Monodelphis_domestica Locus TSR1
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica TSR1
Monodelphis_domestica
TSR1
2
SNORD91
8920..9013
12958
ACAATTCACAGTTGTTGGGGTGGGGAGCCCCCCTCAGGGTTGCAAATTGCGGGTATTGA
AGGCAAGTCTGGCTTAGTTTGGCCAGCGGTGGGAAAGACACAGGATTTTTTTTTTTTTTT
GGTACGAGAAGAGACCGTAGCCCACTTTACAAAGGAGGAAACTGAGGTGAAGGGATTTGG
TTCAAGCCTGAACCACTTGAGACCCAACTCCAGAAATTAGGGGAGAAGAGCCTAGGCTGA
GGGACTTTTGCCCCCCACTCTGACCCGTTTGTTTGTTTCTTTCTTTCGTGAAGTGAAGAT
CTATAAAATTGGAGGGTTGTTCTTTTGTCTGCTTTTTGGCATCAGTGGGCACAATGCCTG
GCACATGATAGGCGCTTAATATATTCTTGATAATGGCGATGAGATCACCTCCCAGTGCCT
TTCTGGTTCTCCGGGGAGTTCTGCAGAAAGGTTACCCGGCCCACAGGGGAAAACTTGAGG
AGCTGGCTCTAGACGCACTTAGGGCCTGAGGAGGGGGTGGAATAGATCAAGTGAAAGTGA
GGAGTCACAAATAGTTCCAGCCTGGCAAACCAAAGACTGAAGAAACAAAGCAGTCGAGGC
TCCGCACAACTGGGCAGGAAGCTCAGAGCAGTCTCCCCAGGTACCAGAAAAAGCGACATT
TTCCTGCGGCCAACCTGCCTCTCCAACTGAAAGTGGACACTCCCGCAGGGACCAAACGAA
CAATCAAACTCCACTCCCCTGGGCGCTCGATTGGACTCTCCCTTTTAAAGCCCCCAGCCC
GCTGGTGGCCATGTGGGGGAAGTTTAGATCCGGGTAGGCTGTGGGTCTCAAACACCGCTT
GTCCATAGGCTAGGATGTCAGCTACCTGGGGAACCCCCGCCCCTCTCCAGCGAAGCCCCA
CCCAGAGACTGAGACCCCACCTACACAGCCTTTATGCGGGCGGAACCGGAAGCATTCGGC
TTGGTACCGGAAGCAGCAAGTCCACGCACGTGTAGAGCAAGATGGCAGTTCATCGCTCCG
GCCCCCTTAAGCAGCAGAATAAGGCTCACAAGGGCGGGCGGCACCGGGGCCGGAGCGCCG
CCCAAAGGGACGGCAAAGGTGAGGAGACCCCTCGAGCGGGGGTTGGGGGGAACAACGTGT
CGGCTTATTCCTTTCCTCGGCCTGGCCTGCGCAGGAGGCTTTTCTCCGCCGTAATCTCCT
CGGCCCTGCGCTGTCGGCCTCTCCTGACCCGCCTCGGGTCCCGTAGGGGCCCGTGGCTCA
CGGCCGCGCCTCCGACCCTGGCTCTGCCTTCTAGGTCGAGTTGCAGTGAAAGTCCTGAGC
AAGAAAGCGAGGAAGGAGCTAAGTCGAGTGGACCAGAGGCACCGGGCTAGCCAGCTCCGG
AAGCAGAAGAAGGAGGCGGTGAGGCCTCGGGAGGAGAAGCTGAGGGAGGGGAGGGCACGT
GCACAAGGCTGCTGCCCCAAAACGAGAAAGACTTGGGCCGGCGAGGGGGTGGAAAGGAAG
AACAGAAACCTTCCCCTCCCCCTCTTCCCTTGGTCATTAAAGATCAGCCTCCCAAGCCTG
GTGTCCCCTAAATCTCTCAGCTACAAGGGACCTCAGAAATACCTATTCCAACCCACAAGC
GAGCTGGCATTCTCTTTTAAGTTCTGATAGGCGGCTAAGTATATTGAGAACCAGATACAG
AGATGGGAGGTCCTTGGTTAAAACTGGCCTCAGACGCTACCTACTTTTGTGATCTCGGGC
AAATTACTTAACCCCCATTGCCTAACCCTAACCACTCTTATGCCTTGGAATCAATGCACA
ATATTGATTCTAAGATGGAAAATAAGGGTTTAGAAAAATCACACACACACACCCCCCTGG
GACATCTGGAAAGGAGGTAATGGGGGAATAACCCCTCCTTGGAGTTGGAATCAGGATTGA
AACATCCTTGTTCTTCATCCTCATCCCTCCTCTCCAACATCAATCAGTTGTTGAGTTTTG
TTGGTCTTACACAGTATCTCTACTAGTTTTTGCTCTCATTCACATGGCCATTGCTTTGGT
TCAGGCCCTCTTTTGTATAAACTGTTTCCTTGATTTTTCCTCCAGTCTTTCCTGTCTCAA
TCCATTCTCTTCACTATTTTCAAAAATAATTTTCCTCAGAAATAAATGTGAAACTCCCTT
GCTCAAAAATCGAATGTGCCTCCTTATATCACTTTTTCATGCCCAGCTGAAATACTGCCT
CCTACCTGGACTGCCCCTACCCCCACCCCATTATTTAGCACTGACTCTAGTCATATTTTA
GAGAACATAAACTTGAAGACCGGCATTCTTAACTTTTGTTCTAGCCCGGTGCCTGCTGTA
GAGGTCCTTGATAGCAGTTGATGAATAGAACCTACCCTGGAATGAGAGCATTCCACTTTT
ATGGATGGAACATCCAGATCTCTTGGGAGGTGGCCCCAGCACATAAGGGTAAAGGTGCAA
GATGCCTTTGAAGACAATACAGTGTAGCCAAATAACATTGGATTTAAGAGTTGGAGAATC
TGTGTTTTCATCCCGGCTTTGCTATTCACTACTTGGGGCATGTAGGACAAGTCTTTTCCT
TGTTTCTATTGAGATTATATTAGGTAATTTTAAAATCCTATGGCCCTCTTGGGGTAGAAT
GAATATAGAGGATGTGAGGGAAATGGCATGCTAACCTACTCTTAGAGGGCCTACCTGCCT
CTCTTATCCTCAGGTTTTGGCAGAAAAGCGGCAACTGGGCAGCAAGGATGGACCACCTCA
TCAGGTGCTGGTGGTGTCCCTCCATGAGAGGGTTAACCTGGGTGAGGCTTTGCTGCTGCT
CCAGAACACAGACAACAAGGTTGTCCCTGTGGTGGAGCAGGCTGGGGCACCTGGCTTCAT
GGTGCTCTGTCCTCAGCTAAAGCATCGATGGTTCTTTACATCTGCAAAATCAGGTGGGTG
AAAGTTCAGGGAAGGAGGTTTAAGTTGAGCTGTCCCCTTGATGGTTATGTGCCAATTCGT
TTAGTATTTTCTGAGTGCTTAGGTTGTCTTGCTGATTCCCTGGTTGAGTTTGCCTTTTGA
ATCTAGGGGATCTCCACACCATGTTAGACCTGGCCAAAGTGGCTGATACTATCCTATTCA
TCCTGGATCCAGTGGAAGGCTGGGACAGTACAGGAGATTACTGCCTTTCTTGCCTCTTTG
CCCAAGGACTTCCTACCTATTGTAAGTGGGTTGGGCTTATTGACAAGTCTCTAGAATGGG
GGATAGGATCCTCTTTTGGGAGGCTAGTTACCCATGTAGTATTGGTTGAGGGTCTTGGTT
TATGGGATAACATCCCAAGACCCTGTCTGCCACCTTTTTGTTGGGCTCAGTGCTTCATGA
GTGAGTGGTTCATTAGTTGTAATAGATATTTATGATTCCTAACTACTAGTCTGTTTCTTT
TGTGCCCAGCTCTAGCCATCCAAGGAGTTGGGGGCCTTCCCCCAAAGAAACAAACAGAAG
CCAAGAAGAAGCTGAGCAAAGCCTTGGAGAAACGTTTTCCTGGGGACAGATTACTCCATC
TGGATACTCGGCAGGATGCTGTGCTGCTCCTGCGACAGCTGGCTAACCAGAAGCAGCGGC
ATCTGTCTTTCCGAGACCGGCGTGCCTACTTATTTGCCCATGCTGCTGACTTTGTCCCTA
GCCAAGAGAGCAGCTTGGTGGGCACCTTGAAAGTGTCAGGCTATGTTCGTGGGCAGACTC
TTGATGTAAACCGTCTCCTGCATATTGTTGGGCATGGTGATTTCCAGATCAAGCAGATTG
ATGCACCTGCAGACCCTTTTCCTCTAAATCCGAGAGTGATTAAAGCTAGGAAAGGCCTGG
ACATGGCCATGCAGGTGTGTGATATCACAGAGTGGGCTGTATCTGCAAGTCATTGCTGGT
CTCCAAGGGAGTTGGCAACACTTGTTTTTAAATTCTTTGTGTTGTTATTGTTACTGAATC
TTAGTTACAGCCAACTTTGTAGACCCATGTTGGTACATAGTTGATGCTTAACATAAATGC
TTTTATTTCATTATGTTCCAACTGAAAATAGGCTAAGGATGTATCTGTGCCATTATCCAA
GTCATGATTGAGAGATGAAATCAGATGGAGGGGTTAGGGGCATGGTCAGGTAGCAGTTGA
TCTGAAAAACAAAATCTATGAATTTTAGTAAATTGAAATTCAGTATGAATCAGGTATGTA
ATGTGGCATGTATGAAAAAAATGTAATTGTGACCCAAAAAACTAATATGATTTTGAGCAG
TAACTAAAGCCATAGTTTTCAAGATCAAGGAGGTGGTAGGCTAGCCTTCAAAGAGTTTAT
GTTGTATTAAGAGGGAAGGATATGTCAGATGAGAGGAATAATAGGGATAAAGGGAAAGTT
GCAAGGATGAATGGGGTACATTCATGTGCCAGCAAGGACATTGGCCTTACAGAAGTAGTG
GGTATGTAGTTGGAAATAGTGGAGGAGAGGCAGAGGTTGCTAAGGTAAGTGGAAAATAGA
CCAGTTTGATGGCTTAAGACCTAGAGAGCCATTGAAAGTTTGTAAGTAGGCTCCTTAGAT
TCTGTATTTTAGAAAGGCAGCATTTAAAGGAGGTCAGAGTGATAGTTACATGTAGATAGA
TTAGAGGTTAGAGTAGAGTCTTTAAATAACATCAGTTGTGTTAACCAACAGAGCTTTTCT
GCTGTTAAAGATTGGACAAATGAGGCCATGACCTCTCTCAGCAAGGTTGAATATAACTCA
GTGAGATTTGACTTATTGTGAAATGAACCCTTAGAATAATAACAACTAACATTTATGACG
TCCTTGAAGGTTTGCAAAGTGTTTTCCATATGTTATTTTATTTGGTCTTTATAACAACCT
TGGACATTGGGTGCTATTGTCTCCATTTTAAGTTTAAAAAAACTGAGACTGAAGGAGGCC
TAGGCTTATACAGAAGGACATGAGGCGTAATTCAAATTCTAGACTTGCTGATTCCCAAGC
TCAGGATTCTGCTGAGCTACCAGCTGCCCCTAAGAGAATGAATGTTAAAAACACACTAGG
TTGTCCACCTTGCTAGCACATGGTCAGTTGTGGGCTTTCAGTGTAAGGGAAAGATGGCAG
CTAGTGGAGAATGTTGGCCTCAATGGGAGTGGGTGCTGAATAGCCTGGTTCTGATATGTA
GGGTTTGGGGGCATAATGCCCACGCTGTACTCAGTAATGAAGGACCTGACTGAACAACCA
TGCTCACTTCTCTCTCAGGTGGAAGGTGTGGATGCTGATGGAGCAACTGAGATGGAGGAA
GACCTTAAAGTCTTAGTAAGAGCAGACCCTGCTCGACAGGAATCTCTCCAGTCAGAGGTG
GTTCCAGATCCTATGGAGGGGGAACAGACCTGGCCCACTGAGGAGGAGCTAAATGAGGCA
AATGGTTGGTGCCCTGCTTCGTCATTTGTTCTCCCTGGGACCCTGGGTTTCCTTTGGCAA
TTGCTCCAATGAGGGTCCTACAGGGAGGGCAGCCAGGCTTGGTGTCTAGTATACTTGGAG
GCACTTCCTGAACAATGGAGCATGGCTTTGCTCTGTGAAACAGTCAGTTTGGTTCTGGTG
GGAGCAAATGTGGGGTCAGGAGAGGGGTCTTCCCAGGTAGAAAGTAGGAGATTGTCATTT
GACTGACCACCTGCTGGTGCCAACTGAAAATGAAGCCATCTCAGCAGTGACTGAATTTTC
TTTTGAGGAGGATTTTGTTTTGTCTGTGTACACTTCCTTAGGTTAGAAGAGAGAGAGCTA
GTTTTGGGGCTGTACCTGAGGACTGAACTTATTAAGGCAGAGGGAGGCACCCCTTAGGAT
AAGTTGATTGTTTTGTTTTGTTTTTGCTTGCCCTTAACATTTTTTCCATTTTTTAAATAG
GCAAGCATTTATTTTTCTCTTTCATCTGAACCATTTCATATAAGAAAAAAACAAGGTCCT
TGTAACAAAAAGTGCATAGCCAAGCAAAACAAATCTCAACCTTGTCTCTGACTCAAATGG
ATTTGACAGATTTCTTAAAGGAAAGAACCAAGATGGTAAAGAAGGTCCCCAAAGGAACAT
CTAGTTACCAGGCTGAATGGATTGTGGATGAGGATGATGTCAGCAGCATCGATGAGGAGG
AGGAGGAGGAGGATGAAGCTGCTGAGGATTTCATGGAGGGGGAAGAGTCAGAGGTGAGCG
AGGCCAAAGCCAAGAGCAGCCTGTGGGGTTGGTGGGGCTTTTTGAGAATTCTGTTTTTGT
TATCAAGCACAAGCCTGTAGCCGGGTCCTCTTTGTTTCTCTGAACTCTGATATAGACTGG
AATTGACAAGGAAGGTAGGAGAATGGGGCTTAGGGATGGACTGGCTGGCTTAGGGTTGGT
GTCCAAGGACTAGCTAAAGGAAGAGGCTCCTATTGGTGAAGGACTGCTATCTCCATCTCT
GGAAAGACCCATGAGGATGAAAACAGATCCGTGGCATACTAGATGATAACTGGCATCCAC
AGAACCCTTTTTGCATGTGATACCAGTTCTGTGAGATAGATTAAACCGGTAGTGAGGGAT
AGGGACTTGAGGTCAGGCTTTATTAGATGAGGATGTTTCCTTGGCCAGACTTGGCCAGTA
CTTTCTCTGCCACATAGCCCCGAAACGTCAGACCATTTGCTTGGGGTCACAAAGACAGGA
TGTGTCAGGTCTTCCCTGGTGATTGTTCCCTACCGTCTCCATCCTACAGTCCTTTACCCC
CTTTTACAGATGAGGAAACCAAGGGCCAGAAAAGTTGGGTCCCTTACTCAAGGTTGAAAC
TTCCTCTTTTTCCAGACTGAGGGTAGTGAAGAAGAATGTGAGACCATGACCTTAGGAGAA
TCTGTTCGAGATGATCAGTATGATGAGAAGATTGACGAAGAGGCTGAGGAACAGATGCTG
GAGAAATATAAGCAGGAGAGACTGGATGAGATGTTTCCAGATGAAGTAGACACTCCCAGG
GATGTAGCAGCGAGGATCAGGTTAGTTGGCTCATTTTCCAGAAGCAATACATACCCTGGC
ACAACTCTGAATTACAGAGTGGCACAGTATCTAGGAAGCCAGCCTTGGAGTCAAGAAGAC
TCGAGTTCAAGTGCTGTCTGACCCTTTCTGGCTGTGTTAGCCTGGGCAATGCATCTCATC
ATAGTCCTTCATGCAGCTGTTAAGACTTCTTAGGTGCAGAGATAATATCAGATATGATAG
CTAGAGGGCATTTCCTTCTCTGGGAACTCCCCTTGCAAAGACACGACAGGTCTGGTCCTT
CTCTCTGTGCTGGCCTCCAGTATAACTAGATAGCTTTGGGAACCTCTTTTTAGTTCTGCT
CTAACCCATATCCAGATGAGAACCTCTCAGCTTTCCAGTAAGGTAGCTTACATCTGCAGG
CCCTTTTGGAATGTGTGGGTTATGAAGATGACCAAGCCTTGACTTGCCTCTTTGTACTGG
TGATTTTCCTTAGTCCTCCTGAGGCTTAACAGAACAAGCCTGATCCCTTTGTAGTGAATT
AGTGAAGTGAAAGGTGGTTGTGAACTAAAAAAAAAAAGTTGGAGAAGTTGAAACTTGAAG
GAAGTTAGGGCCTGGTTTTGTGGAAAAGGAATCCAGCGTGGGAAGATCAGAATTTAAAAC
TTCTCTCTTGCAAGAAGCAGCCTTTCCCCATCTCCCTTTACTAGGACCTTTTTGCTGAGA
TGATCTCTACCTTATCTGGTAATGCTATTTGTACAAATTGTTCGTGTGTTATCTTCTTAG
AGGCATTCTCTATGCTCCTTGAGATCTGAGGTTTGGGGTTGGGGGTAGAGATTCTTTGTA
TCCTTTGGTGTTTAACAAAACACCTGATACATTAGTGAGTGTTCAACAAATGATTTGTTT
AAGTGACTTGCCCATCATCTCTGTTGTCAGGATGAGCATTTTTGGATTTGTTTGTGAAAG
AAGCTATTTTAGTGAGGCACCCCCTTGGCCCACGCACTGTTTTGGACCTGGCCTGAATTG
GAGGGCATGTGACCAGGCCAGTTTGGTTTGGAGTTAATGAGTATAGACTTGGTTTAAGCT
CTTCCTTTGGACTCTTGGGAAGTGGTTGAGGAGTTCATTCTCCATTTGGGTTTTTATCTT
TAGGCTAAGATGGATTATGAATGAAGGTGAACTCTAGACAGGTTCCGTGAAGCCCTTCTG
ATTCATTTCTCTGAAATTTCCCTGTGTTCAGATTTCAGAAGTACAGAGGCCTCAAGAGCT
TCCGCACATCCCCATGGGATCCCAAGGAAAATTTACCCCAGGATTATGCTCGGATCTTTC
AGTTTCAGGACTTTTCCAGAACTAGGAAACGAATCTTTAAGGAGATTGAGGAAGAGGAGT
CTGAAGGGGCTGAGGTACATCTTACCTTTTCCCTAGCTCTGGTCTTGCTCTTGCCAGTGC
TTCTTTAGGAAGGAGTGGCTCTCAGGCCAGTTGAGTGCCTAGAGCACTCTAGGATGGAGG
GAGGAGGAGGAGCTCATGATGTTGGCTGAAATGTCTGAACCTGACTGAGACATCTGTGTG
ATGCATCCCCATCATGCTCTGAAGCTTCTCAAAAGGCCAGGGTGGCTTGGTGGGAGTGGC
AGGTGGAGGGTGCCCGTCTAGACTTGTTGCTGAGCTGCCATCCACTTTGGTGACCTCAGC
TCAACACTGGCCTTGCCTCTTGGGCTTTTCTTGGCAGGTTGGCTGGTACGTGACCCTGCA
TGTCTGTGGAGTTCCTGCCTCCGTGGTTGAGAGCTTTAGGCTGGGGGTACCTTTGGTCAT
GTTTTCTCTCTTACCACATGAACAGAAGGTGAGTGTCCTTAAGAGATGGAGACGGTCTGC
TATTCCCTCTGGCCAGCCTTCTACTAGGTGCCTCTGGTTCCCTTTCTAGGGCTGCAGATA
GATTTGGTAGTTAGGGTTAGAGCTAGTTAACGAAGGAGAATGGAGAAGCCAATGATGGTT
TTGCCAGAATGTCTGAACCTGTCTGAAGCATCTTAGTGATGCTACATCCATATGGCTCTG
AGGCCTCTTTCTCTCAAGTTAAAATTTTGGGTTTACATCTACTGTTGTGAGGCAGTATCA
TTTTTAAAAGGCACATGCTAGAATGTCAGACCTTCCTGTCTAGCCTGTTAGCAGCAGTAG
GGAGAATGAGGGGCATCAGCTGGGCCTCAGTGCAGAGGTTCCAGAGGCAAAAGCAGGGCG
GCGCAGGAGGGCTGGACATGTTTGGGTCCCAGAATATCTTCGAGCAGCTGTGGTTCTTAG
CACAAAAAAAAAAGCTGGTAGTGACACTAGAACCCCAATGCCACTCAAGAGTGATTGTTG
GCCCTCCCCTAGGGGGAGATGTCTTGGGAGTTGATTCCTAGGCCTTGATTTTTAAGGTGG
ACAGTAGAGAGGGAGAGCTTGTGTGTAGACTTCTCTACGCAGTTCACTGGTTCATCTCCT
GGGTTCCACAGAGTTATAGGCTTCTTTATCCTGATTGTCTTCCTTCCTGACCCTGCAGAT
GTCAGTGCTGAACATGGTGGTGAGGAGACACCCTGGCAACCAGGAGCCTGTGAAATCCAA
AGAGGAGATGATCTTCCATTGTGGCTTCCGACGCTTCCGAGCATCTCCTCTGTACTCCCA
GCACACTGCAGGTCTGCCATTGGATGACTGGCTACATGTATCCCAGGGTTGCTGGACTCG
GACCATTTCTGAGGCCTTTGTTTCAGACATACAACATAGTGTTTTAAAGTGTGCAGAATG
TATTCCAATTCTTTTCATTGGGTTGTCACCACAATCTTGGGGAAATGCCTATGACCACCA
TTGTTATTATCCTTGGACTTTAAGGCTTTGGGGTTGAGTGACTTTCTTAGGGTAAAATAG
GTTTATAAAGAGATTGGTCCAGCTCTTCTTGACCTGCTGTTCCCTAATCCCCCAGGTCAA
TGGGTCCAATTTTCTGCCATACTTGCCTCTTTCTAGTAATAGGGTCTGCAAACTTTGGAA
ATGAATTGTTTGAAATAACTTGAAAACTGAGATCCAAAGATGGGGAAATAGTTTTTGCAG
GCCTAGGAACAGAATGATCACTAATGGGGGAAAGGTCACAGAGGTGAGCTGGTCAAAGTT
AGAAAGAAAAAAAAGCCAGCCTATTGGTCCATGAGCTTCTTCATCCCCAAATCTCCAGGG
CAGGACTTGAGGCCTGTAGAACTTACTTGGGGGAGGCTACTTATACAAAACCCTGGGAAG
TACAGGCTTTTGGGGGCTGTGAATGAACCACTCCCCCCTCCTTTTTCCTAGGCCTGTGCT
GCTTTTGGAGTGTGCATGCTCACATTTTTCTAAGCCCCAGATGCAATTTAACTTTTTTTT
TTCCCTTCTGTGTTAGCGGATAAACACAAGGCTGAGCGGTTTCTTCGTCCTGATGTGGCC
TTAGTAGTCACTGTTTATGCCCCGATCACCTTCCCTCCAGCCTCAGTGCTGCTCTTCAAA
CAGAAACCTGATGGTAAGCTGGAATTTGAAGAGTAGCTGCACGGTGAGGGGAGCTCCCTT
AGACAAAGACAGAGGGTTATTAGAGGGAAAAGGCAAAGCCAGGGACAACGTGATCTCTAC
CTCGTTTCATCCTCAAGGGCTGGCCAGTGGCAGAAGCCTCCCAAGGGTCTGAACCTGTCT
AGAATGGGTACTTGGGAGGATTGATGAAAGCTCTGCAGGGAACACAGTAGGATAAAAAGC
AGAAAGCATGGGAGCCTCATTCCTTTTGTTTATCTCTGGGAATGCTGGACTGGGGGGAGA
TGGGAAGCACTGCCATTTATGGGCGGCCTTTGTTGCTGAACTCATAGTGATTCTTGAAAT
GATTTTGTTGCATCCCATCCCTGGTAGGCAAGCATAGCCTCATTGCAACAGGGTCTCTCC
TGTCAGTGGATCCAGACAGGATGGTCATCAAGAGACTTGTACTGAGTGGGCATCCTTTCA
AAATCTTAACCAAGATGGCAGTAGTCCGCTACATGTTCTTTAACAGAGGTAGGTGATGGG
GGAAGGAAGTAGAGAAGCTGGTAGCCTCTGGGTACAAAACCTTGATTTGTTGGGGCTTTT
AGTGGGGAGAGTTGTCATGGAGACCCAAGTGGATGCCTGGGGTGAGGCTTTCTATCCTAG
GGTTCTGGCTCTTCTCTCAGGGATACTCTAGTCCCCTTCTAGCGTTAGAGGTTCCCGATT
GAATGTCTGAGGTGACTAGTGCTCACTTGGTGGCCCTAGCTTATGCTCATGGAGTTAGAT
CACTTTGGTCTCCTGTGCCTTCTCACCCAAATGGACCTCCTTGTTTTGCCTCTAGTTTCC
TTCAAAGCTAGGAAGAAGCACTCCTTTTTCTGCTTCCCCCCACCTGTCCCGGGGCCCTTA
TATACTGTATAGTTGTGTACCTGGCACATAAGAGATGATGCTTACTAAATACTTCTTCAT
TGATTGACTTTTTTAATGTCAGAGGATGTGCTGTGGTTTAAACCAGTGGAATTGAGGACA
AAGTGGGGCCGCAGAGGACACATCAAGGAGCCATTAGGTAAGAAAGTTTTGTCTTCAGAT
TGACCCAGAGAGCTGGGAGGGAACGTGTGCTGTTGGGATGGGCTAGGTTTAACACGTCTG
CTCCTCTGGCAGGCATGTCCATGCTCTGCTGCTTGGGTAAGCTAGTAGGCCTGAGGAGCC
AGGGCTGGAAGGGACCTCGGGAGTCCTGGAGGCCTGCCTCGCCTTGATTTTTACATAAGG
AGACAGAGGTAGAGCTGAAGTGACTTGTCCAGGACTGCAGTTTGCAGATGCCCGTCTCCT
TGAGTTTGCTCTCTTCTCTCTAGGCACTCATGGCCATATGAAGTGCACATTTGATGGACA
GCTGAAATCTCAGGACACCGTGCTGATGAATCTGTACAAACGTGTCTTCCCTAAGTGGAC
TTATGATCCCTATGTGCCAGAGCCCATGCCCTGGTCAAAAGAGGAAACTTCCCCCGGGCC
AGAGGTGGACATGCAATGACAAGGGGTGTGAGCAAGCCTTAGGAACAGGTGTGAGCTGTG
GAGGGGCCTCTGGGCCATCGGGGGGGCGGATGCCAAGTCTTGCCTTGGCCAAGTGCCCGG
GCTGAGACAGTTGTGTCATTTTGCTGCCACACTGGCATTAAGCAGATCTCTACAAGGAAA
GAGATTGGGAGGGCGAAAGCGTGGGCTGGGCCAGGGCTTAGTAAAGGCATCTCTTAACAG
CTCAGAGGACGGTGAGCCCCCTCACACTCTGATCCCTTCAGCCAGCTCAGAGCCCGCAGG
TCCACATTCCCCCCACTGAGCACAACACAGATGTCTCGTGCAGCGGGCACCACCTCCTGG
AACTGCCGGCCCAGCACCGCCGCCACTCCCACCGCGGCCGTGGGCTCGATGAGAAGTTTC
ATTCTCTCCCACACCAGCTGGGTGGCATGCTGTGGGCCAAGAAGAGAAAAGCCAGCGTTG
AGCAGGGGAGCTGGCACAGGTGCTGCACGGCTAGCGTGTTTCTGTGCTTGCTTCTTGTGT
GCTCTCCCTGCTGCGAGCCAGACACTAACCATCTCGGCCCACTTAGGAACATGGCCCCCT
CCTTGTCCACACCCTAGTTTTTACAGAGGGAAGGAAGTGACTCACTCAAGATCAAGAGCC
GTGCCTCTGCCAAGCCTTAGCCTCCCTCTCCCTCTCCTCCCACTTTCTCACCTTAATTTC
ATCCTCGGTAACAGTGAAGACTTCATCCACCAGATCCCTTATGATAGGCCACGTGTGGGT
GCCAATGCTCGATTTGACCCCATCTGCTATAGTGTCTGGCGGGGAAGGGTTAGGGGTTAG
TTCCCCTTTAAGCTTGGATTGGAAGCAGTCATCTGCATTGGAGGGCTCTGCAGCATACAC
TTTCACCTCTGGTCTCAGAGCCTGCCAGGAGAGCACGAGACGTTCGATACCAGGCATGGC
ACCAGGACAGAGCCAGCCTTTGTCCCCGTTTGTGCTGAGCTACCTCTAAAGGGCTCTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1097, 1294..1397, 2713..2932, 3066..3200, 3429..3857, 5245..5403, 6009..6097, 6385..6449, 6654..6677, 6806..6979, 8191..8353, 8677..8787, 9478..9610, 10336..10452, 10827..10967, 11422..11496, 11783..11958
1001..1097, 1294..1397, 2713..2932, 3066..3200, 3429..3857, 5245..5403, 6009..6097, 6385..6449, 6654..6677, 6806..6979, 8191..8353, 8677..8787, 9478..9610, 10336..10452, 10827..10967, 11422..11496, 11783..11955
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved