCGCTTAGAAGAACGGAAGAAACAGCGCAAGGAGGAGAGACGTGTGACTTA
CTACCGGGAAAAGGAGGAGGAGGAGCAACGGCTAGCTGAGGAGCAGATGCTGAAAGGTGG
GGGATTGGTGACTTTGGGGGCAGTTTGAGTTGAAGACATACCAAAAGGTATTTAACTGGA
AATCTTAAGCTGCTCTCATTACTCCTAGCATCTTGATCATGGGCAAATCATCTTTTGAGT
TAGCTTTCTCATACATAAAAAATAAGGACCTGGATCAGGCCAACTAATGTCTATGATTCC
TTAAAGTGTAGATGTTGTTACAGTATTCAGGTTTTTTTTTGTTTGTTTTTCATTTTAACT
AAAGCAGGACACTTGAATATTTGTGCATTAAGGAATAGCATTAATTCTCCAGCTTTTGGC
AATAGCAGATACCATGGTGGTTGACTGTTTAGTCTTGGTTTTCCTTTCATTTGAGAATTT
GTAGGAGGGACAAATGTAGGTAATGCAGCCCCCCTGATTTGAAAGTGAATGTTCCCAATG
AGAATTCTGTGGCATCTATGCNAAAATGTTATTGCATGGCTTTCTTGGACGTGAGAGATA
CTGGGGAAAACTGACAATTTACCAAACAAAAGACAGCAACAAAAACTTGCCTAAAAGAAT
AACTTTATCAGTCTTATACTTTATTCCCTTCCATGTACCCCGAGATCCAGTGACCTAGAC
ATGCTTGCCTTTCCTCCTACATATGACACATTCCTTCTGTTGTTTTTTTTTTAACCTATA
TTTTGTCTTAGAATCTAAATTAAGTATTGGTTCCAAGGTGGAAGAGTGGTAAGGGCTAGG
CAATTGGGATTAAGTGACTTGCCCAGGGCTACACAGCTAGCTGAGGCCAGATTTGAACCT
AGGACCTCCTGGGTCTATTCACTGAGCCACCTTGCTGCCCCTTTTCCTCATATTTTTACT
GACTTTTCACTTGTGCTTGAAGTGATTTCCCTCCTCTGTTTTATCTCCTTGCTTTCTTCA
AGTTTCACCTGAATTTCCACCTGCTATATATCTTGTTTGTAAATAATTTTTTTACATCAT
TACTTTTAGAATGTGCCGACTGTAAGGCAAGGGACTGGTGTTTTCCCCTTCATTGCATCC
TCTAGTGTTTCTGTATAATGCTTGAGACATAGCAGATATTTAATTTGCTAGTTGCATTTG
CTAGTTGACTGAAATTCTGTACCCTGTAAGGAGGAAGGAAATGTTAGGAGGTTATAAATG
ACTAATTTTATAAGGGCATTAACCCTTAAAGGTGCTTTGTCCGTTAATTTTATGTTGGGT
TCTTAAAAGTTTTTGACCATTTAAAAGGTCATCATTATAAAGATTCTAAAATTTGTGAAG
AAACTATATAGAAAACTGGTTTTACAAGCCTGTAAGATTATAATATACTCAAATATAATT
TTAGAATTCTTAAAGAATACTACTAAGCATAATTGTTCTTAACATGATTTTTAAAAAAAG
CTTACACATGTGTTCTTGGTATTTTGATTTGGTTGCTGTAGGACTCTCGTTGGGGTGACA
GGGACTCTGAGGGCACTTGGAGAAAAGGTCCTGAAGCAGAATCAGAATGGAGACGTCCAC
CAGAAAAGTACGTATGATTGAGGGAAGCTAAATTGACTATTCACTAATTTTTCTTTGTTT
TTTTAATAGTGTTTGAGGGCAATGGTGTGATTTTTTTTTTTTTAATGCCAGATGGAGAAG
TATACATATAATTGTTTAATGGATTTTGGCAACATGCTCAAATGTTTGCTATCATACCTT
CTAAATTGTTTCCATTATCTTGATAATTCTAAGGGCTTTTTCATTTTTCTGTTATGAGTA
GTAATGGGTACTACAAATTTTTTTTTAACACTTTCATGGTAAAAAGGTATTTTTGTACAA
ATTTTATACATAGCATATACCAAGTAGATCAGATTCCCTTTAAAATTTAAAATTGCCATC
TTCCTTGTTTTTATAAGTAAAATGATGGATTTACTAGCATTTTGCTCCTGGAAATGAAAC
TTAGAACCAACAATTTGGAAGTGTATTTATTTAGAAATGATTGAAATTATTTTTTTTAAG
TGAAATATGTGCTTTCTTGAGAGATGTGTAGATGTCTTTGATTTTGAAGAATTTTAACTT
GTAACTTCACAGGGAATGGCGGCGTGGAGAAGGTAGAGATGAGGATCGATCTCTTCGAAG
AGATGAGGACCGGCCAAGACGTGCAGGAGATGATGAAGAGAGAGACTCTTTAAGAACAGA
TGATGACCGCATTCCTCGACGTGGCATGGATGAGGACAGGCCCCTTAGGCGGGGTGGTGA
TGAAGACAGATTCCCTAGGCGTGGGGCTGATGATGACCGAACTTGGCGTAATACAGATGA
TGATCGACCTCCCAGACGGGGTCTAGATGAAGAAAGGGGAACTTGGCGTTCTGCAGATGA
TGATAGACCGCCTAGGCGAGGACTAGATGATGATAGAGGAAATTGGCGAACATCTGATGA
GGACAGAGGTCCCAGACGTGGAATTGATGATGATAGAGGACCAAGGCGAGGTGTTGATGA
GGAAAGATCTTGGCGGAACACAGATGATGATAGGGGTCCTAGGCGTGGCATGGATGATGA
TAGGGGTCCAAGGCGTGGCTTAGATGATGATAGGGGAACTTGGCGTAACATGGATGATGA
TCGACTTTCTAGACGAAGTGAAGATGATCGAGTTCCCAGGCGTGGGGATGATTCAAGACC
TGGTCCTTGGAGACCTCCATTTGGCAAACCAGGTAAAATTCAGATCTCTCTAATAACTTT
AGTTTGGTTGTTTATTGGGTGTGAGGAAGAAGTTATTTTGGAGTATATAGAAGTTTAGAG
GATTGTCTGGATTTCCATTGTTCTTTACTAAGCTTGATCTAGATAGTCATAATGGTTATT
TTTTATTCCTTATCCCTACTTTTATATACCTATCTAATGTCTGCCTTATGTTATACATTG
TGTTGCTAGGTACTTTTTATTTTATTTTACTTATTTGTGTTTTAAACTCTTAACCTTCTA
TCTTAGAATTAATACTATATATTGGTTCCAAGGCAGAAGAGTGGTAAGGACTAGCTAATG
GGGGTTCAATGACTTACCAAGGGTCACATAGCTAGGAAGTGTCTGAAGTCAGATTTGAAC
CTAGAACCTCCCATCTCAATTTACTGAGCCACCCAGTTGCTCCTTACATACTCTTTAAAT
TCTTCAAATTCTTTATGGTGTAATGAGTGAGAAAACTAGCATATGAAGTAATTTGAATCC
TAGATTTAGAACTGGAAGAAAGCTTTGAAGTCGTCTAATTTGAGTCCTTCATTGTATAAA
TTAGTCCTGAGGCTTGGAACTTGTTGAGCCATTCACCCAAAGTCATACAAGTAGTGACCC
ATGATTTGAGACAATTTACAGCTAACCTGTAAAATAAGTAAAACAAGAATTTCAAACTTG
GGAAATTAAAAATTATTATTTTTTTTAATAAAACAAGTTTTTTTTTTTACTGAGTGGGTA
CTAATTATTGATACTGATATTCCCTATATTGTTTATTGAATTAAATTTCATCAATGTGAA
ATCAAAAAGCAAAAGCAAAGGAGCTCTTCAGATAGAAGAATCCATAATTATGAGGGATAA
AAAATCTGTTATGAGGTAGGGCAAGAGTATGTTGAAGAAATCTCATAGTTGAAAAATTAC
TGGGGATGTGTTCTGCTTTAATCTCTTTTCACCAGAAGTTTTTAAGTTAAAAGTCATCTT
CCTCTATTTCCTCACTCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1084, 12842..13032, 13244..13380, 15252..15415, 17539..17738, 18191..18399, 21000..21171, 24053..24157, 24623..24721, 25389..25505, 26011..26196, 28281..28628, 28879..28983, 29072..29185, 30669..30791, 31882..32046, 32063..32086, 32515..32628, 33461..33546, 34092..34719
26143..26196, 28281..28628, 28879..28983, 29072..29185, 30669..30791, 31882..32046, 32063..32086, 32515..32628, 33461..33546, 34092..34719
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved