Monodelphis_domestica Locus CWF19L1
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica CWF19L1
Monodelphis_domestica
CWF19L1
1
SNORA12
27380..27529
36567
GACTGGAGGTGGCCTAAACCCTTAATGGGCTCCACTTCTACCTCTAGAGGTCACCTCAC
TTCTGACTGCATCTAAAGGATTTAATTACATTTCAAATCTGGCCAGAGAGACTTTCTTTT
ACATTTGCTTAAAATCTGCCTTAGGGAAAGTGTTCATTGAAGTGTTTTGGTTTTCTGCAG
AAGCAAAGTACAAGAAGTTAGAAAGGCGATGAAAATGGCCCATCCCCCAAGAGCTGCATA
CTTGGATGGACTTCTCTTCTCAGGCTCCTGTGCTTCAGCCCCACGGTGATGCTGCCCCAG
AGACGATCTCAGCCCCAGCTTGAGTTGTCGAAGCTTGGTTCCTGGCTGTCCTGGATGCTT
TTCTAAACTGTACCCCAGGATCTTGGTCCCAGCCCCCCACCCCTTCCCCCCCTCTCACAT
TGATGTGTGCCCTGGACAAGGCTCAGCAATCAGGATCACCCCACCTGGAGCAGAACCAGA
GAACTCATCTGGGCTCTCTCCTCCCTGCCTTCCCATCTACCCTGGACTCTTGTTCCCAGC
GTTGCCCCCGCCCTTACTCAATAACAAATAAAATGTCAGTATATCATCTTTGGGGACTGG
ACACTGAGCCTTATTTTGTCCACCCAGCTGGCACTAATCTAGGGCCCCTGAGGGGCTAGG
CCCCATGCTGCGCAGTAATGATCCCTGAGTTTGGGGGAATGGGGGAGGAGCATAGGACCT
GCTGTGGCGAGCTGGCGGGGCCCTATGGCCCCTGTTGTCCCCAGGCCTCGACTTAGAAGT
CGATAGTGGAGGATGAAAACGGCCTCACTAGGGGGGGCTCGCGGATGGACACCAGGGAAG
GAGAGGTTTTTGTCCTTCCACGCGCCCTGTATTAATGCGCATAGGTTCCGCCTTCCCGGG
GGAGGGGCTGGGGCGCCCAGACAGCGCTTGCGCGTTCGGCTAGGCGCGAGCTCGGGCCTC
CTTCATGCGACCAGTTTCCCGTCCCGCGCTAGCTGTGCTAAATGGCTCAGAAGCCCCTCC
GTCTGTGAGTGACCCGGAACCGGAAACCTCGTGGATAGTTGCTGGGGGAGTGGGAGCGGG
GGTCGGGTGTCCAAGGTTGAGAGGGCTGGTCTGCGTTCGGTGGGCTCCCTATGGAGCCCG
CCTCCGTTGGGGCACTCCTATTCCATTCATCCGGCTTTTGGCCCGTGCCTTCCACTCCAT
GTGCCAGCCCCCGGGTCCCCCCATGGAGGCCTTCCCCGGGACCCCCTCATCTCCATTCCC
CCCAGACTCCTTTTTTGCGCCCTGACCCTAACCCTCCCAAGCATCTCTACTCCCACCGCC
CTTCTACCTGTGCCATCAGCCTCCTCCCCCTTTCCTCAAGTGCTTTTTGGGGACCCTGCA
CTCTCAAGATCCTCTTTTCCCTATAATAGTTAAACGAGGAAAATTGGGCCAAGCTGAGTG
GGTGAGGTATTCTTGAGGGAAAATGAATTTGGATGCAGTGATGAATAACAACATTTACAT
GGTGTTTGAGGACTTGCATAGTGCTTTTCAAATGTTACTTCCTAACTATGTGACTCTAGG
GAAGTCACTTAACCCCCATTGCCTAACCCTTAACCTTGGAACCAATATTTTGCATCAATT
GTAAGTCGGAAGGTAAGGGTATAAGAAAAAATAAAGGGATTTGTTTTGATCTGCACAACA
GCCCTGTGAGATAGGTGCTCTTACCCTCCTTTTATAGTTGAGGAAAGGAGGCAGCGTTTA
AGTGATTTTACCAAGGGTTACACAGCTAGTGCCTGAAAGGTCAGAGACATGAGAGATTCA
CAGGGGACAGGATCAGGGAGATGGCGGAGGATGGAAGGACACAAAGAAAAGGATCCTCAG
TGCCACTTCTCTGGGAGCTGAGTTTCAACTTTAGATTCAGAGTGGAGGTAATAGGAAGAA
TGATATGAAAACAGTGAAGTATAGAGGGAGAAAGTTTTTCAGAGGAAAGATAGGTTGGTT
TTAGAGATGTTGAGTTTGAGGTGACAGCAGGACACCCTGGTAGAGATGTCTCACAGACAG
ATGGTGTTATGGAACTAAGCTCAGAAGTAATACTAATGAAAAAGATCAGAAATCCATATG
AGTACAAGAACGGTTTGCACTAAACTTTACAGGTGTTGGTCTTAACTGGATTAATTTAAT
GTTTACTTTTTGCTTACAGGTTGGCTTGTGGTGATGTTGAAGGAAAATTTGATGTTTTAT
TCAATAGAGTTCGAGCAATTCAGAAGAAAAGTGGAAATTTTGATGTAAGATGTTTCTTTT
CATATTGAAATTTAATACCATCGTTACAGGAAAACATACTAAAACAATTTTGGGGGTTTT
GATTTAGTAAATCTGCTTTGTGGTCAGGGTGAGAATCTATGGTAAACCCAGCCTTGTAGT
AGATGCAGCTTGAATGACATGTACACAGATAAACTAATATAAAATATAAATATACATAAA
ATGAAACAAAATAGTTTGAAAAGATCTTAAATCAGGGAAAATCTTTTCAAGGTGGTATTT
GATTGAGCTCAATTTTTAAGGGAAATAAGGATTCCAAGGGTATCATTAAGGAGGGCAAGT
AGTCAATAGATTCCATGTAAGTAACTATAGTGAAACATAATTGTGGAGCCATAACAATAT
AGCTAATTTACATAGTGTTTTAAGCTTTGCAGAACACTTTAAAATATCTCATTTGGTCTT
TACAACATCCCTGGGAGATTATTATCTTGATTTTGTAGGTGAAGGAATTGAAGCAGATAA
AGGGTAAGTGACTTGCCCAGATTCATAAAGCTAATAAGTGTCTGAGGAGGGCTTATTGAC
TTTAGGGACTACTCTGCCCACTGTGCCACCTTCCTGCTATAGTAGAAGACAAATCAGAGT
GGAGTACAATTAGGAAAGTTCATCATCTTGGGTGATTTTTGAGCTAGGTTTTAAAAGGCC
ATTAAGGTTCTGTTCTGGGTCCTCTCCTCTCTACATTTTCCCTTGATCTCATCTTCTTCT
CTTGGTTTAATTATCATCTTTATGCAAACAATCTTTCAAATGTATATGTCTCCTAAGTTC
TAGTCCCACATCACCAACTGCTTTTTGAAATACATTCCTTAGATGCCCCATTGGAATATC
AAATACAATTCTTTTCTCACCCTATATATAAACTTTCCTGTTTCTGTTGAGGACCTCATT
ATTCTTCAGAACTTCAGGATTGTTCCTCTACTCTTCCCTCTCTCTTGACTCCTGTTATTG
AATGAATTCCCAGGTCTTTGAAATTTTCCAGAATTATCTCTCATTTCCATCCTCTTCCTT
CTATTCATATACTATAATTTTTTTTTTCAATCATTCCCCAAGTAATGATTACCACCTTAA
TTTCCATTTTTTCATCACCTCAGAAAGAACTGCTATGAAGGTTTTTGTACATATGATCTT
TTTCCTCTTTCTTTGGCCTCATTGGGGTGTATTCCTACTAGTGATATCGCAGGGTTAAAG
TAACTTTTTTAGTATAGTTTCAAGTGGCTTTCCAAAATGATTAGACTTATTCATGACTTT
AAGCTGTCGTCACATATCTTTAGGACTGTTGTACAGGCTCCAAATTTTAATCTCTCCCCT
CTACAATCTGTTTTCCAAACAGCTAACAAACTAATATTCTTAAAATTCAGATCTAGCCAC
ATCACCCAGCTACTAAACAATCTTCATTGGCTTCACATTGCCTCTTGGATAAAATATAAA
ATCCTGGGCTTGGCATTTAGATCCATCCATAGTCTGACTCTCACCTACTTTTCTAGGCTT
TTTTCCATGTTATTTCCTTCCATAAATTCTCTAGTTTAAACTAATTCAGGACATTTCCTC
ATTTTCCATCTCCATGCCTTTGCATAAGTGTTCTAGAATGTCAGGAGTACCCTCTTTTCT
CAACTCTACCATATAGCTTCATTCAAAGTACAGTGAGGTGCCATCTTCTATATTTAGTCA
TTCCTGATTGGCCCAACTTTTAATGCTGGGTCTTTCTTGAAATTATGTTGTATATACTTT
GTAATTACTTTTCTGTGCATGTTATAATCCCACCCCCAATAGAATATAAATCCCTTGAGG
CCAGCCACCCTTTTGTTTCTATTGTTATATCTCATCACTTAATATAGTATCTTCCATTTG
ATAAACACTTAGTGTTATTGAGGTATAGTTAGTAGACATGGAGAAGAAGATACAGTAATA
ACTTAGATATGGAGGTGTGATGAATTAATTATGTTTAGAGAGAGCAAATTTATTCACTCA
ACTAGCCCATGGACTTGGGCAAAAACAAAGAATATTTCCATTCTAGCAAGTTTGTTTGGT
TACATTTAGCAAACACTGAGTACCTTTGTATACAGGACTGTAGAGGTACAAAATTAACAA
GCTCAATTTCCTGCTCAAGGAGCTGATTTTAGTAGCTAATACACAGTAGTGCAGCTGCCT
ATAGTCACATACATCTCTCCATCTTTAAAAAATCCTCATTTGATTGGATCATTCTTACTG
GCTATTCTCCTGTGGCTTTTCTACTTTTCATCGCTAAACTTATTTAGAAAGCTGTCAAGA
GTTGGTGCCTCCACTCACTCTCCTTTCTCTTCTAAGTGTTCTGTGGTCCAGTTTCTAGCC
TTATCATTTCAGCTTACGTTTTTTTTTTTGTAAAGATATTTTATTTTACCAATTTCATGT
AATGACAATTTTCCACATAAATTTTCTGAAGTTATAAGATCCAAATTGTCTCCCTCTCTC
CCCTCCGCCTTCCTGAAGATGGTAATCACTTTGATTTGGGTTATACATGAATTATCATGC
AAAAACATATTTCCAAATTGTTCATTGTAAAAGGATACTCATATAAAACCAAAACCCTAA
AATAAAAACACAAATAAATTAAAGTGTAAAGTAGCGTTCCTTGATCTGCATTCCAACTCC
ATCAGTTCTTTCTCTGGAGGTTGACAGCATTCTTTGTCATTAATTCCTTGGAATTGTCCT
GGATCATTGTATTGCTTAGAGTAACTAAGTCTTTCACAGTGGATCATTCCATAGTATTGC
TATTACTGTGTACAATGTTCTCCTGGTTTTATTTCACTGCATCAGTTCATGCAGGTCTTT
TCAGCCCTTTTTGAAATCATCCTGTTCATCACTTCTTATAGCACAATTGTATTCCATCAT
GATCATATACCACAATTTGTTCAGTCATTCCCCAATTGACAAACTTTCCAAATCTTTGAT
ACCACAAAAAGGGCTCCTAGAAATAATTTTTGTTCAAATAGGTCCTTTTCCCTTTTTTTA
GATTTCTTTGGGATGGAAATCAATACTGGTTTTACTAGATCAAAGGGTATGCACAGTTTT
AAAGCTCTTTGGGCATAGTTCTAAATTGCCCTCCAGAATGGTTGGATTAGTTCAAAACTG
CACCAACAATGTATTAGTGTCCCAATTTTGCCACATTCCCTCCAACATTTATTGCTTTCC
TTTACTGTCATGTTGGCCCAAATTACATTTTTTGAAGTTATCATTGATGCTTAATTGTCA
AATCTAAAGGCCTTTTCTCAATCCTCACTTTTTTAAATTTCCCTACAGCCTTTGATACTG
TCAATCACGTCTCTTGATACTTTCTTTTTATTTTTAGAATTAATTTCTTTTTCAATGAAT
ACAAATCCATTTTTTTCTCCCTACTGTAACAGGCTGGCACATACAACATCCCCTTACCCC
AGTTGGAAAACAGAACCCTCATTACAAATATATATAGTCAAGCAAAACAGATTACTTCAT
GTTCATATATATCTCAGTATGTACCATTAGTCCATCACTTCTTTTAGAAAGCAGAGAGAA
TACTTTATCCTGAGTGTTCTGGAATTGAAGTTGTGTTGATTTGGAGCTCTTAAATCTTTC
AAAATAGTTTGTCTTTACCATGTTGTTACTTTATAAATTGCTTTCTCTGAAACATCATCC
TTTCTTAAAGTACAATAGTATGCTTTTTAATTCATATACTCTAATTTGTTCAACCATTCC
AGTTGATGGGTACTACCTTAGTTTCCAGTTTCTTGTCACCACAAAGAGAACTACTATGAA
ATTTTTTGTACATATTTTCTTTTTTGTTTGGTCTCAGGTATATTCCCAGTAATGATATTA
CTGGAGTAAAATAACTTTTGGGAGATAGTTTCAAATTGCTTTCCAAAATGATGAGAATAG
TTCATCACTACACCAACAGTGCCTTAATTTATTTGTTTGGGGGTTTTTGGTCAACTTTGC
CAGTCTGATGGCTATGAGGTAGAACCTGAGTTTCTTTAATTTATATTTTCTAAATAGTAA
TTTTTTTAAACATAGCTTTTGATAGCTTCTCTTTTTTCTCTGAAAATTATTCCACCATCC
TTTCAGTGACCTAAATTTGCAACCTGTGTGTTGTCCTTGATTCCTTGTTCTCACCCTCCA
ACATTTAGTCTGTTGCCAACCATTGTCAATTGTGGCATCTCCTATCTAGAGCCCTTCTCT
TTCCCTGCCACCCCTCAGTTGGAGGCATTATCACATCTAGACTGGAAATAGTGCTCTGGT
GGGTCTCCTTGCTTCAAGTCTCTCCCCCTCCAATCCATTTTCATTCAGCTACCTAAAGCA
TAGAGCTGACTTTGTAATACCCAACTCCTATTTTGTAGGCAAGTTCAAAAAACAAACCAT
TTGCTCCAGGTCACACTGCTCATCGGTGTTGAAAAGGAGATAATGGGGAAAACAGCTTAA
ATATTATGCTTAGAAATTTAGACTTCAGAGGCAGCAATGTGGTTCAGTGGATTGAGAGTC
AGACTTAAAGACAGGAGGTCCTGGGTTCAAATTTAACCTCAGATAACTTCCTAGCTATAT
GACCCTGGGCAAGGTACTTAACCCACATTGTTTAGCCCTTACTGCTCTTCTGCCTTGGAA
CCAATATACAGTATTGATTCCAAGATGGAAGGTAAGGGTTTTTGGTTTTAATTGAACTTC
ATTATATAATAGTAGAATTTTAGTGCTAAAAAGGACCTTGCAGATCAAGTTTAGCTTTTT
TTTGAAAATGAGGAAACAGAGGCCTAGAAACATGAAAAGAACAATAATAGAACAATCCCA
GAGACCCAATCCAAATATCCCCAGTAGAACAGATCCATTTGGGTAGAGTCAGTCAAAAGA
AAGTTTAGAGACTTGTTCTAGAGATTTGAATGTTGATGGACTCATTTTTGTGATGTGTTT
CTTTCTAAGACTGTCTTTAGGGAGAGAGAGGATAATTTGTTGTAAAGGAACAATAAGTCG
GATCCTTGAACTTGCTTGTGAAGAACATCTCTGAATTTTTTAACTCTTTCTTTCTGTCTT
AGAATTGATACTAAAGCAGTTTCAAGGGAGAAGGACAATAAGGGTTAGACAACTGGAGTT
AAGTAACTTGCCATGGGTCACACAGCTAGAAAGTGTGTGAGGCCAGATTTGAACCCAGAT
CCTTCTGACTCCAAGCCTGGCACACTATCCACTGAGCCCCTTCTCTTAATTTGAATTGGT
AGGTAAGGAGAAGGCAGTGCCTACTACGAATTCGTGCCTTCTAGGAATTTGAATAGTTTG
TATTCATGATTTCGATTCCATAAAACATTCACAGATTGAAAATCCAATTTTGACCATTTG
CCATATATTAAATATGAAGATTGTGCCTTGACTATATTTGTATTACATTGTTTGCTTTCA
AATCTCTTTTTAGCTGCTGTTGTGTGTAGGTGATTTCTTTGGCTCAACACCAAATGCTGA
ATGGGAGGAATATAAGACAGGAGCCAAGAAAGGTACAGAAATGGTTACTAAAAACATAAG
TTTCAAGGTACCAAGGTACCAAGATTTGTGGTCCTAGTGTGTTTTATCCATGTATTGTTA
TTTCAGGATTTCCTCTTTGTACCCACTCAGCTCAGCAGGCATTTACTAAACACCTCCCAT
ATGCTGGGCACTAGAGACACACAGACAAAAATGAAATAGCCTCTCCTTTCAGGATGCTTA
CACTCCTCTGATGTGGGGAAGGAGATGCTCAAGTCACAGACTGGTTGTCGATTTTGTATG
GTGAATCCAGCATCTGTAATATGTTTAACAAATTAACAATTAAGTGGATAAACAAAGCCT
CATGGGACTCTTCCTTCTTCCAATTTTAGTCCTTTTTATCATGTAATTTACAGCATCAAT
TTTTATTACACGCTTGCCTCTATTGTCCAATAATGCTTAGCTATCTATCTGCAAGTTTTT
ACTAAGTACCTGTGTGCCAGCCACATCTAATATTGGACAGAGAGCCTACCCTGGAGGGGA
GTTTGTGTATCACATAGAGCTGCTAATGAGGTGGTGATGCAGATTTTTTTCCTTTGGATA
AGAGTGTTACACACTCAGAAAAATTTCTCATGCTAAGAAGTATGTCCAATAACAGTATGA
TGTTTCTTGTTATCTCTTTTCCTCCCCAAAGCACCCATTCAAACTTATGTGCTCGGTGCG
AATAACCAAGAAGCTGTCAAGTATTTCCCGGATATTGATGGGTGTGAACTGGCTGAAAAC
ATTACTTACTTAGGTAAGAATCAGACAGAGGTGGCAGGAGTGGACTCTGGGAAAATGGTT
ATGATAAAATAAAACAGGCAGCCCCCTCAGAGAAAATCTCCTGGAATTCCTCTCTTAGCA
ACTTTGCCTTGCTGTCACACAGGAGAATAAGGGCAGTTTCTCTGCCAAAAACCATGTTCT
TAGGGCTATATAGCCTTCCTCCTTTTCCCCCACTCTTTGCTACTAACATCTCCTTTTATC
AGTTTCGCTTCTACCAGTTTTCTGTGCTTTTTCTAATTTCTCCTTCTTCAGTCTGATTCA
CTTTCTTTATCTCTAAATGTCTTCTTACTGATCTTTAACTTTGCTATGAAGTTTTAGAAT
TTTTTTTCATCGGGTATTCCCCTAAGAATCACCCTCTGGAAAAAAAAAAAAAAAGAATCA
CCCTCTGGGACTCATCTACATATCTGGTCATACAGATTGCCAAAAAGTTGTGCTTACTAT
AAATTCATATATATTCAATGCAGTATAAAGTATATTTATTCCTGCTCCCAGCCTAGCAGG
ATCACTCTCAGTCTCTCTAAGACTGATCATTAGAAAGGGGTGAGGTCAGCATAGTTGTAT
GGAATCCTTTACTTCCTATTTTATATTGTAATCCCTCCTTATTTTATATACTGTAGTTAA
AGGAATTTGTATGGCAGGTCTCAACCTAGTTATTACAGTCCAACTGCGAATGCCTCCCAA
TCTTGTGTGTTAAAACTATTCTTAGGGCTAGTCATAGCAGCTAACAGTGCAGTTAGAGCT
CCTAAGTGAGTCCAGTGAAGATCTTCACAATAATGACAGGATACTATAAGTTTTTTTTGT
TTTTTGTTTTTAATTTTATAGTATTTTATTTGATCATGTCCATGCATTATTCATTAAAGG
CAAAGATCATTTTCTTTTCCTCTCCCCCACCCCCCATGGCCGACACGTGATTCCACTGGG
TATCACATGTGTTCTTGCTTCGAACCCATTGCCATGTTGTTAATATTTGCATTAGAGTGT
TCGTTTAGAGTCTTTCCTCTGTCATGTCCCCTCAACTGCTGTAGTCGGGCAGTTGCTTTT
CCTCAGTGTTTTTACTCCCACAGTTTGTCCTCTGCTTATGAATAGTGTTTTTTCTCCTAG
ATCCCTGCAAATTGTTCAGGGACATTACACCGCCACTAATGGAGAAGTCCATTACGTTCG
ATTATACCACAGTGTATTAGTCTCTGGGTATAATGTTCTCCTGGTTCTGCTCCTTTCGCT
CTGCATCACTTCCTGGAGGTCGTTCCAGTCTCCATGGAATTCCTCCACTTTATTATTCCT
TTTTGCACAATAGTATTCCATCACCAACAGATACCACAATTTGTTCAGTCATTCCCCAAT
TGATGAGCATCCCCTCGTTTTCCAATTTTTGGCCACCACAAAGAGCGCAGCTATGAATAT
TTTTGTACAAGTCTTTTTGTCCATTATCTCTTTGGGGTACAGACCCAGCAGTGCTATGGC
TGGATCAAAGGGCAGACAGTCTTTTATCGCCCTTTGTGCATAGTTCCAAATTGCCCTCCA
GAATGGTTGGATCAGTTCACAACTCCACCAGCAAAGAATTAATGTCCCTACTTTGCACAT
CCCCTCCAGCATTCATTACTTTCCTTTGCTGTTATATTAGCCAATCTGCTAGGTGTGAGG
TGATACCTCAGAGTTGTTTTGATTTGCATTGCTCTGATTATAATGGATTTAGAACACTTT
TTCATGTGCTTATTAATAGTTTTGATTTCTTTATCTGAAAACTGCCTATCCATGTCCCTT
GCCCATTTATCAATTGGGGAATGGCTTGATTTTTTGTACAATTGATTTAGCTCTTTATAA
ATTTGAGTAATTAAACCTTTGTCAGAGGTTTTTATGAAGATTTTTCCCAATTTGTTGTTT
TCCTTCTGATTTTAGTTACATTGGTTTTGTTTGTACAAAAGCTTTTTAATTGGTGTAGTC
GAAATTATTTATTTTACATTTTGTGATTCTTTCTATGTCTTGCTTGGTTTTAAAGTCTTT
CCCCTCCCAAAGGTCTGACATGTATACTATTCTGTGTTTACCCAATTTACTTATGGTTTC
CTTCTTTATGTTTAAGTCATTCACCCATTTTGAATTTATCTTGGTGTAGGGTGTGAGGTG
TTGATCAATTCCTAATCTCTCCCACACTGTCTTCCAATTTTCCCAGCAGTTTTTATCAAA
TAGTGGATTTTTGTTCCAGAACCTGGGATCTTTGGGTTTATCGTATACTGTCTTGCTGAG
GTCGCTTGCCCCCAGTCTATTCCACTGATCCTCCTTTCTGTCTCTTAGCCAGTACCAAAT
TGTTTTGATGACTGCTGTTTTGTAATATAGTTTGAGATCTGGGACTGCAAGGCCCCCCTC
ATTTGTGTTTTTTTTTTCATTATTTCCCTGGATATCCTTGATCTTTTGTTCTTCCAAATG
AACTTTGTTATGGTTTTTTCTAAATCAGTAAAGAAATTTTTTGGGAGTTCCATGGGTATG
GCACTAAATAGATAAATAAGTTTGGGTAGGATGGTCATTTTTATTATATTGGCTCGTCCT
ATCCATGAGCAGTTAATGTTTTTCCAATTGCTCAAGTCTATTTTTAGTTGTGTGGCAAGT
GTTTTGTAGTTATGTTCATATAGTTCCTGTGTTTGTCTCAGGAGATAGATTCCTAGGTAT
TTTATTTTGTCTAAGGTGATTTTGAATGGGATTTTTCTTTGTAGATTTTGCTGCTGAGCT
GTGTTGGAGATATATAGAAATGCTGATGATTTATGTGGGTTTATTTTGTATCCTGCAACT
TTGCTAAAGTTGTTGATTATTTCAATTAGCTTTTTGGTTGAATCTCTAGGATTCTTTAAG
TAGACCATCATGTCATCTGCAAAGAGTGATAACTTGGTCTCCTCCTTGCCTATTTTGATG
CCTTCAATTTCTTTTTCTTCTCTAATTGCTACTGCTAGTGTTTCTAGTACAATGTCAAAT
AGTAGAGGTGATAATGGGCATCCTTATTTCACTCCTGATCTTATTGGGAATGCATCTAGT
TTATCCCCATTGCAGATGATATTAGCTGATGGTTTTAGATATATAGATACTATAAGTTTT
TAAATAAGGCTTTAAAAAAAAACTCTTCCTTCCATCTTATAATCAATACTATGTATTGGT
TCTAAGGCAGAAGAGTGGTGAGGGCTAGGCAAAGGGAGTTAAGTGACTTGCCCAGGGTCA
CACAGCTGGGAAGTGTCTGAGGTCAGATTTGAACGTAGGACCTCCTGTCTCTAGGCCTGG
CTCTCAATTCACTGAGCCACCCATCTTTTAAACAGAAAATTAAATGAATAATACATCATT
TGGGCATTAAATGAGGTAACTAAAGAATGCTTAGTACAACTTATTGCCATTCATGAAATG
AGATTTTTTTCAAGATTCTAAAGGATCTATGCCATGTGCACAATCCTTCTGCCAATGCAA
ATCACAACCCCATCCATGCCATCATTGACAGTTTCATGAGTTGGCCATTGACTGAAAAAA
GGTGATTACCTGGTGGTGGGGAAATAGGCTGGTCCCTTAGATAATGGTCACACAGTGTGT
TGCTAGGTCCAATTAAAAGCCTTTTTAGTTCATTAACCATATTTTGTATCATCTTTAAGA
ACTTGGGACCAGAAACTTCACTTAGGTGGTCTTCTTCCCAGTTTCTCCCTCCCTCTAAAA
AGAACTCTTTGTATTGATGGCCGACTGTCCTCAAACTCTTAATATTATCTTTTTCTCCCT
CCCCCTTACCCACACCTCTAAACAGTTGCCAAGCACTGTTGATTCTACCTCACTGATATT
TCTTATGTCTTTCATCCAAGATTCTCATCTCTTCTCACCTAAACTATTGTAGATTCCTAG
ATAGTATTCCCATACCTGATTGCCCACCTCTGATCTATCCTTCATAAAACCCTGTACTGA
TTGTCAGACCTGTCAAGAATTCCTCAGTGGCATTTCCTGTTACCTACAGAATAATGTGCC
CATTCTTGATCCTGGCATTTAATGACCTTCATGGTCTCGCTTCAGCTTAACTTTTTGGCT
ATATCTCCTCTAGCCCACTCCCCTTCATCCAAACTACTCCCTTTCTCAGCTTTCCCTCAC
TCATCTCTCTGTCTTATTTTGCTCATGTCCCCTGATCCTAGATCCATGCCATGTCCATTT
CTGTCTGTTGAAGTCTATTTTTTCAAGTTCCAACTCATTTCATATGGAAACCAGAGGAAA
GAGCATAGCTCCAGAAAGCAATTACTTGAACACTGAGCATATCATATCTGCCTCATTCAT
GTGGAGAGTATGGCAGAAACAACCTCCTGTTAAGGAGGGTATCGAGACATTGTGTGTAGT
TACAGCTGATCTACATTTTAAAGAAATAACAACATTTTACTTAACCTTAGAAAAAAGACA
TGAAATGATGAGGACACAGGTAAAAGTCATGCAGGATGAGAAGGCCTGGATGGCCTGAAA
CCAGCACTATTGCAGCGTGCCCACATCTGTGAGAACCATATGTATCAAATGAAATGACAT
GAGTTGTAACTGCAAGGAAAGAAAAACCACATCTAGTGCATGACCATCAACTTTTATAGT
GTTTGTAACAGATTTTATTTTTGCATCTCTTATAGTTTCCAGCATTTCTTCCCCCTCTTT
CTCTTCCTATAACAAAGAGCAAAAATGATTTTACAACTGTTCAGCCAAAGTAGCCAATAC
ACTGATTAAGTTTAGCATGATCTCTAGAGTTCCACAGATATAAATCTCCACTTCTTTGGG
GCCATGCTTGGCCATTATAATTCAACAGCATTCAGTTTCAGTGGTTTGTCCATTTCTTTG
TTGTTTCCATTAAGTCTTACAATCTAAATCTACTGTCTCTTACCTGTGTTTTCCAGTTGT
CTTTTTTTCCCCCTCTGGGATTTTAAACAGATCCAAGGATGACTTGGGAGGTCTGACTAC
CTTCCTTCCAATCTGCATAAAATTTATGGTCAGTACACAGCCATCTGAATCCCTGTCAGA
AGGTCTGAAGAGGTGATAATGAAACATGCAGATAACTGTATTGTTTGAATGGGGTCTCAT
GGTCTGTAGACTCACAGTAGTTCTTATATTTGTGATGGTATAACTCACTTTCTGCATTTG
TCTGCTGTCTGTGAAGGATTTAGGGTTGTGGCCTTGTCTTCTTTCCCTATCCTTTTCCTT
CTAGTAAGGCAGTGACAGCAATACATTCAAACCAATCTTTTTATAAAATATTTATGGGTC
CATAGATCATATTCAGAATTTACTGTAAGAGGTATGCCTTAAAAATAATTTTTAAAAATA
TATAAGCCTAACTAACTCCCTTCGGTTCATCCTCTCTGTCCATCTACCTAAGGTCAGCCC
CTTCCCAACTCAGGTTGTGCCCTAGTTCCCAGAGAAGTCTAGTTTCTTTCTAGTTCTAAT
CTTCTACTCCCCTACTGGCTTGGATTCTTTGTCCCATCCCACTGAGTAGTACATATTTTG
TGGTCTTTTCCTGTAGTTATTTTTTCTTTATTGCTTTCTCACCTATGCCTTTGGGGTCTT
CTTAGATCTGTGGTTCTCTCAGACCCAGTTTATCTGATATTTTCTGGAGGAGAAGAAACC
CTCTTATTTCTTTAAAACAATTAGCTTAGCATTTAATATAGTTGTATAGTGGCCCAGCTA
TTGGGATTCACAACCACTAGCAGGTACTTGAGGTAGCTGGGCCATTCACCATGGAAATTC
TACTTTCTAGTCGGCCTAAACCTAATTTTTCTCCTATGTAGGTAGAAAAGGTGTTTTCAC
TGGTGCCTCAGGATTACAGATTGCGTACCTCAGTGGGACAGAGTCCTTGGCTCAGCCTTC
ACCTCCTTACAGCTTTACCTCCAAGGACGTATGCTCACTGCAGGCAGCTTTGCGGTCCAC
ATCACAGTTTAAAGGTGTTGATGTCTTATTGACATCCCCATGGCCCAAGGGTGTGGGGAA
CTTTGGGAATGCTTCTGTGAGTAGTTCTTGTCTAGTTGGGATTTTTTAAAACTTCTTTAT
TATGATGATATAGCATGTTGACAAACATAAACAAATGTAAATGTTTCTTCTCTACAAATA
AGAATAGAAAAATATGAAACCTTGACTCTCCTAAATGTACAGCTTTTCTGGGGAGGTGGG
GGAGGAAGTCTAGATGAAATTTCTAAAAAGCACATCATCTTGGTTTAGTAATGAGATTTA
TGTGATCTGTGTTGAATATTCCAGGTTTTACCATGTTTTAGCTATCTCAGATCCTCCCTG
AACCTTTTCAGAAACCATAAGAAATGTCCCCCTCTTATTTCTGAGGTTCCCTGGAATTTC
TTTACTTGGACAGTTCTCATTTGACATTAACATAAATGATCACAAAGAGAGTAAACAAGT
GAAACTCCCAATGTGGCAAAGCTTCTCTTATAAGGAACAGAATGCCAAGCCAACAAGAAA
GTTTGACTCTTGGTCAAAAAATTGTCCAGTGAGCTTGTGTAAGGTACTGCAATACCTCAG
GGATCTATGATTTTTTTCAGTGTGGATACTCCTTCGACTGGTACAGAAAGCAGCCCCTCT
GCACTAAAGATGACAGTCTTGTCGAATTGCTGCTTCTGAAAATTAATCGCCTTTTAGCTA
ACTATCTGATGAGAAACCCTGAACTTAAACGTAGTCTCAGCTGTAACAGGTACAGAGTGC
CTGAACCTATATTTGAAGGCTTTTCCCCTTGACAAGGGCAAGCAGAGCTTGTGCTCAGAT
AGCAAAACCATTGAGAGCCCATCTCTGTCTCATAATGAGACATCTGGGGACCTTCTTCAG
GAGAAAACCATTGAAACACCTGACATAAAAGGGTGTTCTATATCAGTGACAGCCTTGCAA
TATCACTGTAAACTGAGCCCTGAATATATTGGATTGCAATTAGCTTGATTTCATCAGCAT
TATTAACTGGAAACAAGCCAGTGCTTTCTCCTCCTCTTGTACAAATCCATGATATAACCA
AACCGGAAGCCTCTGGATATTTACACTGGAGCCATGTACATTTTATATCCTAGGAAATGG
TACAAGGCTAGTAAAGAACTAGGCAAGATACAAAAAATAATCAAAGGGGAAGAATGGGTA
CTTATATGTAGGAACAATTCCAAAATAAAGATTTCTTTAGTGTGCAAATGTGAAGATAGG
CAATCATTAATAAGGTATATAAAATCACATAAAGTCATGAACATAAAACACAAACGTTCA
CCAAATCTTAGGATATTAAAAATTCAGAGCCTACTTTGTATAAAAGGGCATAGTATAAAC
TGAAATTATGTAAATTCAATAAGGGTTCATGTAAACTTGAAGATGATTGTTTCCACGAAG
GTAAATTATGAGATACCTTGACCTTTTAGGTTCATGCATATTTCACCTAGCTGATTTTGA
AGCACTTTCACATATCATTTAATCCCTAGAAATTCTATAAAGAAGTCAGAATAAATATTA
TCAACCACACCTTATAGAGAAGCAAATTAACACAAAACAGTTAAATACTTTGTCCAAGAC
CACCAAGTGGCACATTATGGACTTGAACTCAGGTCTTTAGACCCCTGTCCCCTTCTCTCC
CATTAAATGCTTTATCTTTTTTCCCCCTTTCTCCATGGCTAATGAATTCTGTGAATATTA
CATACAAACTATTTTAAAAACATCTGGTATCTGAAGATTTGATTTGATTTTGCACTGGCC
AAATCAGGTTGTCCCAATTGTCATGAGATCTATTCTTGGCCCTCTGCAAAGAAAATTACA
CCAGCATGTCATGTTAACTAGCAAGAGCTAATCTTTCAGTTTTGTTTTTGATGAACTATT
TTGTGTACAAAAGCTGAGGTGGAACCACCTGCTACTCCTGACCAAAAACCATTCTGATTT
GTGATCCAAATATGACTCAATTCTCCTTTTGTTATTCAGGCTTATATGATTACTTCACTT
ATAGACACTTAACAACATATGCTTGTATCATGCATATAGGCACCCACCTCTGAACATGCT
TGCATATTATTTCTCAAGATCATTAAGGTCAGTCACAGAGGATGCTATTTCTCTTGCAGG
GGGATGTAGATACCAAAAAACATGGCTCCTCTTTGATCTCCCATCTTGCCATGGACTTGA
AGCCCAGGTATCACTTTGCTGCCTTGGAAAAGACTTATTATGAGAGGCTTCCTTATCGGT
GGGTATCATTTTTCTTTTTTTAAAAATGTATTATCTTTTGTTTTATATCACCTTCATTTC
TAAATAGACGTTACCCTCTTTCCCTGCCCAGTGAGCCAACCCTTGGAACAAAGAATTTTT
TAAAAAAGGTATAGAGGGAAAAAGTAGTTCAGCTGTAACAGTATCAACATATCTGACAAT
ATATACTCAGTGTTCCATTTGGGGTATATAATTTCATAGCTTCTGGCTGGGGAAATAAGC
TTCTAGAACACAGATTTCTGACTTTTTGTGTCATAGGACCCTTTGGTTGTCAAGAAAAGC
CTATATACCCTTCTTAGGGTAATGTTTCCTCCCTAATCGAGGGAAAAGCTAAGTTTCACA
TAGAGATGAGTGAAGATAAAGATGTAATTTATTTTTCATCCAAGTTCATGAACCCCTTGG
AATTTATCCTCAGAGCCCTTAGTGGTTTGTGAACTCCAGTTAAGAACTCCTGCCTCAAAA
GTTTAGGGCATACATGGTTAAAATTTTTATAACTACATTTACTTGCTTCTAAGACCCTAC
TTAAAGTTTCCAAGTTAAACTGTTGCCCTTTTATATAGACTTGGAAAATCACATTACATT
AGTAGTCACTTAAGAAGCATATCTGAAAATTTCAGTTTAGCAGGCAGGAGGGAAAGATGA
TACCAGACCTATTATGTGAAATGGTCAGTGCAGTTAACTAGTTATCTATACTAATGGAAA
AGAACCAAAGTTGGGATAATCTACATTTTTCTTAGCTTTGAGATGTAATTTCATTCTTAT
AATTGAATATATGTCTGACTTGGAACTTATATATTTCATTTCAAGTAATAAAACTACATT
GTGAAAACTTGTTTTAAGATTACTAGGAGATTGCTTAGATTAAAAAAAAAACCAAAAACC
TGTTCTTTGCTAGCCTCTTCTATATATTTTATGCCAGTAAGTATAAAATAATTTAGCTCA
ACTTAAGATTTACTCTCTCTTGGAATTGCTTCTCCTTCACAGAACAATAGGGATATGATC
CATTAGCAGAGAAATGAGATTTGACTGTATTATTTCCAACTTTCCTTTATTCCAAACCAA
AATCACTCTTTCAGATGCTTCCTCTTTTCCATGAAATTACTTTTTGATTATCATCCAAAT
ATAAAAAGTTATGATAGACAGTGAGATTAAAAACAGGCAGTGAATTGAAATGGGAGCAAT
TTCCAGCCCTTCTGTTGACAGTTTAACCTCTTGACTGCTGCTCCCCAGGGTAGAGCTCAA
GTGTGCTCAGAGTTGAGTCTCCTGACTTCCCTAGTAATCAGGGCTATAATTTATTTTGGA
ACAAGAATTAGCAACCTACTCTGTATTTGTAAAGCCTAGGCTTTTTAAAAAATCAGATCA
GGAATAAATTGACATTTTAAAACAAGTGTTACTGTATTTTGAAATATGAAAACTTTTTAG
TTTTCTGGCTGTACAAAAAGGAACTGGCCAACCTCTGGCTTCAAAAGAGGCTTTGAAGGA
GTGCAAAACCCAGAGAAGATTCTACGGAAGGGTTTGTAAAAGAGGACTTGCTGAGAGAAT
GGAAGATATTTCAAACTAATCTTAAATATAAACTCACAGCAAGGGCATGGTCAGATCTCA
GAATGGTAGAAAGCATTGGTGGTATTGCCAGGAAAGATGCAACATGGAGTCAGGATCTGT
TGCATCAGGGGTTGCTTCCTTTATGTTCTTGGGACACATGGAAAGTATCTGGAACATGAA
GAAAACAAAGCATTTCACTTCATGTCCTCAGAAGGAAGCCCTGCTTTTATGTCCTGTGGG
CACTTCTGTTTTAATAATAGTAATGATAATGATAGTAGCCTCAAGGGCAGCATATTGAAT
AGAGCCCCGGAATTATAGGCAGCATATTCTAGTTTCAAATCCTGCCTCAGACATTTACTA
GCCATGTGCCCCTGGACAAATCACTTAATCTCATATGTAAAATGGAGGTAATAATAACAT
CTGTTTTGCTGATCATTCAATCTAGTGGATTGAATGAGAGAATCCATGTAAAGCACTTCA
CAAACTTTGAAAGCATTATATAAATATTAGCTAGTAGTATACACGTAAGAGGAAGAGAGA
ACTCTCACTGATCTAAAACATTTACAAAATACTGCTAAGTTGAATATAAAGGTCGCATCC
TCTTTTCTTTCAAATCTGTTCTAGAAACCACATAGTCCTCCAGGAGAGTGCTCAGCATGT
TACTCGGTTCATAGCTCTGGCAAATGTTGGAAATACAGAGAAGAGAAAGGTAAATATTTA
ATCATTGCTATTGTACCCAGTAGGTTCTCCTCCAGACAGATACCCATATCTAGAAAAGCA
GCATCCAGATGCTTGCTGTCCATAGAAAAGTACTGGTAGTTGAAAGACCTTGATCATTTA
TTCTCACCAGTAGCACTGTCTTGGGTAAGTTCAGCAAGATCGTGACAGTCTCAGTGAGTC
CTGATTAATTGCCTAGAGTGGAAAATGTGAACATAAAAACCAAAAGTACTCTACCCTTCA
GCAGGCCCAACTTTGATTCCGAAATTCATTTGTTAGCCTGTTGTTACTGCTACTGTTGCC
CATGTTGGTACCATCTTTTGTATTCATTAGATACACATGTCAGGTTTGAAAAGATGATAG
GAAAAGATTTTGGAAAAGGTGTCCAAATAAAGCAAAGGCACCCATTTCAGAGTAATCTTA
TTCATGTACACATATCCATGCAGTGAGCGGTCTGGAATATGTAATTGAGAAGCTAGTTTT
ATAAATTCTTAGTGACAATCTGCTTACATATTTGAATCAACTAGAACAGGGATTGGCAAA
TTTATAGCCTGCAAGACCAAATCCATATAAGGATGGTATTTCCATTTTTTTAAAATAAAG
TTTTATTTAAAAATGAAAACGGGGGGCAGCTGGGTAGCTCAGTGGATTGAGAGCCAGGCC
TAGAGATGAGAGGTCCAAGGTTCAAATCTGGCCTCATCCACTTCCTAGCCGTGTGACCCT
GGGCAAGTCACTTGACCCCCATTGCCTAGCCCTTACCACTCTTCTGCCTTGGAGCCAATA
TACAGTATTGACTCCAAGACGGAAGGTAAGGGTTTAAAAAAAAATGAAAACACAGTTTTA
AACTCTTGATCTGCACAAAAACAGGAAGCTGGTGAGATTTGGCCCTCAGGGTTTGAAAAC
CCTTCTTGGAAGCTAAAGGAATAGTGGCAGCTAAGTGGTTCAGTGGAAGGAGAGCAAGTC
CTGGAGTCAGGAGGACCTGGGTTTAAATCTGGCCTCAGATACTTCCTAACTATGTGACCC
TGGGCAAGTCACTTAACCCCAATTGCCTAATCCTTACCATTCTTCTGCCTCAGAACCAAT
ACTTAGTATCAATTCTAAGACAGAAAATAAGGATTAAAAAAAAAAGACAAAGCTAAGGTG
ATAGCTAGAAGCCCTGAGAAGTACTTGTTCTTCTCTGGTCTAGAAATACAAAAATAAGAA
ATGTGGCAGGCTTTGTGATGTTTTCCTGGAAGTTCAGTTGACCCACCCTGCCTTAATCCA
ACAGGCCCTGTCTTCAGTCTTTGTGAATCACAAGGCTCAACCACAAGGGAACATGTCAGA
AGTGTCCTAAGATGTATTGAGGTATAAGAGGAAAGAGCCCTGGCATAGAGGCAGAATCCA
GTTCCTAGTGATTGACTATGACCAATAAATAAGACATACACCTTGTCTAAACTTCAGTTT
TCTCATCTGTAAAATGAGGAAAATACCATTTACACTGTCTATTATACAGAGTGGTTATGA
GGAAAGTGCTTAATTCACTTTATAATTGTAAGTTATTATTGTTAGAGTTCTTTGAGACCA
TGAGTTTCAGTGGTTTTGGGCTATGAAGCATTGATTCTTCTACCTCCCATTGGTATAACA
CACACCTTCCAAGTACAGATTTTAGTCCATGCTTTCTCATCCTGTGTGGTTCTTGTCCAT
GTCTTTTTATAAATCTTTCAGAGAGGAACAACTTTCTGTCCAAGAAACTATTCTTTGCTG
TCTTTATTTCATTGGTATTCTTTGGGCATGTAGACCATACATCTCTTACCCTTCTTTCTG
CATGTTTTGACTATACCTTTTTCTAGCTATATGTATCTTTCCATTTTGATTCCACTTCTC
ATATACAGGACATCATTACTAATCACTTGTAGCCAACTTTCCACACTCATGTGTCTTTCC
ATTGTTTCATGATTTGCACCCCTGCAGACTAGAAGAATGTTGGTGCTAAAAAAGATGGCT
TTTATAGAACCACTTGAAATCATTTGGGGAGCCACTTGGGATCATTAAAGAGCCTACATG
CTCTCCTGTGGTCTGACCTAGCCTTTCCTCTTCAGTTCTGGACCCAGCTCATTGTTCTTC
TGCAATGCCTATCCAAGATGTGTGTAGGGGCAGACTAATATCGTAATTTCTTCCTTCCAT
GACTTCATCTGAGCAGTATGCATTCTTCATTTTGTTTTTCCATTGTTGATGGCTGTTTTT
CACAGAGGAAAAGTCAATCAATTGACAAATATTTTAAAGCACCTATTATGTACTGAACGC
TGGGGATATAGAAACAAAAGTGAAACAAATACCTGTCCTCAAGGAGCTTTCCTGCTTTCT
CCTGGACAAAATAGAACATACACATTTAAGTAAATATAAGGCATAGCACGGAAATAAGTT
TCAGGGCCTGGAGAGCACCAGTACTTGGGAGGATCCAGAAGGTTGTTGAATAGGAGCTGG
TACTGGAGCTGAGCCCTACAGAAATGTAGAGAGCCTGCCTCCAATGCAGGTTTGATTAGG
AAGTACATTCCAGGCCAGGGAACAGCCTGCTCAGTGGCACTTGGCTTACTGTCATTAGTA
ATAATAGGTTCACCACCAAAAATTGACTACCAGATGATGAATTTTTAACAACAGCATCTA
GACACACTAAGGGTTGAAGTGTATATCAGTGGAAGGAGTAATGGCAGATCTCTTGAAGTG
GTAATACCACACTTTAGAATGTAACCTCCTAAAAATCCTATACTTAAGACTAAGTTGATT
TCCTACTAAAAGTAAAACTTAAAAAGTCATAGATAATTCCTATAGCCCATGTGCAGGTTT
TAAAATATATATATATTTGAAACAGTAGCTTAAAGTTATATGCAAAATTAATAGAGACAA
TCTAATTTTACTGAAATAGCAGACTGCCTCCCATGAGCAGGCAAGCTTATGTTTGTGAAG
CACTTTACAAATCTTGAAGGATGACTATATTTCCTCATATCTTGGAAAAGTTTTGCAGAC
TTTTTAAAGGCAAACAGGTTAGTCTGCATTTTGGAAAAAGAAGAAACAATAACAGTGGCC
AGAAATGTAAGCTATAGCTATCCAGAATTGACAGTCTGAATAGTGTATTTTCTTCCTTTC
TTCTTTCCCTTCTTTTTTTCCTTCTCCCATAAATAACAGGTTTCCAGTGTTCAACTTTGA
TGACTTGTTATACTTGCTGTTTTTATTTTTTAAAGTGCTACTATACCTTTTATGGCAGTT
TTCATAAAGCAATTACATATTAGCCTCAAAGAACTTAATAGTTATCTTAATCTATCTTGT
TATTGTTTTTCCAAAGTACCTTTATGCATTCAGTATCCTTCCACTTAATTTGATGGATGG
GGCAGAGCTAGTGAAGCAGCCACCAGATGTCACTGAAAACCCATACAGAAAATCTGGGAA
GGAAGCATTGTCAGGAAAACAGGGCCTGGCTTCACAGGTATTCTCCTTTGGGTAACATTC
TGAAGGGAGTTGGGGGCTGGGGGTAGGGGGCAGGCTGGGATGGCTCACATGGGAACTCTC
TTTCTAGAAGATACTTTGAGCTAAGAGGATAGGGTAAGCCCAGATATAGACAAAAATCTG
TATAATCTAGATCTTACTTTATAGGAACATTTTTGTTCATTGATAGATCCCAATAGTTTA
GGTAATTCAAACAAAGTTAATATTCCATTTAATGATGATTTGGTGCTGTGCTGTATGGAT
TTAGTTAGCCTATATTGAGTCCATCTCTACCTGTCCCTGAGCTAAATCCTGCTACTTATT
TTCATGTAGACATTCTATTGTTTTGTTGCAAAAGAAATAGAAATGTGAATAAGATAACAG
CCCTTGCTTGAAGGGAACTTGGAATTGAGTAGGGAAGATAAAATGTACCTATCCATAATA
CAAAGGAGACTGTAGCAGATGTATTCAGATGTTGTAATCTTCAGTATTAGGGTCAGAGAA
TGTTTCATGGCATCTCAGTTATTAGGCTTTGAAAGATCAAGAAGCACCTGTCAAGCACCT
ACTTCAAGCCAGGAACTGTGCTTGGCCCGCCCTTGGGGAGCTCATTGTCTAACAGGGGAG
AAAATATGCAAACAAACAAGATAGAGACAAAGCAGTTGGAGATAATTTCTGGGAAGGAAG
GTACTAACATTAAAGAGAATTGGAAAGGACTTTTTTAAGGAAGGTGGAAATTTTAACTGG
GATTTAAAGAAAGCTGGGAGTTGGAGTTTAGAAGGGCATTGATCTTTCTAGTCATGGAGG
ACAACCAATGAAAATGCAGTCAGAAGATGAAGTGTTTTGTGCCAGGAATAGCCAGGAGGC
CAGTGTCACTGGAGTCTGTGGTAGAGCAAAATAAGTCATGACTGAAGGGAGCTGGATTAT
AAAGGACTTTGGGTGCCAGACATAATTTTTTATTTTATCTTGGAATTAAGAGAGAACCAT
GGGAAGTTATTGAATAGGGGAATGACTAGGCTACAGAGACATCTAAAAAGATGAGGATTG
AGAAAAGGACATTAGATTTGGAGATTAAGAGATTATTGAGAACCAGTCCTGGAGCCAAAA
GGAGTTGGATTCAAATCTGTATTTAGACACTTTATATATGTATGACACTGGGCAAGTCAC
TTAACCCCAGTTGTCTATCCCATACCCCTTTTCTGTCTTGGAGTTGTTATTAAAACAGAA
GGTAAGGGTTTTAAAGAGAGAGGGAGGTTATTGATAACTTTGGAGAGAGTGAATATGAGG
TAAGAAGCCAGACTGTAGAGAATTAAGAAGAAAGAGGAGAGGAAATGGATGCACTAATTA
TAGATAATCTTGCCAAGGAGCCACAGAAGGAAGGAGAGATAATGGAACAAGAGCTAGTCA
GGGTGGCTAGATAAGTAAAGGATTTTTTGAGGATGGAGGAGACATGGTAATGTTTGTAGG
CAGTAGGGAAGCAACCAGGAGACAGAAGAGAGTGAAGATAAGTGTTAAAGGTCTTCTGTA
GAAAATGGGCTGGAATAGGAGGATCACCTATCCCTGTAGAGGGGTCTGGCTTGGCAAGAG
GTTTGGCTACCTCACTATTCAAGACAGGGATGATGGAAGAGAGAGTGATATATTGCAGGT
AGGATTTTAACAGGTAGAGGTTTGGGGAGTAGAATGGTAAAGAGGGGTTGCAGGCTCTTG
GCCACTGTGGCAGAAGTACCAAAGTGGGATAAAGGAATTGGAAGTAGGAGAGAGGAGTAG
GTGGCTGTATATGGCTGGACATCTGAGGGTAGACACCAGGAAAGGTATGTTTAGAAGGAA
CATGGAAGGACAAGAGCTGTCTTAGCTAGACTAAGAGTTGAGAAGAAAAGGAAAGGAAAA
TAAACATTTGTAAATGTCAGGGCCAGCTTTTCTAGAGATCCTTGGAGTAATGTTTGCTTG
TTTTTGAACCTTCACAGGAAGAACCAGCCTGTCAGTTTTTCTTTGATTTAAGCAAAAAGC
AGGGAAAGAAACGTCAGTCCACTGGGGGAGACAGCAAGAGTATTTCCCCCAAGCAGCCTC
GGAAACCACGTAAGTATTATATGAGATGGTAAGGAGCACACAGCTGTGATACATAAGTAA
ATCATGTTACACAGCAGTGTTACATGAAGAGAGAAAAGAAAAGTCATCAAAGATGGGATC
ATAGATTGAGAACTGGAAGGAACCTTCAAGTTCTTCTGGTCCAGACCCCTCATTTTACAT
TTACATTTTACGAAGTGAGGCACGCCATGAAAGTCTTTCTTTCTCATTTAAATCCCAGCC
GCCTCTAGTAACAAGCCTTTGGAATAAAAGCCTGGGCTCCATGTCTCCCCCAAGCTATAG
CAGAATGGAAGCAATACCCCTACTGTGAGGTAACCTGAGTGTAGACTAGACTGACCCCTA
AAAGATGAATTACTTGGGATTATTAATTAGGATGTTTGGACCATCCTAACAGCAATTTTT
GTTTTTGTTGTTTTCTGCCTACAGCTCAGCCCCTGGGGCCCTGCTGGTTCTGTCTCGCCA
GTCCTGAAGTGGAAAAACATTTAGTAGTCAGCATTGGCACCCATGTGAGTACTTCTCCCT
TCAGTCTTTTATAGACATTGTGACTTTCTGGACTTTTATAGAGTTCTTGTTCTGTGCTCT
TTTCTTCTACTTTATATGATCAGCATTCTTTATCTTTTCTGACCTGTTTTACTTCTATTA
TTTCCACTTCAGTCATAGCTAGAAAAGATACCTGATCTTATTCTCTGCCAATTGTTTTAT
GATATGACCCTTTACAGTCATTGCAAAGCACTTGGCAAACCTTAAATATCTATTAATATC
TATCTATTATCTATTAAATATCCATATCTATTTTGAGCTTGGGAAGGTATATTGTGCAAG
GTGTTGGTCTAAACCTAATTTCTGCCAAACATCATCTGAGGACAAGGACATGATGTAGAA
ATCATTGGCTATGATTTATGGTCCACAACAGATACTTTTAGTCAGAATTTTAAATTCTCA
TGAGCTCTTACTGAGGAATCTCTGAGAGGTAATTCGACTCTCTTGTTTCTTTAGTGCTGG
TCCTTCCAAACCCGGGGTCCCCAAACTATGGCCCGCAGGCCACATTTAGCCCCCTGAGGT
CATGTATCTGGCCCCCACTGCACTTCTTTTTTTTTTTAAAATAGCATTTTATTTGATCAT
TTCCATGCATTATTCATTAAAGACAAAGATCATTTTCTTTTCCTCCCTCCCACCCCCCGT
AGCTGACGCATGATTCCACTGGGTATCACATGTGTTCTTGATTCGAACCCATTGCCATGT
TGTTAGTATTTGCATTAGAGTGTTCGTTTAGAGTCTCTCCTCTGTCATGTCCCCTCAGCC
ATTGTAGTCAGGCAGTTGCTTTTCCTCGGTGTTTCCACTCCCATAGTTTATCCTTTGCTT
ATGAATGGTGTTTTTTTCTCCTGGATCCCTGCAAGTTGTTCAGGGACATTACACCGCCAC
TACTGGAGAAGTCCATTACGTTCGATTATACCACAGTGTATTAGTCTCTGTGTACAATGT
TCTCCTGGTTCTGCTCCTCTCGCTCTGCATCACTTCCTGGAGGTTGTTCCAGTCTCCATG
AAATTCCTCCACTTTATTATTCCTTTTTGCACAATAATATTCCATCACCAACATATACCA
CAATTTGTTCAGCCATTCCCCAATTGATGGGCATCCCCACTGCACTTCTGTAAGGGGCAC
CTTTTTCATTGGTGGTCAGTGAGAGGAGCCCTGCATGTAGCATCGCTCACATAGAGTACT
ACTTCCAGTGACATAATTCTTTGCGTGGCACCTTAGAATGAGGCACCACACAAAGGATTA
TGTGGCTGCACAATGGAAGACATCAGCATGGTGAGCAGCAATTTGGGGGAGGGAGTTCCA
CACTGTGTATACTGCTGCCCGGTTAGGGTTAGGTTTAGGTTTTTATAGTCCAGCCCTCCA
ATGGTCTGAGGGACAGTGAACTGGCTCTCTGTGTAAAAAAATTGGGGATCCCTATTTCAA
ACAGCTTCTTTACTGGCCTCTGTAGAAGAACAAGATACAGAATTAATGTCCTAATTCTTC
TGCTTTTGTCCTTTCTTTCCAGTGCTACCTTGCCCTGGCCAAAGGCGGTTTATCTGATGA
TCATGTTCTGATCTTGCCCATTGGTCACTACCAGTCAGTGGTGGATCTCTCAAGAGAGGT
GGTTGAAGAGGTGGAAAAGTACAAGTCTGCAGTGAGACAGCTCTTTAAAAGTAAAGGGAA
GCGATACGTCCTGTTTGAAAGGAATTATAGGAGTCATCACCTTCAGCTACAGGTGGGGAA
GCATGGGCCAACAACTCAGAGGGAATTTAGACATCCCTGGAGGAACCCAGATTAATTTGT
GCAACAAATATTCATTGAGCATCTGGTGTGTGCTCTAGTCCTGGGGTGGGCACCGTGTAG
GAAATAGCTGGTGCTTCCTAGGCTTCTGCTCTGTGTTAGCAACAGAGAAAGCCTCAGTCT
ACTCTCTTGAGACTCATAACTCTTTTGAGGAACTTGAGGATCACATGTATAAAAAGCCAA
CAGTTAAGTAAGAGTAGGAGAGATGTCATAAAATGAGATCCAGGAAAAACATGGGGAGAA
TTCTGAAAAGGGTGATATCAGTATGGAGTAGTCAGAGAGATTTTATGAAGGAATGAGGAG
AAGAATGGTGAAGGTTGGGTTGGGAGAGAGCAGTAGTTTATATGTGGACCAGTGGGAGCC
AGGTATGAAGGTGAGAAGTCATCAGATGGGAGCTCCAACCAAGATACTGTTACAGAGGAA
GGCTAGATGTTGAAGGGGATGTAAGAGAAAGGCACGAACTTTGCCATCACAGTCTGTTAA
GGGAAATAAGACATGACTGGTGATGTGGTAGTTTTCTTTCTGGTCCATTTGTGAAGTATC
AAATTGGCCTGATTCTACCACATAGATTATGCAGGAGCAAGCAGTCTTGGGGATGGTCAG
GCCTCATCTGAGCCTTTCCCCCTTCAGGTATTGCTTTAGCTCCTACATGCAATACATTAT
CTCATGAGTTTAAGTCTTACAGATAGTACATAGAGTATGTACTCTCTGGGATGAGGAGAA
CCTATGCTGAGGGGTGTCCCTTCACCTCAATGATGTGCTTGCCGTTGGCCTCCTTTCTGG
GACCAGAGCCAGTGGCATCTGCTCTTCCCTCCCAGGTTGTTCCTGTACCTCTCAGCTGTT
GCACTACCGAGGACATCAAGGAGGCCTTTATCACCCAGGCTCAGGAGCAGCAGATTGAGC
TGCTAGAAATACCAGAACACTCAGATATCCAGCAGGTAAGGCCCTAAGTCCCCCTCCCTT
TATGTGGTTATGGGTTACTCCTTGCACAGGTGCCCCCATATGCCTTTTGCTCTGAATATT
CTTTGAGAAGCAGGAGGAGCCCAGTAGCAAGTATGCTAGGGCTCCAAGAAGTCCTGGGGA
GGTGAAAAGGGACACTGATTGGAGTGGGCTTGTGATGTGGCTGCTCAGTGTTCTGGTTGA
ATCCCTGACGGGTATTGATTTTATCATTGTCTCAGCTTTGTCTTGGGTGGGGAGTCGGTG
CTATTCAGAATTATGTCCTGGGTATCCTGGGGACATAAAAGACCTAGTTAACAATACTAG
ACTATGTAAGATAAGCCCAAAGGAGAAAAGGCTATGATTCTCTTCCTACGGGAGAGCCTT
CATAGATGAGTATGTCAGTGTGGTGGAGGTGGAGCTTCAGCTGAGTGAGAAGAATGGTGA
AGATTGGGTTGGGAGAGAGCAGCAGTTTTTGTGGGGACCAGTGCGAGCCAGGAGGGAAGG
TGAGAAGTCAAATGGGAACTCCCCTCAGGTAACTAAGTCAGTTCAGCTTATTAGTGATCT
GTTTGTTGGGCAAGGAGGAAGGTGTGTGGGACAGATGGATGGTAGAGGAGTGCTAGGGAG
GTCCAGGTGAAGCCTGAACTAAAGTGATATCAGTGGGAATAGAGAACAGGGTCTGGGTGT
GAGAAAGCTTATGAGCTACATTTTCTTCATCTTTACAAACACCGAGTACCTGCTTTGGAG
TTGCTTTGGAGAGAGGCACTGAGTCTAGGAATGTAAAGATCAAGATGTCCCAGTTCCTTC
CCTCAAGGAAATTACAGTGTAATAAGGGACATGGGATTAGATTTAAAACAGAAAGGCATC
TCAGTAGTCATCTAATGCAGCCTTCTAGTTTTGCAGATAAAGGAAGCCGAGGCTCCAAGA
GGTTTAGTGGCTTGCCTAAAGTTATACACATAGCAAAGAACACAGGCAAGATGCAGACTA
AGACTGACTTGGAGTCCAAGCTGGCTCTTTCCATCATCCCCCCATGATACCTCCTTAGTG
GTGGCATGACCACAAATAACTAATATGGAGGATGTGGAGGTGCAGGAGAAGTAGGGACCA
TTTATCTTTGGAGGACCCAAGGTCTCCATGGGGGCCAGCCTTGATCTGGCCTTCAAGAGT
GGATAGGATTATTAGCAACAGAGATATAGCAAGGAGGGCTTTGGAGGCATAGGAAACAGC
ATGTGCACAGGGGCAGAAAAGTACAGAACTTATTCAGAGTGGTGGAGGTCAAATGTGTCA
CAGAATTTCAGGAGTTAGAAAGGACCACAGTCTTTCCACAAAAGCCTCCAAGGAATAGAA
ACTCAGTGCCTCCCCAGACAACCTATTCCACTTTTGGAGAGCTCTCCTTGTTAGAAAGCA
TTCTCTGACATCAAGCCTAACATTACCTCTTTGTGACTTTGATTACTTCTGCTTTTGCCC
TCTGGGACCAAACAGACCCAGGACAGTTCCTCTTGCATATGGCATCCCTTCAATTAAAAA
AAAAAAATCTATCCCAACTATCTTTTTCGAATCTCTCCCACATCTCTTCTTCATCCTGTG
TAGCCCCAGGTCCTCATATGTCCTGGTCTCAAGGCCCTCCATCATCCTGCTGACCATCCT
CTAGATGTTCTCCAGTTTCCTTCTTAATCTGATACCCAAAACTGACCACAGTAATCCAAA
TATGGCTTTATCAAGGGAGAGTGCTCAGGATCTATTCCATTCTCATTCCTGAAATCTCTT
ACCCCCATTAGAACCACTAGATTTTTTCAGACACTTTTCAGTCTGATTGTGACTGCTCCA
TCCTGTACTTGTGAAATTAAAATTTTTTTAAGATTATTTTAAAATTTTTCCCCATGTTTA
CATGATTCATGTTGTCTCCCTCCCCTCTCTTCTCCCTCCCACCCAGAGTTAACAAGCAAG
TCCACTGGGTTATACATATATTATCACTCAAAACCCATTTCCATATTGAAATTAAATTTT
TTAATCAAGTATCAAATTTTATATTTATCCCTCTTAAGTTCAGTACAGTGTTCTGGCATG
TTAATATCTTTCTGGAATCTGATTCTATTATTCAATTTGTTAATTGTGCCTCCTGGCTCC
CTGTCATCCATAAATTTTATGAAAATGCCATCTTAGCCTTTACAAAGTCATTGATAGAAG
CATGAAACCTCCTAGGGTAAGTATAGATCAATCCCTGGACACTTCACTAGGTCCATCTGC
CAAGTTGGCATCTAAACCAAGAATAACTGTTCTCTGAGTTTGGCATTTTATCCAATTCCA
AATTCATCTGTGCTATTTCCTAGTCGACATCCTTCCATCTTTTCCACAAGAATAGTACAA
AATACTTTCTTTAAATGCTTTGCAAAAATCTAGATATGCTAGTATAGTAACCCTGTCAAA
AAAGGAACTAAAGTTTGTCTGGCATAACCTACCCTTGTAATATCTTCTTTTACTAGATGT
TCATTAACCATCTCTTTAACAACCCATTCTAGAATTTTCTAAGGAATCAAAGTCACACTC
ACCAGCATAGAGTTTGCAAACTTGATTCTCTTCCTTTTTTTTGGAAATTGAGACCACATT
TTGCCCTTCCCCAGGTCTGTGGTTCCTCTCCCATTTTTTATCATCATTCAGATATTAGTG
ATACCAATCATATATACTGATTCTTTTATCACCCAAGATTTTGGTTCATCTGGGCCAGGT
GACATGGAGTCATTAAGAATTTTTTCTCCTACTTTGTCAACTCTCTGTTGGCCATTTTTG
TCCTGGCATTTCTAATGGAAAAGTCATTTTATGTGGCAGAAAGAAGAGACTGAAAATAAG
AGGTTAGCTTCTCTGACTTCTCTCTGTTGTTATTTATCATGTCGTGTTCACTGCAAGCAA
TAATCCTAGCCCTACTTTGATCCTCTTCCTTTTTCTTAATATGGCTTTAAAAAAATCTAC
TTTGTTTTTTTTAGTTTCCCTAAGCAACCTCAACTTTAAACTCAACAATATTTATATAGG
ACTGGACCATGGTCTTATATTCATCCTCTGTGCCCCTTGTTTCCATCTCATGTCCATATC
TTTTTTTAAGTGTCATCACTTTTATCCCAGATGAGGCTTGAAACCTTGGGATCATCTTTG
ATCCTTTCCTCTTTCACAATTTATCTGCATCTGATAAGTTGTCAGGTCCTATCTGTTCCA
TTTCCAAAATATCTCTTGAATCCATCCCTTCTTCTTCATCCTAATTCAGCTTCCTCTCTT
CTTTTGCCCAGAATATTGCAGAAGCCCCCTAACTAGCTATTCTCCATCTCCATTCTCTTT
CCCCATCAATTTATCCTTTACACAAATATCACATTAATGTTAGAGAAGCATGGCTTTGTT
TGTCATTATTCCCATGTTCCCTAATACTTACTAACTAAAGTTGAAATTCTTTAAGCACAC
ATTTAAGACATACCATAATCTAGTTCCACTTTACCACCTCAACATTCTTTCACCAGATTT
CTTTGCATATGCCCTTGGTACCAAGAAAATCATTCTGTATGCAAATGCCCAAAGTCTAGG
CTACAAGCAAGAAGTACTAGATGTCTTAATATAAGAATGAAATAGAATTGTCTGAAGAGG
CTGATATGGATGAACAGGGACTAGCACCTTTAGCAAAATGATATTCATCTGTCAAAATGG
TCATCCTAAATAGCTAGTTGGATGAAGCAGCTAGGTGGCTCAATAGCTAGAATACCAAGC
TTGGAGATGGGGGATCCTAGGTTCAAATCTTACCTCAGACATTTCCTACCTGTGTGATCC
TGGGCATGTCATTTAACCCCAATTTCCTAGTTGATTTGGCTCTTCTACTTTGGAATTGAT
ATTCAGTATTGATTTGAAGATAGAAGGTGGTGAGGTTAATTAATTTTAAAAAGCAAGTCT
GACCATATCACCTCTTATTCATTAAATTCCAATGGCTAAGTAGTATATCCAAGATCAAAT
ATAAAATGTTGTGTCTGGCATTTAAAGCCCTTCATAACCTGTCCCTACCTATCTTTGCAG
ACTTCTTTCTCCCTACACCCAACCTTCCCACCTATTCTTCCATCCAGTGATACTGGCCTC
CTAGTTCCCTATACAAGACCCTCCATCATCCAACTCTTGACTGTTTTCTCTGGCAGTCTC
TCAAACCTAGGATGCTCTCTCTTCTCCTCCTTGTGGCTTCCCTGCCTTCCTTCAGATCTC
AGCTTAAGTCTTGCCTTTCTTCAAGAAGCTTTTTCTAGTCCTCCTTAATCTTAGCAGCTG
ATGACCAGGGAGATGGTGTCCTGTCTATATCTTTTTTGTGCATGCTCTATGGTTTGTTGT
CTCCCCTGTTAGACTGTAAGCTCTTTGGAGCAGGGACTGACTATTCCCTTTCTTTGCATC
GACAGTGTCTAGCAGTGCTTGGCACATAGTAGGGGCTTAATAAAAGCTTGATGATTTACT
GATAGACACTAGCACCTCTATATACATATGCTCAACAAGCAGATGGAGAATACAGGCCTA
GATTTCTAGAGGAAGATTGAGAGAATTGTCACTTACGGTGTGCTCAATTGTGTGATGACA
AGCGGTTTGTACGGAGTCTGGAGCAACGGTCTGGGCCTCATGCTGAGAAGTGAGGGCCCT
AACACTTATAGTTCTACTTACAGTTCTACTTAGCAACAACCAGGGTGACTTCTGTCCTTG
TTGGAGGAGCAGAATTCAGCTTCCAAGAGCTGTGTACAGGTTTGTCTATGCAGTTGTTGC
ACATACTTTAAAAACTTGTTTGTCTTAGATTGCACAGCCCGGAGCACCATATTTTTATGT
GGAGTTGGACACAGGAGAGAAGCTTTTCCACAGAATTAAGAAGAGTTTTCCCTTACATTT
TGGAAGGTTGGTCTATTTTTCATTTATCAGCATCACTTCATTGAGTACATTTACATGTTA
GGAACTTACTACAGGAGTACATAAATGAACAAAAGCAAAATTCCTACATTTAGTTAGTTT
CCGTTTCAGTAAGAAAGATCGTATGTATGCCAGTAGCTATAATTCACAGCAGAAGGAGTT
GTGGTAAGATCTGTGGGTTAGCAATACTGCTTAGGCAACCATTGGAGAATGGATTGGAGT
AGGGATAGACTTAGCACAGGGGAGACCACTGCAGCAATGCAGGTTAGAGGGGATGAGGGA
ACAAGGGGGCAAGCAGAGAGGCTGAATCAGCACAGCTTGGCCACTGCTATAAATGAAGGG
CAGAGGTGAAGAAGGCAGAAGTATAATCATAGGAACTTGATGAAATGTCACTGAAGAACC
CACTATTCTTAGAAAGGATATCAAGCCCTGGATTTTTACAGAGGCTCTTCAGTGAAATCT
GTGGTCTCTCCAAAGGGCTGGGCCTAGCCATGCCTAACAGAAAAACAGTGAATGAAAAGC
AAATATCTGTTGAATTACAGTATGCACCTGTTTAGCCCATTCATTTATCCATGGCACTAA
CCACTTAGACTTCCAGGGGCTTACCCTCAGGGTTTTTCCATTCCTGAGAAAATGGTGCTT
TTTAACACTATCTAAATATCAGACAACCACCAATTCTAGCTAGACTTCAGAGAGTGTTTG
GTCTAGAAAGTTATCACCCCTGCCTCACCTGTGCTACTCCTTTTTCTGAACATCCATGAT
AGTCATTGCCTCTGCTACACAATTTTGCACATGAGCTAGGATGACAAAAATAGCTCACTG
TATTTCTTTACATGGTTACAAAGTACTCTGTATTCATTATTTCATTCTTTAGAGAAGAAA
ACCCAGAAGTACCAACAGGGGGAAAAGCTTCTCCCAACTTCTCTCCAAACAATCTTTCTA
CATATTCTCTGCTCATCATCAGACACAGGCTGGTCTGAACAATGGTATTCCAGTTCTCAT
CTTTGTTAGACAGGATCTCTTAGGCACCTTAAATTCAACATGTTCCAAACTGAGCTCATT
CATTCTCTTTCCCCTCAAATGTCCTTCCTGGGGTCTTCAGCACCACCAAGACCAGCAATT
TCAGTGTCATCCTCCATTCCTCTCACTCTTCTGAACTGTTGCCAAATCTTGTTATTACTA
CCTTCAAAAAACCTCTTGTTTATGGCTCCTTTTCTACACTTTTCCAGCCATAACCCAAGA
TCAGGCTTTCATCACCATGTAAAAAATTTAATTGTATTTCATTTTCTGTTCCGGATTCTT
TCTCTGCTTGCCCCCTTGTTCCCTCATCCCCTCTCACCTGTATTTCTGCAGTGGTCTCCC
CTGTGCTAAGTCTATCCCTACCCCAACCCATTCTCCATTGGCTGCCCAAGTAGTATTTCT
AACCCCACAGATCCTACCTAAATGTAGGGATTTTGCTTTTAGGGTTAGGATTAATTTTGT
TCATTTCTGTACCCCTGTAGTAAGTGTCTAATGTAGATTCTTTAACCTTTCCTTCATTCC
TCTGCATGCATCTTCCCTGGGGAACTCCACTCTCCAAGACTTTGGCCCTGTACTTCTAAG
TGTCTCCTTGACTTTGTGTGAATTTAACATAAATGGTACCCTTACTCCATTTGAAAACTC
ATTTGACAAGGCATGCATGTTTCCTAAGTGGGGGATGCCAGAAGCCTCATGGCACCCTGG
TTCTCAGAAAAGACTCGAGTCTTGTCCTGGTGACTCCTGACATCCAGAAGGCTGGGCTCT
GACCTGAGGTCAGACTGAGGTCAAGACTGTCCAAATGGATGCAGAAGGAGGGGACTGAGG
AAGAGGGAGGTCTCTCCTTGGCTTTTTCAGCTCTTGGCTCTCTTGGACTAGAGACTCTTC
CTGGAACAGCCTCTGTGGACTAGTGAACAGAGACAAGTATTGCGCATGCAGATTAGAAAG
ACGCAGCACTTATACTAATAATTATAATTAATGGATACTCTAGAGAATTTTAATCATAAC
TTTTTTTCATCTGGTTTTGCTTCTACTACATTAGTATATCGAAAACTGGACTCTTTTTTT
CCTCCCAAACCTGCTCTTTATTTCCCTATCTCACTGCCACCACCAAAACCATAAAATGTT
TGAGCTGGAGGGGGGCCTAGGTGTTCAGTCCTCTCATTTTACAGAAGAAGAAAGTGAGGT
CCAGCAAGTTAAAGGTGAGTTTGGACTAGAACATGGGTCTTTCTACCCTAAGGCTGTGTT
TTTCCTATTAGATCACATCCTGCTCTCATCACCAGTATCATCCCTTCTTATTCAGCCAGC
CTTATCTTTCCTTCCACCTCAGCCCAGCCCAGAGGTTTCCCAGGAGATCAGCCCCTTTAG
CAAGAGGTGACTTCTGCCTCCTGTGAATCCTCATTGTTCTCATTTATGCCTCTTGACTGC
TCTTATCACATTCTGTTCATTTTTCTACATCCCTTATCTCCCCTAGCAGACCTGTAGTCC
CTTTCAGGCGTAGGGAGCAGGCCTGATTTATCTCCACCATCTCAGGGCCTTAAAAATAGG
CCTTTGTGTTTATGGAATGGCCAAGGTAGGCAAATGTGCAGCCAGTGGGGGTGGAGGAAG
ACGGTTCACATTGGCAAGTAATTGGAGAAGTAGGCTCTGGGCCTCATGACTGAGGTTTCT
TTGACCTGCCTTGTCCCCTGCAGGGAGGTTTTGGCAAGTGAGGCCATCCTCAATATTCCC
GAGAAGTCTGACTGGAAGCAGTGCCCTCGGAGCCGAGAAGAGGAGGAAGCTCTAGCCCGC
TTGTTCCGGAAGCATTTCCAGCCCTTTGACTTTGCACAGGAGGACTGACAGGAGTTCTTT
CCAGAATTACAAAAGAGAACCAGGGACCTGTCTTAAAAGTCAGCTTGGGCGTCCCACAGG
AGCTGTTTCCCTCGGTTCTAAGCCACATCTTCTGTCTTCTCACCACTGAGTCTCCTGCTG
AGCACTGAGAATTGGAGCTCTGAGGCTCCTTCTGGCACAGGAGGCAGCAATGCTGCTTGG
AGGGATGAAGCAAATTCCAGAACAAATAGCCTTGCCTGTTAATAGCATCTCTTTTAGATT
TCTGATACAAATAGCCATTATTCATATTTTGATTTTTTTTAACTACCAAAATAAAAATCT
ACTTTGCTTGAGGGATGCTCGGTGTCACATTTGACTCAGTGGCTGAGGTCATTATTAATG
AAGTATTGAGAAAGCTTCTTGTAGCCCCGGGTTGAAGGCAAGTGGATCCCTCCCTGTTTT
CAGGACCTAACAGAGGGATGTCCAGGGCGAGAGGAAGGGTGCTGTTGGGGCATTTTTAGG
ATAGTTCCTTGGGAGTCGCCCATTAAACTCGCTACAATGTTGGCCGGTGTAAGAACAGGC
AGCTCAGATGGTAAAAAGGGGAAGGCCAGTAACACACTTGGTCACTTAAGGCCGTGAGGA
CTGTGGCTCCATTCTCTGCCCAGACGGAGTGAACAAGGTGGTGCCACGATTCCAGGGGCT
CATTGCTGGTTTTACAAACCTGATTTGGAAAAGAAATAGCAAGAACTAGTTCATAGTGGG
AGATCAAGAGAAATAAAGCTTTAAAGAGAGAAGTAAAGACTGCAAAATATACTGCCATAG
CTTTGGGACTTAGTGAGCTAGAATAGCCTTTTGTGGTAAAGGAGAGGTTTGCTATAAAGG
GAGGGAGGGCTGCTGGGGAAAGGGCTGGATGGGGTGATGTGGCATCCCCAGAAAGAGGGG
TAGCCTCTGCCTTGTGTTGACTCTAGTCTGTGGCTCGTAAGCAGTCCAAACCTGCCTCAA
GGACATGGAGGCTCAGAGGCACAGTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 2179..2263, 7693..7771, 8431..8532, 14321..14535, 16619..16737, 18924..19008, 22336..22476, 24437..24548, 24984..25063, 26602..26811, 27695..27814, 32608..32705, 35423..35567
1001..1023, 2179..2263, 7693..7771, 8431..8532, 14321..14535, 16619..16737, 18924..19008, 22336..22476, 24437..24548, 24984..25063, 26602..26811, 27695..27814, 32608..32705, 35423..35564
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved