Monodelphis_domestica Locus ENSMODG00000019297
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica ENSMODG00000019297
Monodelphis_domestica
ENSMODG00000019297
2
SNORD42, SNORD42
2586..2652, 4342..4410
5570
TTCCTTCCTCCCTCCCTCCCTCCCTTCCTCCCTTCCTTCCTCCCTTCTTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGTCGGCAATGTACAACCTGGGTGACCTTGG
GCAAATCACTTTGAGTGTGATCCTCAGCGGTAACGGTGTGGACATTTGACTAGATGACTT
GTGAGGTTGTCAGAACTGATTTTGACTGGCTCAAACCTGGCTCAAGGTACAAACTTAAAT
AAATGCTTGTTGACTGATTCTGTAGTGCAGTGTAACAAAAAGAAAAACAGTCGCAAAGAT
CCAGGCTCAAATCCCTCCCTTTTCCACCTCATATAGGCACATTCTGCCCACAGCGCCTGG
ATAAAGCAAAACAGCTCAGAACTGAGCTCTCAAAACAGCACCTAGCCACCAAATAACCAC
GTGTCAGCAATAAACTACGTTTCCCATGAAACCTCGGGATCTTGGGAGCATGCTCAATTC
GGCGCTCTTCCTTCCGAGATCGGTATGGAACGCGAACTACTAATCCCGACAGGCGCTGCA
TCGGGTTTCCCGATACCACCATAATCCTCCTCCCCTTAGACTCGGCGTTTTTCCCACAGT
CCTTTTTGGAAGCCTTGAATACTCGCGAGACTTGAGCGAGAGTTGGCTCTATAAGCCTGT
GAGAAGGTTCGCGGAAGACCCTTTCCTCCTTTTCCTCTAAGATGGCGCCGAAGCCCAAGA
AGGAAGGTAGGTGAGGAGTCCGGGCCCGGGGGGGTAGGCTGGGCTCAAGGCGGCAGTGGT
GGACCGGCGGGTCTAGTAGGAACCAGAGAAGCCCAGACTTGGTGCTCCTCGGTCTGCTGC
CATCGCCGAGGCCGATCCTGGAGCAGCCCCTGGGGCGGACCACGTGTGTTCGGCCAGGCC
CGGCGTCCGGGGACCTGAGGCCGGGGCCACTTGGGGAGGCTCTTTTCCCCTAGCCCGGAC
TCTCCCATTCACCTTTCGCTCCGGCCAAGCCAGGGCTCCTTGTAGGGCTTTCGTTTACGC
TTCTGTGAAATGGCGATGTGGGGGCGAGAGTACCTTCTCGCGTTGTCTTCTCCCCGTGTG
GATTCCAGCCCGTCCTTGCGGGATAGTGCCTGCAGAGCTCGGTAGGATGCTAGGCTCCGG
GCTCGGCTTCCGGCTCTGCAGCGGTTTGGGCCAAGACTCAGTCCCGGAGAATCGTGTCTG
ATAACTGGGATCTGATCAAGCCGACCATTGGAGAGTCCCGGCCTGTCCTTGGCCTTTCTG
CATCCCAGGCGCCTTGCACAGTCCCTGGCACATGCTGGTTATCAGTCGTGCCCGACCCAC
CGTGACCCCATGAGAGATTTTCTTGTTCCAGATACTGGAACCGCTTACATTTTTCCGTTT
TACAGACAAGAAAACCGAGGCAAATGGCGATGTGGCTTGACCAGGCTCACACTGAGGCCA
GATTTGAACTTAGGGACCTCATCCCCAGGCCTTACTATGTATCTCCTGATTTTCCCATCT
GCCCCTGCATATACTTTTAAGTTTAATCTGCATTATTAGCCTTTCCTTAACTTTTTTTTA
AACAGTATTTCCTTAGAATCAATACTATGTATTGCTCTCTTGGTGTCATCTGGCTCTCCC
TCCCCTATTAGATCCTTAATCAATATTTACTAACTGGCTATTTATGACCCTGTGGATCCT
TTCAAAGAATGAGGTTTTTAAATGAACAAAACAAAACCCACAAGACCACAAAGGAAGCTA
ATTTTTCTTTCTAAAGGAAACAAGACTGGTTTAGAAATTAGAAAATGGACTTTTTGGGAT
GGAGAACAAGTTTGATTCCAATTTTTAAAATCTCCAATTCTTGGGGGTAGCTGGGTTGCT
CAGTGGATTGAGAGCCAGGCCTAGAGATGGGAGGTCCTGGGTTCAAAAGTCATGTGTTCC
TCTGCTTTAGCAGCCCAATGGGAGTGCACAGGGGGTAAGGTGGGTGGCAGAACTGGAGGA
GGGAGCACTCAGGTCCCTCCTCTCCCCCTCTCTACACTTGCTGAAGACAGACCTCATTTT
ACATGCGCCGCCCCCCCCCCCCCCCCCCCCCCAGAAGTCCCTTGAGGCGGGGGGGGGGGG
GGGGGGCTCCCTTTTTTAAAATTTTGCCTCCCTGAACCAATTAATCCTTTAAGGGCTCCC
CTTCCTTGGAACCAATACACAGTATTGATTCTAAAATGGAAGATAAGGGTTTTTAAAAAT
AATAAAATGAATCTATAAATCTTCTCCAAACCTGGAGGATCTCACCCTAAAGAACTATTT
AGCCTCATGCCAATGATGGAAACATGTATTTTCCTGAGAATACTGATGTTGTCAAAGGAA
CCACTGATGGCATTGGGGTGGTTAGGAGCAGCCCCTTGTTGGCCTGGAGAATCTTGTAGA
TTGATTCCCTTTTCCTTCTCTATCCCCAAGCGGTTGTCCCCCCCAAGACAGAGGCCAAGG
CCTTGAAAGCCAAGAAGGCAGTGTTGAAGGGTGTCCATAGCCACAAAAAGAAGAAGATCC
GAACGTCTCCTACCTTCAGGCGACCCAAGACGCTGAGACTTCGAAGGCAGCCCAAATACC
CTCGGAAAAGTGCTCCTCGGAGAAACAAGTAGGATCTTATAACTGTAGACTTATGGGAGG
CCTTTGGGAAGGTGGCAGAAGTGGTAACTACTAGGCCAAAAGTATAATTTGTAGGGATGG
GCTGTAAACACCACTGCCTGCTTTCCACCAGCACTCATTCATTTGGGTTTTGGTCACTAC
TACCAATGAGGCATTGGGAGTGGAGAGAGCATGCTAGACACTTCAAGTCTTCGTTTGCCT
TTCTCTTTGGTAAAACTAGGGTGGGAGGAGGTTAAAGGATATTCTAGATTTCCACTAATA
GTTTGGAGATGTGATGTGGACTCAGTGGAAATGGAAGCATGTGGAGCCAGCAGCCTCACT
GCTGTGTGAGCCCATAGGAGCCAGTCTTTCAGGGAGTGTTTGCAGAATAGAGTCTGGGAG
TACATGGACCAGTTGCCTTCATTTTTTTGAGTTGAGGAAGTTCCTAGTAATAGTATGTGT
CATGATAATCAAAAAGCTTAGTGGCATATTCCTACTCCCCCAGTATCAGGAAGCTTGAAG
TGCCTACTCAGATTCTGTTAGATTCTAATTCCACTCTTAGATGTTTCTGAGGGGGTCTCC
CCACTCACCCCCAAGCACTTTCTACCTCCAAATTTCTCCTTTGATCACATAAGAAAGTAA
ATTCTCTCTGCAAATTGTAGGATCATGCCAGTTTGGGAAATGTTTTTGTCTTTGTGGTAC
CTTCTCGGGATAAGTGCTAGCATCAGGGTGCAGATGATGATATCTATAGCGACCAAAGTC
TGAGTAAAATGATAGGCAACTTCAGTGTCTGATGCACCCTGCTCTGCCCTAGGATTCTCC
TTAGACCCCCTGACAGTAAGAAGGAACAGGCTGCCTCAGTTGGTACTGTGGGGCTTTTTA
AGTTTGCATCAGTTGATTAAAAGCATCCCTGTTCCTTCTAGAGTTAGAGGCCTTAGAACT
TCCATGTCCCTCCTCTTTCTTTCCCCAGGCTTGATCACTATGCCATCATTAAGTTTCCCT
TGACCACTGAGTCTGCTATGAAGAAGATTGAGGACAACAACACTCTTGTCTTCATTGTGG
ACGTCAAGGCCAATAAGCATCAGATCAAGCAGGCAGTAAAGAAGCTCTATGACATTGATG
TGGCCAAGGTCAACACACTGATCCGGTGAGGATGAACTCCCAGACAGAGGGGGCAAAATC
TGCTCTTAAAACCCATTTGGGGTTCAGGCAACACAGCAATTTGGGTGGCAGAGGGAAATG
GGTGGGTGCTGAAACTTAGCCATCCATCTCAGTTATGTTGAGGTTGAGAGATTTTGGCAG
GGAAATGCATCCTGCAATCTAATCCATAAATAGTATGCTTTCTCTTTGCTGGCTAGTGAA
ATTTTACTGCCATTTTAACTCTGGTCTTCCTGACTGCAGACAGAGCTCTTATCCAACTAA
GAGGTTATTGTTTCCAGGATTCATGCAAATAATGGAAAAATATCATTTTACCGGAAAAAA
AATGATGCTAACAAAGGAACCACTGATGCATGAGGCAGGCATAAAAGGGGATAGGAGCCT
CAGGGAGAGGTGCTGCAGTTAGGTACTAAGGTCACTTTTTCTATCCTAGGCCTGACGGAG
AGAAGAAGGCCTATGTCCGACTTGCTCCTGACTATGACGCATTGGACGTTGCCAACAAAG
TGAGTATATGGAAGGTAGCCTCCCTCTCTGAACTGCTTCCCTCCCTGGGTGCAGGTGATG
AGTCAGAGTGACCAAAGCCTGAGCCTCAGTGATTACTCTGCATTGGCTGATGCACCCCAT
CCAAAATGAGCAATGGGCAGCCCAGTGGAACATCCCGGGACCCAGTTATCCACCCCTACC
CCCATTGTGTCACAGGTGTTGGGGGCTTCTTCCCTATGTAAGAGCTTCAAGGTGCTGCTG
CCCAGCTAGGGAGGTTTGGCGTCCCCTACGTGCTCTTGGTAACACTTCTGGCTTTTTTCT
TTTCAGATTGGAATCATCTAAACTATCCAGCTATCCTGCTCCACCTTCAATAAAACATTT
CCAGTATTCAAGTGCTTGGCTTTTCTCCTTAAGGATTGGGGCCCCAAGCAAGGATGGGAA
TAGAGGTTAATGGCGATTCAGCTTGCCTGTCCATGGCTGGTGACTCACCTACACCATGAA
GGGTTTACATGGGGAAATAAAGCCTCACTGCTCTGCCTTGTGGCCTGGAAGCTGGCTGCT
ATCCCCCAGGGCTGAGGCCATTGTCCTCGGGTTGTTTAAACAGTACCTTCTCACTGCCTG
ACTACTGCTTATTCCTGTAAGGGGAGCCATTGGGGGAAGGGAAAGCCACCCCCTCTAGTC
CAGGGGAAGGAGGGAGAGGGAGCTAGCAATTAGAGAGGGATTGATGGGAGAGAACTGCTA
CTGGCTTCAGGCTTTGACCTCCCCTGGCCCTAGAGAAAGCTCCGGTTCCAGGTTGGTGCT
CTGCCCATTTCTAGAAATGTGGTTGGCCCATTTGTGCCTAACTCCTGGTAGGGCCTTCTA
AGTTCACAATCTGAGCTGCCCCTATGATTGGCACAGCATAGTTAACCTGAAGTCAAGAAG
TGCGAATCCTGCCACCGACCCACATTCACCCCCATGTGTGACTGGACCAGTATCTTCAAG
AGGAGCAGAACATGGTCAAGCTATGAGATGTGAGAGGAAGTCTGGCAGGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 2730..2907, 3868..4044, 4489..4570
1001..1025, 2730..2907, 3868..4044, 4489..4570
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved