Monodelphis_domestica Locus NCL
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica NCL
Monodelphis_domestica
NCL
2
SNORD20, SNORA75
7984..8062, 8337..8466
9719
AGACCCTACAAGAATAGGGGCCAAAAGGAGCCAGGTCAGAAGACAGGAGAGTCTGGATT
CAAATTTGAATTCAGACATTTCCTGGCTAGGTGACCCTGGACATGTAACCTTCCATTGCC
TGACCCCGTAAGTGATATTTGTATGGTTCCTGGGAGGGAGTGGGGGGAGGAGGGGTGGCA
GCTAAATAACGGCAAGGGGCCACTGGAGGTGGGGCTCACAGAGATCTCAAACTCCGCAGA
CTTGGGGTCCGTGGGCCCTCTGTACAGATGGGCACACTGAGTCCCACAGATAAGCCTGGG
GCACTCGGTCCTGTGACCCTGGAAGCCGAGTCCCTGAAAGCTGGGCAACCTCAGGTCGAA
TAATGCATAGCCGAACAAACTGCGGCTCCGGGCCGTGCCCCACCCCCACCCCCAAGGCTG
GAGGGTCCCGGGGGTAGGGAAGGCCTATTTCTCCAGGGAGCGGACGGGGAAACTGAGGCC
AGCGACTGGAGAAGCCTCTCGCAGAAACCCCCAAACTTGCACAAGATGTCTGCCGCTACC
GCCGCCCGCCGCCGCTGCTGGACGGCAGGAGGCCCCACGTGGGCAGGCTGCGCCCGAGCG
CCACGTGCTCGCCGCGCTCCGCTCCGCTCCCGAGCGCGTCCCGCCCGTCAGCCAATGAGC
TCGCCGCTCCCGTCCCGCGCCCCGCGCGTCCGCGCGTCCGCCGCCCCTCCCCAGCGCGCC
CCCAAAGCCTCGGGCTCCGCCCTCCCACTCTAGGATTGGCTAGTGCGGACCCGGGGGCGT
GGCGCGGGCGCTGGTTGGCCGCGGGGGCGTCACGGGGTCGGGGCGAGCTCCTTTCCAGTC
GCGCCGAGGGGGCAGGCTCAGTCTTTCGTCTCCGTCTTGTCCAGCAAAGGCTGCTTGTGG
TCGGCCTCCTCCTCGCGCTCTCCGTCATCACCGCCGCCGCTGCCTGGGCCTTCGCCGACG
GATCTCTCATCACCCCCGCTCCCTAGTCGCGCGCCGCCGCCATGGTGAAGCTCGGGAAGG
TAAGAGGCCAAGGCGGGCCTGCGGCGCCACGCGCGCCTGGGGCCTAGCGGGCCTGAGCGC
GCGGGAACGGGGCGGAGCGCGATGGCGCGTGCGCGGCCCGGGGCTCCCGGGAAGTCTCGC
GCGACTCGCGGCGCCTCCGTCTGTGCTGGCGGGAGGGAGGAAGGCTGAGGGCTCTGGAAG
CCCAGAGCGGCAGGAGGGAGAGAGAGAGGGAAAAGCGGCTGCGCGTGCGCGCTGTACCCT
GCAGGGGGAAGGGAGGGAACGGAGCGGGCGCGGGCCGCCCTGGGTCCCGTGAGGTCATCT
CGGTGCGCCCGGCTCCGGGACCGTGGGAGCACGTGTCTAGGCGACGAGCACATGGGCGCA
GGGCTCGCCTGGCAGCCACGTGGGGCCCAGCAGCCACGTGCGAGCGGGACCGGGCAGATT
CGGCCTCGGGGACCGCTGGCTGGCCCTTCTCACCTGTCAGAAGGGCCTCAGCCACGTGGT
CTCTTGAGCCCACTCCTGCGCCAGAGATCGGGGAGGGGACTTTCTGAGCCTTCCTGCCCT
GGGAGCAAGGGCTAGGCAAGGGGAAAGGCGACCAACAAACGGTCTCACAGCCAGGAAGTC
TCTGGGGATACCTTTAAACCCAGGACCTCCTGCCCCTGATTCTGGACTTCATAGAATGGG
CTGGAGGAATGGGCAACCCCGAAATGAGCAAGCACAGTGCATGGGGGCGGGTCCCAGGCC
CTGCACGTGGTCCTTGTCTCCCACGTGGTCACAGCCCTTTAAATTAGAGTCTGGAAAGCT
TGCAGAAGGTTGGCTGTAAACTGGTCTTCCGTGTCAAGGGTTTGGGGAACCCCCAGAGCT
CCACGAGGAAAGGTGAAGGGATGCCTGGCTTTAGGCAGGGTTCATGTAAGTGGAGATGCT
ATTGTCACTAACAGGACAGATGGAAGTTTGGGCAAAGCCTTTGGGGAGCTCCAGGGCTAC
AGATGTGACCCTTAAGTTTTTTGCTCTAGGCTGCTAAAAATCAAGGTGAGCCGAAGAAGA
TGGCCCCTCCCCCCAAGGAGGTAGAAGACAGTGAGGATGAAGACATGTCAGAAGAGGAAG
AAGAAAGCAGTGGAGAAGAGGTAACTTGTAACTTCAGAAAGGATCTGGATTGTCCTATAA
AGAGGAAGAGGAGGGGGCAGCTTAGAGGGCTCAGCGGATAGAGAGCCAGGCCTGGAGGTC
CTGGCTTCAAATCTGGCCCCAGACACTTCCTACTCTTGACCCTGGTCAAGTCACTTAACT
CCATTGCCCAGCCCTTACCACTCTGCTGCCTTGTAACCAATACAGTGTTTAAGAAAGTGG
GTTTATCAAAAAATATTCTAGGAAGGAAATGTGTAGGTGAGAAATGGAGTGAAACCTAAT
GGTCATGTAATCATTTCACTGGCATCTGTTGGTTTTAAATGTCCATGAGCTGAATGATAA
TCTTTGGGGCCTGGTCACATGAATATTTAAATCTAGATTTGAGTTGAAGGAGAAATTAAA
AGTCCAAGCTTTTAAAGGGTGTAGGTAGCATTGATCTCTATGATTTAAGGGCAGAGGCTA
TTTCTTGGATATTGAATACAATTTCCAGGAAAGAACAGCTTAATCAGGAATTCTGTGTGC
TTCCATGGGCTTTTGTGAGTTTATTGTATGGACCCTGTACATGGGGCTAATTAATGGCTT
ACAACTAAGCAAGAACCCTGCCATGAGTGTTAGAAAAGGATGAAGATTCCTTCATAGTTC
TAGAGTTGTAGGCTGTTAGCCCAGTGCTGGCACATCTGAATATACAGTGTTGGCCTCCTC
CTGGTTAACTGAGGCAACGATGTCTGTGGAAAATAAGAGTCAATGGTAGGAAGCTTTGTT
GAGTTTTTCACTGCTTCTTTATTAATAGCCTTTTAAAATGGAGCTATGGCCATTAACTCA
GATTGCTAGGATGCATGTCCTATCAGAAAAGGAGAAAGAAAGAACTTCCAGGCTATTAGA
AAAGAAAGCATTCAGTAGAACAGACTTGGCACATTTCCATACAATTGACTCCCCCCCATG
CTCATCTGTAAAACAGGTTAGACCAAATTTTCTCTCAGCTCTTAAACACCATTTCTGTGA
CCCTGGGCCTTGAAGGGTGTTGCCAGAACCTTGTTCAGAGAGTAACAGATGGAGAACTGG
AAGGGGCCTCCTAGACTGTCTCCTTTTTGGAGCAGCCACCTGTGAAGTCACTGTGAGGGC
CTTCTGGGCACAGAACACTGATGAGCACCAGGGAGATCCAGGAGGCTCATTTAGACCAAA
CTCCTTCCCTCGGGGGAATAAATTATATGATGTTATAACCAGAATAGAACAAAGTAACTA
GTGGAATTTGCCTTGCACCTTTTATTGGTTGATTGAGTTGTCCTTGTAAAATGATTAGTT
CTTCATGCCTTCCTTCCCTTTTCAGGAGTTTTTAGGATAGACTGGGCTCTTCATACCTGT
AAAGAGCATGTGAGTTGTAGTGGAGAATAGATGCTTCAGAATGATCCCATGGTAGATCAT
GAACCCCCTCTCCAGCTGTCTCAATGTTTGAGCAGTTCCTCATTTTATCCTTTACATTAA
TCTTAAGGATATAAGTGTAGTTATCTGTAAACCACTGACAGGTCCTTGTTCTCCCCACTT
AAAGAAGAGGGTCATAGTTTCCTAACTTGTACATCCTTTCAAGGCGGATGATCCCATTTA
TGATTTCTTTCTTTGGGTTAAGTGTTTTTTTGTCAATTGTAATATATTTTGGAAATGAAA
ATTATTAGGTCGTGGTCCCTCAGAAGAAGGGCAAGAAGGCTGCAGCTACCCCAGCAAAGA
AGGCTGCAGCTACACCAGCCAAAAAAGCTGTTGTTGCTACCACACCTGCCAAGAAAGCAG
TTGTGACTCCTGGTAAGAAGGCCGCTGTGACCCCAGCCAAGAAAGTGGCCACCCCAGCCA
AAGCTGTCCCCACACCAGGCAAGAAGGGAGGTAAAGCAGCAGCCACCCCGGCCAAAGGGG
CAAAAAATGGAAAAAATGCCAAGAAAGAGGACAGCGAGTCTGAAGAAGAAGATAGTGAAG
ATGAGGACGATGAAGAATTTGAGCCCCCCAAAGCCGCCAAGGGGGGAGCAGCTCTGTCCA
AACAGGATTCTGAGGAGGAGGAAGATGATGATGAGGAAGAGGAGGACAGTGAGGAGGAGG
AGGAGGAAGATGAGGATGGTAATACATTGTTTTTATTCTGGTAATGATGAAGTCTTTTCA
ATTCTTGTGGCTAAGGGGCTTAGTAGATAAAGCCAAACCTAGAGATAGGGAGTCCAAATC
TGTCTCAGACACTTCCTAACTATGACCTTGGACAAGTCACTTAACCTGAATTGATGACTT
CGCAGCGGTTGATTTCTAAGACCGAATACTTGAGTTTACCCTTTAAAATTTAGGAAATTC
ATTTATCAGAGCTTTAAATTCCCAGGCAAGAGTTAATCCCTTTAGTGGAGGCTGCCATTA
TCCTAAAATAAGCCTAACATGATCCCAGAAGAAAATTGCATCTGACACACACCCCACCCC
ACCTACCCCCCACCCCTTTGCTTATTTTCCTGATTTGTAAGCTAGCTGCCTTGATTGCTT
CTATGAGCACTTAGGCCCAGAAACTTCTGGTAATGCTTTTCTAATCATGAATGAATGTCT
GGGCTAAACCCTAATGCCCACCTTGGGCATTACTATTAAAATCAGCTACTTTTAGGACGT
TGCCTAGCAAGCTTTGGGTTGTTTTATGGGAAAGGATGTTTGGGGCAAGTATTAAGAGAC
TTTTTTTTTTTTAAGACTCTGAAGAAGAAGCAATGGATACCACCCCTGCCAAAGGGAAGG
CTGCTTCTGTGAAGGCTGCCAAAGGTGGAAAAGCTAAGGAATCCGAGGAGGAAGAGGAAG
ATGATGAAGATGAGGAGGAAGATGATGAGGAAGAGGAGGAGGATGAAGAGGAGGAGGAGG
AGGAGGAGGAAGAGGAGGAGGAGGAGGAGGAGGAAGAAGAAGGTAAAGATAAAGGGAAAG
AAACTTTGGGTCAGAGGGTCCCTCCAGAAGTGAATTTGTCATCATCTTTGACCTTTTCTT
GGTTTCCATTGGGATTCCCAAACCCAGAGCACAGCAGTTGGGCAGGAACTAGAAGTATGC
TGGTGGGTAGTCCCCTGATGGCAGGCATGAGGTTGTGATGTGCTTGCTGGTTTTGTCTTC
CAGTGCCCGTCAAAGAGGCCCCGGGAAAACGGAAAAAGGAAATGGGCAAGCAGAAAGCCC
CTGAAGCCAAGAAACAGAAATTGGAAGGTAAATACAGTGTGGAGAAAGGGTTTGGACAGG
TGAGGCCCAGGCTCACAGCTGGGTGGGCACAAGTGATGATCCACATAGGGACTTAATTCT
GAAGCCTGATGCAATGCTTGCTATATATGCTGATGTGCTCCTGCGCCTCTGGGTCTCAGC
AGTGGAGCCACTCTTCTTCCCTGACACAAGTTATTTATTTGTTGAACAACAGCTGAAACG
TCTACAAATTTCAATCTCTTCGCTGGTAACCTGAACTTCAACAAAACAGCAGCTGAGCTA
AAAACTGCCATCACAGACTTCTTTGCAAAGAAGGACCTTACGGTTGTGGATGTCCGCATT
GGTGCCACCAGGTAAGTGACCTCCAGTAGAGCCTTCCCCAACCCACCACCTTGAAGCATG
TGGATGTCTTCACTTGTGAATGCAGCCAGAGCTGAGGATAGGTCTGAAGCCTTAGAAGGT
GAAAACAGGTGTTTGCTTATTAGGACCCTGTTAATCTCAACAGATTGGATTTCTACCATG
AGAGAGGCAACAGAATGGCTGTGGAGTCAAGGTGGGCTCAAAGCCCATCTCTGATTGTCA
CCCTAATGCTGTAGGCAAGTCTTCAGAGTAAAGCCTAGAGCCGAGGCTATGCCAAGAGCA
GTGGCAACAACCTTGGTCTTGGCAGCCAGAGTGCTAGAGACATTTTCCTCGGGCTACATG
AGGAACTCTGGCCAATCTCCTGGTCTGATCTAGTTGATGGTGTGGCTATAGTTAGGGGCC
AGTACCAAATAATAACTAGACCAGCAACAGCTAGCTTTTAAAAGCTACTTAAAAATTGTT
ATTATTTATTTATTTTTTGATTTTTGTGGCTGCTGGGGGAGGAGGTTTTCTACTGTTGGA
GTCTGAGGCAGGGAGAATGCTCGAGGCTGCCCTTGAGAGTTTTAACTGAGACAGACAGTT
CAGTCTGTCCCTTGTGAAATGTAATGTCTTCATCTCATTCTTACCTTTGGGGATGTCCCA
AAGCTGGATTTGCACTGTGAGCTTCCTCAAACCTTCCTAGAAATATGGGAATACATGGGG
GTAATTAATGTGGGACAGCGCTTACTTGCTGCCACTGAGGCCCCATTTGACCAGTTGGGG
GTTTTTCTCATCCTGAATTGAGCTCACCCATGCCTAGTTATTGCTTGGCGACAGCCCCCT
TCCCACCTGTGCAAGGTTTGGGGCTTCCTACCGTTTTTTGCTTTTCCCTTTAGGAAATTT
GGCTATGTAGAATTTGAATCTGCTGAAGATATGGAAAAGGCGCTGGAACTCAGTGGCTCC
AAAGTGCTTGGCTCTGAAATGAAGCTGGAAAAAGCAAAAGAGAACAAGAAAGGTACCAGG
GACGGGACTGGATTGGGGGCATTTCTTTCCTCAGCCTCCTCCCTGGTGAGCTCTTGGAGA
CCAAGCTAACAGCATCTCTCCTCTATAGATCGAGATGCCAGGACACTCTTTGTCAAGAAC
TTACCCTATAAAGTAACTCAGGAGGAGCTCAAGGAAGTGTTTGAAGATGCTATTGAGATC
AGACTGGTCTGCACCAAGGACGGAACACCCAAAGGGTATGCTTGGATTTATGCTCATTGG
GCCATGGGTTAGATGATGTGCATTACAGTGCAGTGCTGAAAGGCCCCGTCCTTCATGAGC
TCAGTCTTGGGGGCTGTCTTAGGCAGAAGGCAGCACGAGATGGGACAGACAAGCAGAGAG
TGAGGGCCGATTCCAGGCCAGTGGGAAGGAGGTGGTCTACCCTGGAGCCTCAGGGCTGTG
CTGAGGCCAGGCTCACCTAGTACCTATGTGGTATTCTGCCCACTCCGGTGACCACCTAAC
AGGTTGCTGTCTGTCTTTGGGGGAGAGACGAGAAAGCGCCCTCTGAAGTGGAGGCCCTTT
CAGGGAGTGCTTGGGTCTCTGCCCTTGGCCTCGGGGCCTGCTGTGTGTATTAATCAGACT
TGGCCACACCACGGTCTTTGCTTCATGCTGGATGGTGCTTTTGGGGAAGTGGCTTCTTTC
CTAAATCTGCCCTCATTTTCCAGAATTGCCTACGTTGAATTCAAGACAGAAGCAGATGTG
GACAAGGCCTTAGAGGAGAAGCAGGGGACTGAGATCGATGGCCGGGCCCTCATTCTGGAC
TACACAGGGGAGAAAAGTCAAGGACAAGAGAACTCTCGAGGGAAGAACAACTCGTGGAGC
GGGAACAACAGCAAGCCATCAGACTCGAAGACACTGGTGCTGAACAACCTTGCCTACAGC
GCCACAGAGGAGAGTCTGCAGGAAGTGTTTGAGAAGGCCACGTCCATCAGCCTGCCCCAG
AACAACCAAGGCCGGCCCAAGGGGTGAGCCAGCTGCTGGGAAGAGGGAAGGGGGGGATAC
CCGAGGCTCTGAGGGGACCGGGGCCTAGCCTTCTAAATATCCTGTATTTCTGCTTAGGTA
TGCGTTCATTGAGTTTGCCTCTGTGGAGGATGCAAAAGAAGCTTTGAACTCTTGTAACAA
CATAGAAATTGAGGGCCGAGCCATCCGGCTGGAGCTGAAGGGACAGAAGACGGCAAATGC
AGCTCCCAGGAACCGTAAGTGAAGGAGGGGGGTAGCTGCCTTCTCTGCAGGTAGAGGGAG
CTTCCTGCCAGGTGCAGCTCTCCACTTCCAGGGAAAGGCTTTGTCTTGGGTGACTGAATG
ATACTGGATATGATGACTCATTATCTGAGAATTGCTGATGAAACCTCCAGAAAATTCCTC
TAGATAGTCAAGTTCTGATCCAGCTGTCAATAATTCTGTAACAGTCTAGGCACAGTTCCC
ATCAGCCTATGGGTCTGTTGTGAGGGAGGGTCGGCCTAGTCCGGGAGCTGGAAATCACGT
GGAAACCTCTTCCTCTTCCCCAGAGTCCAACAAAACCTTGTTCGTCAAAGGCCTGTCTGA
AGACACCACAGAAGAAACGTTAAAAGATTCTTTTCATGGCTCAGTGGGGGCCAGAATAGC
CACAGACAGGGAGACGGGGTCTTCAAAAGGGTACGTTGTTGGTCAGGTATGGGGGGGGTC
TTCTCAATGAGCTCCTTCCCGTCTATCAGTGATGGGCTGTGGATTCGCACGAGAAGAAAA
TTCACTTCACTCCACATGTAGTGTTCCTGTTGTCACGGGGATGCTCAAGTGTGGCTGTGA
GACAAGTGACATGGCTTGGGGGTGCCTCAAAGAGGCCCTGGACCCAGTCCAGGATATTGC
ATCCAGTTCACTTGAGGGGAGGGTCTTGGGGTGAAGGTCTGGCCAACCTGTGTGTTTGCT
GGGGGCATTTGTGCAGGTTTGGTTTTGTGGACTTCAACTCTGAAGAGGAGGCCAAGGCTG
CAAAAGAAGCCATGGAGGATGGGGAGATCGATGGAAACAAAGTCACCTTGGACTGGGCCA
AGCCCAGCGGCTTTGGGGGCCGAGGAGGAGGACGTGGTGGCGGCGGACGAGGAGGCTTTG
GGGGCCGAGGAGGTGGCAGAGGAGGCCGAGGGGGCTTCGGAGGCCGAGGCAGAGGAGGCA
ACTTTGGAGGTAAGGATGGGCCTGAGAAACTGGGGTTTCAGGGTGGTCCTCTGGGGGTGC
TGCCACCAACAGGGATGGTTACCTCCCTCTCTTTGTCCTAGGTCGAGGTGGTTTCAGAGG
AGGCAGAGGAGGAGGAGGCGACAACAAGCCACAAGGGAAAAAGACAAAGTTTGAATAGCC
CCCCGCCCATTGGACGGACTCTGGGGGTTGGAGCCTGTCGGCCAATGGCTGATAGAGCCT
TCTGAGGACATTCCAAGACAAACATGCGGTCCGAGGAAGTCGTCTTGGAGAAAGCCGGAT
GACATCTCACGGGAGAGAGCGTGTTGGTTTTGACTGGATGGACGTTCCATAGAAACTTTT
TGCAGAGACGGGTGATAGATGTGGGAAGTTGCCCTTTTTGTCTATGAGTTGTCTTGAGTT
TATAATGTTATACCCCATGTACAAAACCATTTTTCCTACAAATATCTGTAGTGGTTTTTT
GTTTCCTTTTTAACCCCTTTTGGCTGTAAAGAAAAAGGCGAATGTTTTCTCATGGTTCCT
GCTTCAGCAGCCTGTCTTAGGACACATTAAAAGGGCCTAACCTGGTGCCAGACTCTTTCC
TAAAGGGCTTTCTGTCAAGGCACCCAGTGAAGAAGCTGCCTGCTCTTGGGAGAGGATCTC
TGGGGCCTGTGAATCTCCCTTGGGCCCCTTACGGTTCTGTTCTGGGGTGATGAGAAGTCA
CTGGTGAGGGGTGTGGGCAGCTTCCAACCTGGCCCTCAAGACTAGCTGCCCCAGTTTCCC
TATCTGGAAAATGAGCTGGAGAAAGAAAATGGCAAACCCCTCCAGTATCTGTGCCAAGAG
AGCCCTGAAGTGGAGTCAGTCAAGATACAACTGAAGGACCCGGCTGGGGGGGGGGGAGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 2009..2119, 3788..4134, 4605..4675, 4815..4883, 5022..5153, 5223..5315, 5512..5650, 6533..6651, 6748..6874, 7343..7642, 7737..7873, 8183..8309, 8596..8719
1001..1018, 2009..2119, 3788..4134, 4605..4675, 4815..4883, 5022..5153, 5223..5315, 5512..5650, 6533..6651, 6748..6874, 7343..7642, 7737..7873, 8183..8309, 8596..8719
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved