Monodelphis_domestica Locus TCPA_MONDO
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica TCPA_MONDO
Monodelphis_domestica
TCPA_MONDO
2
SNORA29
5937..6074
14112
TTGCAAGCTGTAACTCTGGTAACTATTGCACAATTACATTGCAAGATACTCTTCAGGTT
CCTTCAAAGGCAGAGCTCTAGCAATTGTTGAGAAGTCTTATAAAGTTTTCCTGTGGAGGG
GCTGAGTCTTAAGGGAAGCCAAGACCTAAAGAGAGCCAATGAAAATGCAGGGAGATAATG
ATGTGGAAGAGGAGGCCTATGGGCAGGAAGGGAAATCAAGTGTCCTAAGGCTGGAGGGTC
AGGAAAGGGTCCATAAAGTACCACCTTTTTCTGCCTAACCCCCCAGGGTTTGGGAGCAGC
CAAACCACGATTTTGGACCTACTGAAGAGTTGAACCTAACTCCTCCAAATCCAGTGGTCT
TTCCACAGCACCAAGGACTGGAATATTATTAATTTAGGAAATGGAGGGAAAGCTTTTCAG
CGCCCCACGGCTCCTAAATTCTAAAAAAAAAGGCGAAGCCTCTTCATTTTGGCACCATGC
GGTTGCAGGATGCATACTCAGTGCACATACAAAAATAGACTTACTAGTTGCCCTCCGGTT
GTTTTTATATAGGACAGGAATGTACTCTTATAAGCCTAAATTTGAAAATGCTTTTAATTC
CCACCAAAATACAAAACCCGACTTGGGTTGGCCTCATCACTAACCCTTAGTTTATGTGCC
ACACCCAGCAACCGCTTTCTAGAAACTATTAGAATTTCCTAGCCCGCATGCGCACTGCGG
TCCCAACCCAACTGCTTTTCCTTCTTCCGCTTAGCATTAAACGCCAATTCCTCCCTTCCC
CGGGCCCTTTCCCTCTCATCCTTTTTCTGATTGGACCTGAAGCTCATTACGCTAATCTCC
GGCTTTCTCCGCCCTCTCTCTCCTCTCCGAGTCAATTTCCTGGTGCTGAGATAGCTCTGA
GGCTTCCTTTCCCCGCTCCCCTCTCCCTCGGCTAGAGAAAGGAGGGGGCGGGGAAAAAAG
GGTTACCCAGCAGCCTCTCCGGCGCCATTCCTTCCCTGTTCTCTGGCCCCACGCTGCTGT
GTCTTCGGCTCCTCTCGGTCTTGTGTGGCCGGCAAAGAAGATGGAGGGGCCCTTATCCGT
GTTCGGAGAACGGACCACTGGGGAGTCGATCCGCTCCCAGAACGGTGAGGCCGAGCTGGG
CGGGCGGCGGCAGAGGAGGCCTGTTTTAGGGGGCCGCGCTCCCTGGCGCTGCCCGAGGCC
GTGGTGGGGCCTAGCCTGCGGCGCCAGACGAACCCCACCCCCTCATAGTCCCGGCCGCGG
TCCCGCAGCGTGGGGTCGGAGGAAGGAAGGGAGCGAGACCCATTCTTAAGGAAAAGCTTC
TAGGGTCGGGGTAGGGCAGGGCGGGAAGCCTGGGAGCCGCCAATGGCCACGTTTTCTTGG
AGAGGCCTTGGGAGATATGTTCGCGGCCTGTGGAGCGCGCACGTTTTTACCGAATTAGGC
CTGTTCTAAAACTTAGCAAGTTTTGATTGGTTGTAGCTGGGGTGCAAAGTGCACCTCTAA
CGATTCTTTTTTTTTGAGGGGAAGGGATTGGCACATGTCCGACCTCATCCCCTCGACTTT
CACTAGCCAGCTTCTTGTGTCTGATTCCCCGCTATTGGGATTAGAGCATGGCTGGAATCA
TAAGGGATCAGATCCATATCAGCCAGTTCTTAAAGTATGGACCCAGGTGTCTTGTTCCCC
AGGTCATTGTTTATTTCATAGTTACTCTTAACAAAAAGAATGCAACCGCTGTTAAAACTG
CGGGTAGCTTTTCGGATTCCTAGCCATTAGAAGGCGACAGCGCCTGGGAGAGCCTATCTC
TTACTCCTCTTCCCCCCTCATTTCTAGCTTCTTGTGCCTTACTCAAGTGAGGAGACCCCT
GGGTCAAAGCATGGCTAGAATTTTAACTCTGCAAAGGATCTTAGAAATTCCTTTATGCAA
AGCCCTCATTTGAAAAAATTAAATACTCGAATGAGGTCTGTATATTGCCAGTTAATTGTT
ATGTTAGTGACTGTGGACTAGGGTGCCTTATTTCTCCAGTCCAGGCTGCTCTTCCCCCAT
TTCTCTTAATTTTTTTTAAACCCTTACCTTCCATCTTAGAATCAATACTGTGTATTTGTT
CCAAGGCAGAATAGTGATAAGGGCTAGGCAGTGGGGGTTAAGAGACTTACCCAGGGTCAC
ACAGCTAGGAAGTGTCTAAGGCCAAATTTAAACCCAGGAACTCCCATCTCTGAGCCTGGC
TCAATCCACACCACCTAGCTGTCCCGCCTTCCTCCCTCCCTTCTCTTAATTTTACAAACT
TTTTATTAAAATGCCAAAGTTAAATTGAATGATAGCTTTTCTGACTTTCAAGAAATATGG
AGGGGAAAGTTGGTTTTAATTCATTGTATTGATAAAGCATTTACATTACTCTTTCAATAT
TCCATATTAGCCAGATTTGCTTCATGAAATAATCTGAGGATGAATTGGGATTGATAATGT
AAGAGAACAAGTGATTTTTTTTTTTAACCCTTACCTTCCGTCTTGGAGTCAATACTGTGT
ATTGGCTCCAAGGCAGAAGAGTGGTAAGGGCTAGGCAATGGGGGTTAAGTGACTTGCCCA
AGGTCACACAGCTAGGAAGTGGCTGAGGCCAGATTTGAACCTAGGACCTCCCGTCTCTAG
GACTGGCTCTTAATCCACTGAGCTACCCAGCTGCCCCTGGAACAAGTGATTTTTAAAAAT
GCCTCCCTTTTCTTGGGAGGAGAGGGACTATCAGAGCAGTTGTATACACTATCACTCATA
CTGTAGGTTTTTTGTATTTGTTTTTCTTGGGTTCAATTTGGAATGGTGGAAGAGTATATA
TTCAAACATTTAGTATAAAATGAAAAAAATGTCAATGAAACTTTGAAAAAGAATCTTTTT
CAAGATTGAGGATTTGTTAATGATGTAGGGAAGACATTTCCAAATTCTGAAGTACAAAGC
TCATTGTTCCTTTTTTCTATATGAAATTATAAACTTAATTAAGAAATATTAGCTAAAGCA
TCTTCAAATAGCAAATATATTTTTATTGAGTCATTGAATAAACTTCCTTTTCAGAGAATA
GATTTAAGGTCTGCTTGGTTAAGTTTTATTTATGGGTCTACATTTTAACAAATGTTTGAA
ATTATTGTATTTTTTAGGAAGTGTGGTTTATACAGTGACCGATTAAAAAGTGCAATAGAA
ATGTAAGATGAAATTATCTTAGTGAAACAGTGAAAGCCTACCTGAAAAACTACAGGTTGG
AAGGCAGAAAGGAACAAACGTTTATGAAGTAATCTATATGGGCCAGTCACTGTGCTAAGA
ACTTTAAAAATTTCTTGTTTGGTCCTTATAGCAATTCTAGGGCATGGGTACCATTTATCT
CCATTCTACAATTACAGTTTACAGGCCAACTTGTTCAGGGTTACAAAGCTAGACTGAAGG
TCTGAGATTGAATTTGAACTCGAAGGTTTCTTAATCCCAGGCTCAGTATTCTATATACAG
TATAATAACCTAAAGCGACTTCCAGAAAAAAACAATTGCATCTTACTTAATCCATGCTAT
ACATGGGAGCCTTTGTCTGAGATTATTAAATTTTTTATTCTTTCTCATGGATATTCTGTT
CTTTAGAAATAACTTTTAACCTATGCAGTGGTCTTTGTGAGGGCCTGCTGATGTAAGATA
CTGGCCTAAGATAGCATTTGAAATAATGAAGATGCCTCGTTTCATCCTCTAATTTTTCTA
TTTTTACAGTTATGGCTGCAGCTTCCATTGCCAATATTGTAAAAAGTTCTCTTGGCCCAG
TTGGCTTGGATAAAATGTTGGTGGATGATATTGGTGTAAGTACACAGATGTGGCTTTTTT
TTTTTTTACCTAAGAGTTTTAAAGATAAGGTATTTTGTGTAGTGGTTTGATATGTAAATG
CTTTGCTTCTCTTTTTATTGTTGAACTGCATAATATACTTATAGTAAGTACCTCTAGGTT
TTTTATTGTTCTCTAATGGAAATGTAAAATACTAATTTTTAATAAATGCTTATTACTTTT
TTAAACAGGATGTGACTATTACTAATGATGGGGCAACCATTCTGAAATTGCTAGAGGTAG
AACACCCTGCAGCTAAAGTGCTCTGTGAGTTAGCTGATCTTCAAGACAAAGAAGTTGGAG
ATGGAACCACATCTGTGGTGGGTAGACATGTTAGAAATATGTTGGACTTGACCAAAAATT
TTGACAGGCAAATTGAAAGGATACATCATCTTAATGGTCTTCAAGCTAAAAAATTGGGAG
TAGAGAAAAGTTTAATAACATGTTTTGGTTTGCATTTCTTTAGTAATAATTTGGAGGCCA
CCCACCTTCTCTATATCTATTTATGGCTTTGATTTCTTCATCTGAAAATTATTCGTGTCT
TTTGCCCATTTGTCAATTGGGTGATGTCTTTTATTTTTATAAATTTGACAAAAATTCTCT
ATATTTTAGATGAGACCTTTATCTAGACTGTCTATAAAAATTTTTTCCCAATTTTCAGCT
TTGTTTCTAATCTTGACCATGTTTATTTTATTTGTTCAAAAACTTTTCAACTTAAAGTAA
TCAAAATTATCCATTTTACATTTCACAATGCTCCCCATCTCTTGTTGACTCGTATTCCTT
GCCTGTCCATAAATATGATAGGTAGTATGTTCCCAGTTCTTCTAATTTGCTTCTGGTGTC
CCCTTTTATTTCTAGATCATATATATGTTTTGATTTTATCTTCATAAATGGTATAAGATA
CTGGTATATACCTGGGTTATGCTAAACTAGTTTCCAATTACCTTATCAACTTATCCCCAA
ATCCTAGATCTATGGTTTTATCAAATACCAGATTTCTATAGGCTTATTGCTCTTTTTTGT
ATGTCTCTTCTGTTCCACTGATCTACCTTTCTGTTCTTATCCAATACCAGATATTTTAAT
AATTTAGAGTACAATTTAAAATCTGGTACTGCTAGACCTCCTTCCTTTACCTTTTTTTAA
AATTAATTCCTTCAATATTCTTCCAACTGAATTTTGTGATTTTTTTTCCTAACTCAATAA
TTTTTTGGTAATTTAATTGGAATGGCATTGAATTAAGTAGATTAGGTAGGATTGTCATTT
TAATTATATTGGTTCTGCCCATCCATGAACAATTAATGTTTCTCCTTTTATTTAGATCTG
TCTTTTATTCATGTAAATAGTGTTTTTAAAATTATGTTTATGTAGTTCCTGGATTTGTTT
TCTAGATATTTTATTATTTTATTACCTCTTTACCCATTCAAATTCTTTTTTCTTTTATTA
CTATTGTTAGCATTTCTAATACTATTTTAAATAATATTGGTGATAATGGGTATCCTTATT
GCCTGGTGACCAGTCTTAAACAAAAGTTTGTCATCCCTAAAGTGTGAAAAGAAAGCAAAG
CCTAAAAAAAAAAGAAAACTTTTCAGGTTTGTGGAACATTTTACCCCTTTTTCCTAGGAA
ACTTAGCAGTCATCTCTTCTACTTTGTATAGGTACTGAATGTTGGTGTTAAAAGATGTGC
TAGCTATGAACATTTTTTTCCCCAACAGGTTATTATTGCAGCAGAACTTCTGAAAAATGC
AGATGAATTAGTCAAGCAGAAAATTCACCCCACATCGATTATTGGTGGCTATCGACTAGC
TTGCAAGTACGATACATTCATGTTCATTGAAATATCTAATGTTAAATCACTTAATCTTTA
AGCTTCAGTTTCCTTGTCTATAAGACTGAAATGATAATCCTTATACTTTGTAGTACTTTT
GACCCTTTCAGAGCCTGATTGTGATGAAAGTACAACACACAGGAGCTGGAAGGGCCTAAT
ATTTTCATTGAAACCTTGAATTATCAGTTCTCTAGTTGATTTCACTTTGGATAGAATGAA
AAGGTTATGTTCGCAGTTGCCACATTTGAGCAACTCAAAAGGAGACCAGATCATTTTCTT
CCCATTTGACTACCACTTTTTCACTTAATAGATTTAGTGGCTATGCTTATGGGATAAAAT
ATAGCTGCCATGGTCTGATGGAGAAAAAGTGTCTGGGTCTTTTTTTCCTATATGAAATGG
CAGAACAATCTAGCTAAGTTGTATATTATATTTGCTATTAAAATGATGGTTTGGCTTAAC
CCACAACTACTTTAATATCATTGTCAATTGTGGTAAGCATTGATTTCTATATTTAAAAAA
TGTTTTAAACAGGGAAGCAGTACGCTATATCAATGAAAACCTGATCATTAACACAGATGA
ACTTGGAAAAGATTGTCTCATCAATGCTGCAAAAACATCCATGTCTTCTAAGATCATTGG
AATGTATCCTTTTGTAATCTTGATTGTAGCTATAGCTATGTATTTAAATTAATTGTCATT
GTGGTATGTTAATTCTAATGCTTTGGTCCTAAAATCATGTTTGGATATATAAGTTCAGTA
TATAATTTCCATGGAAGAAAAATCTGTCATTGAAATGAGATCATGCTTAGAGTAAGAAAG
TTTCCTACCACTTAAGGTTTCTTAAGAAATTGGTAGGGAATGATTGATTCTATCTTCTGT
CAGTGTGATATTTGTTATTTGAAATGAAAGGATTCTTATAGCAAGTGTCCCTATAATAAT
AGTGGTTTGCATTTTTAGAAAAGAAAATCTGCAGGAAAGTGGAATTATTTGTTGGTAGTT
TTCCTAGGTTAAGAAATCTAGGAATTTTTTTTACTGTCCTTTTGAGGCAAATACGAAGGC
CCAGTTGAAAATACATAAGGTATTTTAGAAAGGCATAGAGATTAGTTGTAGGATTATATT
GCCATGCATTGAAACAAAGAAGACTCCAGAGTAAATAAGAAATGCAATTTTTAAGATTAG
AGAACCTACATTGTTCTTTATTGTGCAGTTATAGATGCATGTGTTGCTTTTGTCATTGGT
ACCCAAATAGGATTTTGCCCACCACCAAATTTGTGGGTACTGGTTGGAATGAGGAAGAAT
GTAAGGAAAAGAATAGTGGACAAGTTTAATTTGATTAAAAGATGTTTCCAAGGGGGGAAC
TAGAAATGTGCTAATTGCTTGTGAAATGAGTATAATTATACTTTAAAGATGTATTATGAG
CATCGTTTTTGCCACCAATTGTCACTCTTAAGGTTGTTACAAGTGGAAGATACATGGAAA
ATGCTGTTTCATTTCCTTATGGGTTGCTGCTTATGTTGGAAAGCTAAATAAGATACTTTT
TAAGGGAAGATTCCATTGCAATTCTTTGTCCTTAACACTGTTGGCTTAGTGATGGGGACT
TCTTTGCCAATATGGTGGTAGATGCAGTACTTGCAGTTAAATATACAGATGTGAAAGGTC
AGCCTCGGTATCCGGTTAATTCTATTAATGTTTTGAAGGCCCATGGGCGAAGTCAGAAGG
AGAGTATGCTTATAAATGGTTACGCACTGAATTGTGTGGTGGCATCACAGGGTAAGTAAA
CTTCAAGGAGTTTGATCTCTTAACTCTTCTCACTTTTCTGCTTCATTTATGGGTACCACC
ACTAACCACCCAAGTTTGCCATCTGAGTGTTGTTCCTGCTTCTTGTGCAATGTCACTTAC
CCATCCCTCTCCATTCCCACCACTACCACCTGAGTTCAGGTGCCATCATCTCTAATAATT
CACATTTGTTCTGTTTCTCTGTTCAAGAAAGTGGCCTTCTAGCAACTAAAAAAAAGATGC
TGGCTTTTAGAGCTTCTTGAAGTCTAGCTTTAGCCCAGCCATTCTGCTTGCTTTTGGTTG
TGCATCACCTTATATTTTCTGTACTCCATTACTACTGTCTTCTATACTTAAGCTAACCTA
ATCTTCTTTCTCCCAGAACTCCATACCTATTTTGTAATTTGTATATATGTTTTGTTTTTA
CATATCTATATGTCATGTTTTGCTTTACTTCAGGAAAATGAAAAATTAAGGCGGGGGGGG
GGGCACAGCTAATTGTTGGTTTTGGAGCTCCCACTGCCTGACCCCTAATAATTGCTATAT
TTGGGTGTTGAATGAATGATCTCAAACTATTTTTAATAGACTGAACAGTAATACACATCA
TGGCAGATATTTGATTCATCTCACTATTTGCATTTATTCATAAATAAATACTTTTACTCC
TTAAAATGTGTAGGGAAAATAACAAACATGATGGTTGTTTTTAGTGTACATTCCAATGTC
TGGTCACCCTTGAATCAGCTATTTTCTCTTTTGTTTTATAATTTAAGCTAATGTGTCAGT
CTTGATAGTTGCATTTATATTTTGGAAATGGAGGTTGGGAGAATTTAATTCCAAAAAGTG
GCTTCTAACAATAAAGACCTTTAATAAAACTGGATATCCCCTACCCCCTCGGAAATTGTA
CTTTTAAAATTGGAGTTTAAGGGTAATAAGTGATAGTTTAGAGTTAGTGTTATAAATCTC
ATTTGGGGGGAAAATCTGATTTTTCTATTTGGTTTTTATAGGCATGCCCAAAAGAATAGT
TAATGCAAAAATTGCTTGCCTGGACTTTAGCCTACAGAAAACAAAAATGAAGCTCGGTGT
GCAGGTGGTTATTACAGACCCAGAAAAACTGGATCAAATTAGAAAGAGGTAGGTTGGCGG
ATTTTTCTTTTTCTTCTTCCCCACCTCCTTTCCACGTCTAGGACTGGATGCAAATAATTG
CTTTTTTTCTCCAGGCTGAACAGTCAATTAGAATTGTTTCCTAAACTGAGTATTGGTTTT
TATACAAACTAACTTAGAATATGCTTCAGGGACTTGAGCATCTTAAAATTTACCAAAATA
GCTTATTTTACATAATTGCTTGAGAATTTAGAATACATATTAGAATATCCAAAAGATTTA
TCTGTACTTTTTTTATGTTAGATATTTCTCAGAATGATTGGACCATTAGGAGGTTGAAGT
GGTTGTATAGCATGTTTAAACTGTTACCATGGTTGTTACTTAATATGTAATTAATTTTTC
ATTAGATTTTGTTGTGCTACAAGTATATTGTTGTAGTCAATAGTTCTATTCCCATTCATA
GAAGCTACACAAAAGCAAGAAGGGAATGTATAACAAATCAGTGAGTCTGTGGGGTAGTAA
CTGCCAGCTCTATCCTAAAGGAACAGAAACTCTGCTTACTTATTTCCTGCTACCACAAGT
GCTACTTGTCTAGGAACCACCAGCAGCTCCTATATAATGAACCTGGTGGTGACCTGAGAA
GGAGATTGGAGGCTAGAGGAATATGGATGAATAGATAAGGCAGTCAGTAGATAAGAACAG
ATGGGGAAGTGAGCTACCTTTCTAGAGGAAGATAACAAGTGGAGAAATTATAAGTTTGAG
AAAGAATAAGTGAGGAGTCGAGAACTCTGGGATACCTCCCATGGACCAGATGGCCAAGAA
TTAATGGGAGATGTGTGGGGCATCTACGTTGCATGAATAGGCAGATATGAGGAGCAATAT
AGGCAAGACCAAGATGTAAGAGGCAAGAGCAAGGGAGGCAAGGCAAGAGATGTAAGATCA
AGAGAGAAGCTTGCATATGTACCCCAACTTTTATTGGAGATTTTAGGAATGTGAAATGGG
AGGTGATTAATGAATACATGACATGATATAGGTTTTAACATTGGTTGATTTGACAATGAT
GAAATCAAAGAGGAAGAGATTAATCAAACCCTCACTTTGTAAAGGAATGTAGTCTGAGCC
AGGACACTGTGGCTGGCAACGCCCAGCCCAGGAATTTAACCTGACCATGAGTCTTAGTAT
ATGAATATGTAAGATACAGTATCAATACATCAATCATACTTCCAAGATGCTAACATGTCT
GGTATGCCACAACTTGTAAAGCATAAAATTTCTGCTTTAAGCCTCTTTCTGTTTGTTCAC
ACGTGACTGTGCTAAAGCAATTGTGGGAAATAACATTGTAATAAATGAAGCCGTCTAATA
TCAAACTTGTTGGAATAGAGTTACCATAATTTTTTAGCTGTACATGATTTGTGTTATACA
TACTTTTTAAGCACAGGTACAAAGTCACACCTTTTTAGCATAAAATAAAGAATAGATGAC
ATTTTTACTTAAAATATGTGGAAAATACTGATCCTTTTTAATAGTTTTTTTAATCTTTAA
TTGAAATAATTTGACAATTTAATCCATAAACTTGGAAGAATTAATGTGACTCATCATTAG
AAATCAGTGATGTTGGTAAATTTGAACCCAATACCTGGGTAAAGTTTTTGAATATCGGGA
CCTTTTTTGTAAAGGAGGTTGGTTTAGGTAGATAATGTAATCTTAAATGTAGAAAGAAAA
ACTTGACTGAATGATAATGTTAACAAATAAAATGGAATAGCCTGAGTATTTCTGCTGAAA
ACTTTATTTCTAGGTATTTAAACACTTTCCTGTATTAAGAGAAAGTTAGAGTAATGATGA
TTGTCATACCTCTTTAGAGAAGCAGATATTACCAAGGAGAGGATTCAAAAGATACTGGCT
ACTGGTGCCAATGTTATTCTGACCACTGGTGGAATAGATGATATGTGTCTGAAGTACTTT
GTTGAGTCTATGACTATTGCAGTCCGAAGAGTTTTAAAAAGGGATCTTAAACGAATTGCT
AAAGCATCTGGAGGTAAGTATGACTATTTAGGAGCTAGTTGTTCTCTATGGGGATTACAA
CTCTTTTAAAGTTAATTAGTTTTTTCCATAGGTATGCCTTTAAACAAAAAGTACTGTGTA
AGCTTTAGCACTTCAAAAAGAAAACATAAACAGCAGCTACTCTTATGTACTTGTTACTGC
TCATCTTAATTTTTAACGGATTTGGGGGGGAAGAAAAATGCAATTTAAGAAAAAATGAAT
CACTTTTTCAGTTTAGGTCAGCAGTTCTCAACCTCTCAATTTGCAGCAATGAGAATACAT
AATGCATAATCAGGTATTTGCATTGTGAATCATAACTGTAGCAAAATTACAGTTTTGAAG
TAGCCACCAAAATAACTTTTTGGTTTGGGGTCACTGCAACATGAACTGTATTGCGGGGTC
ACGGCATTAGAAAGGTTGAGAACCACTGGTTTAGGTAGATTTCTTTTTTTTTAATTCACT
ATGTTGAATGTTGAACTCATAATTTCTTAAATTATTTGGGGGGACTACTGATAAAATCTC
AATCATTACAATGTGTGGTTGGGTCCTTTTTCTTAATATGTAGGGATGTTTGTGGGGGAT
CTGACTCCTAGGCATCTCCCCTTTCTTACCATGTAGGAAAATGAGCACACTTTTCATAAT
GGTAACAATTGGTCATCTTTAATTCATCTTCCTTTTGTACAAGGTAAATGGGAGGAAAAT
GCATGTAAAAATTTCCAATTTTTTTCTCGTTTAAAAGCAACCATTTTGTCAACCCTGGCT
AATCTGGAAGGTGAAGAAAGTTTTGAAGCTTCAATGTTGGGACAAGCAGAAGAGGTAGTA
CAAGAGAGGATTTGTGATGATGAGCTAATTTTAATCAAAAAGTAAGCTATGCTATAGAAT
ACCACAGCTTATATAAATTTTTATTCTCATTAAATTAGAGCCACATAACTTCCCATTTAT
TTGCTGCCATTCTTTCAGTAGGATGAGCAGTTATACGCATGGGATACAGTAAGATTAGTC
CTGTAAATTAAGATGAAATCAACATTTCATCTCTTACAGGTCTATCACATTTTGTAGACA
TTGAGGGTGGACATCCAGAAGAGGTGATGACCAGGATCCTATAGAGAGAGCCTCTATCTC
ATGCCCTATAAGGATCAGTTTAGGGAATTAGTTATGTAGATGGTGAAGGACAGCTTTGGG
GTGAGGTGGGTGGTTTAAGGGTTATGTCTTGTCCAAGAGAGATTAATTTGTTGTGGTTGG
CCCCAGAACAGGGAAAAATAATACTTAAAGCTGCCCCAAAGTGGAAGAGGCTGGTCCTTC
TGTAGAGACTGTCAAGGACGGCTGGATGACTCATTAGCACATTGTAAAAGGGATTAGTAT
TCTTGTAGGGGCTAGACTAGTGGTGACTTGCGTTTTCAAAACTCACAATCAGTTGAGGTT
TTTATACCTAGAGATTTAATATTGAATCAAAATTCTCATAGTTTATAGCTTGACCTTAGT
GTGAATAAAATGTTGCACCAACAGTTACCCTGTGAAGTATTTTAGACTTTTAAATTATAT
AATTCTAGTTTGTTATAAAGAATGGTTTAACCATGACTGTTTGTTATAGCACTAAAGCTC
GGACATCTGCCTCAATTATTTTACGTGGAGCAAATGACTTCATGTGTGATGAGATGGAGC
GTTCTTTACACGATGCTCTCTGTGTGGTGAAGAGGGTTCTGGAATCAAAGTCTGTAGTGC
CAGGTGGTGGTGCTGTAGAAGCAGCCCTTTCCATTTATCTGGAGAACTATGCAACCAGCA
TGGTAAGAGTGCAAACCTTGAAGAGGGAGGCAGGGAGGGACCTATTTCCATGAAAAAGCA
GCTAATTGTTTTTTCTTCCTTCAGGGATCACGGGAACAACTTGCTATTGCAGAATTTGCC
AGATCTCTTCTCATTATTCCCAACACATTGGCAGTTAATGCTGCCCAAGATTCTACAGAT
TTGGTGGCTAAGTTAAGAGCTTTTCATAATGAGGCTCAGGTTAACCCAGAACGCAAGAAC
CTAAAATGGCAAGTATAATTTGTTCTGCTTTTATTGTCCTTTTGCATGTACAAATTAGAG
GGCTGGATTTGGGGGATGCTTGTGTTTATGAAGGTTAAAACTTTAGAGAAATGAAATCAT
TATTGATTGAGAAACATTGGGAGGTGTATAGCTTTGCGGAAGTATGTTTACATGTAGGTT
GTATATGTTTAGAACAACACTCCAATATGTGAGTTGGAGGAAGGGGATGGGAGGGGGGGA
GATTTTTGGTAAACAAAAATTGACCTTTGTTTAATTCTTTTTTCTAATTATAGGATTGGT
CTTGACTTAGTCAATGGTAAACCTCGGGATAACAGGCAGACTGGTGTGTTCGAACCTACC
ATGGTTAAAGTTAAGAGTTTGAAATTTGCTACAGAAGCTGCAATAACCATTCTTCGAATT
GATGACCTCATTAAGTTACATCCAGAAAGTAAGGATGATAAAAGAGGAGGAACTTATGAA
GATGCAGTACACTCTGGAGCTATTGAAGACTGATCAGATTTTATTTATAACAATATTACT
GTTAGTTTAATTCTGTACCAGTTGGTCTTTAAAAAATAGAACAACCTGTTGCTTTGACTT
GAGTTTTTATAAGGGAGATGAAAGAAAATAAAAACATCTTTCCTCTGCTGTTTTTGGTCC
CTGAAACATGTTTTCACAGGTAGTTTAGTTAAATAAGTTTGTTTTTTAAGACTCAATGAG
TTAAAATTAACTACATTTTACAGTTTGTTCAATCACTTTTTGAGATGAAGGTTTTCCTTT
CATTCTCTTTTAACACACATTGCTATTCCCATCCCTCCTCCAATGCAGAGAGCTGCCACT
CCACGAGTTCCACCCATCCGCTCCAGTGTATGTAACAGAGTAACAAGAATTCGACACCCT
GAGGACCCAATGGGATGTCCCAAAGCTATGGCTCCACCTTGAATGTTGACCTAAAACAAA
CAATAAGGACACATTTAAAATCTCCATACTTGCTATGTGCTTGTGAAGTTCCCTGTGGAG
TAACGCCTAGTTTACAGTCACCGTTAGCTTTGAGAGGAGAACACTCCAATCTCATGGTTT
GGGTTTATTTCACCATAAGAAATGACAAATGAAACATTCAGAGAAAACTTGCATAGATTC
AGAGGGAAGTGGGCAAAACCAAGAAAATTTGTGACAGTTATAATAATGAAAATAACTTTA
GGACAATCACCATTAGAATGTAACCACGCTGCCCCCCAAGGATTAGTGACTTGTCACCAA
TGAAGAGGGGAAGGAAAGCTGTGCTAGGTACTTTTACAAATACTGTCACTTGGCCATGTA
AAAAGTATCTCCGTATTGTTTCAATACACTCACCTTTTCTGGATTCAATCCAAGTTCCTT
TGATACTGCTACAGCCAGGGATGCAAAGGCTTCATTGATTTCAAATGCATCAACATCATC
TAGTGTCCAATTTGCTTTGGCAACCTAAGAGGGAAGAATGATTAAATGTGTCATTGAGGA
TAGGTATATGGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1123, 3729..3814, 4028..4156, 5548..5645, 6192..6302, 7249..7430, 8441..8567, 10397..10572, 11317..11440, 12169..12361, 12444..12605, 12894..13112
1060..1123, 3729..3814, 4028..4156, 5548..5645, 6192..6302, 7249..7430, 8441..8567, 10397..10572, 11317..11440, 12169..12361, 12444..12605, 12894..13109
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved