Monodelphis_domestica Locus RPS12
snOPY snoRNA Orthological Gene Database
Monodelphis_domestica RPS12
Monodelphis_domestica
RPS12
2
SNORD101, SNORD100, SNORA33
2044..2115, 3407..3490, 3949..4075
5375
AAATGACTATTAGATGACAAGGCATTTGCCATTTTTCTGCAAAGAGAAAAGGGTGATAT
TACCAGTCTCTTGGAAGATTAGGAAGCTGAGCCATATAAAGGAAGATTGACTTTTTCTGG
GGAACAAATATTTACTGAGTCCGAACTATGTGCCAGGAGTTTTTCAAATATTATCTTATT
TAATCCTCACAATAACCCTATAAGGTAATAATAATAGCGAGTATCTATATAACGCTTAAC
TATGTGCTAGGTACTTTACAATTTTTTTATTTCATTTGATCTTCACAGTAACCCTGGGAG
GTGAGCGCTGTGATTATCAGAATTTTACGGATGATGAAACTGAGGAAAGCCGGGGTGAAG
TAACTTGCCCAAGGTCACACCGCAAGTAGGGATCAGAGGCCATTTGAACTCAGCTCTTCC
TGACCCCAGGCCCAGCGCTCTGTCCACCAGGAGGTGCAGAGGGCTGAAAGGAAGGGCAAA
AAAGGCAGGACTACATATAACATAATTCCTAAGAGAGACAGAAAAGTTCGAGACCGGAAC
TAAACACACAGAATTAGGGACTCATAAAACCCACGTGTAGACCAGGAAACCCACGCATAC
CTTCTCCGGAACTTGATCTCCAAGCCCCATTCGGTGCCCCAGAGAGCAGGGTTGGACTGT
CCAACTCTGTGCCTGTCAGTCGTCCCCCGCCAAAGGCTCTGTGAAGCTCGCTGGAAACAG
AAGTCTCAAAGCCCGGCAGAGCTTTAGACATCTCTATCCGAGGAGACTAATGAGCATGCG
CGTAAAGGGGTCCTGAACCCTTTAAATTCTTCCGGGCGGGGAGGGAGGGCCTCTTTCCCT
GTCGCCGCTGAAGAGAGCGGGAGGCGGAGGCTCCCGGGGTAAGTGTTTGTGGCGGGCGAG
TTGGAGGTGCACGCGTTTGGCGGTAAGATTCTCAGGCTGGGGGTTTCTGTCGGAGCGTGG
GCAGGCGTGGGTACGTTCTTTTGACGTATTTGTGATTTAATTTCAGTGCTTTCAAGATTA
AGCTTCACCCGTGAACCGCTGCCATGGCCGAGGAAGGGTGAGTGCGGGGATGCGGGCGGG
CGGGAGGGGGCGCTTACGTGAAGAGTTCTCTAGAGTTTTATATTCTCTACCCGATGGCTC
GCGCCGGGGCCCCGTTCCGCCGATGCCACGTGCACACCTCACCCATGGGGGGTTGGTTGG
CGTCTCCAGGCTCTGGCTGCCTAAGCCACACAGGTCGAGAAGCAAAGTTGCTTCTCTCTT
CCAAACCCCAAATGTGTACGGAGACCCAGACCTTTTCCCCCACGTGGCAGGCGAAGTTAG
AGGAAGGAAGGGTGGAAGCCTGTGGTGTCCAGTGAGCAGAGTTTAAACATAATCACTTTT
TCGCTTTTATAGCATTGCTGCTGGAGGTGTAATGGACGTTAACACCGCTCTACAAGAAGT
GCTGAAGACCGCACTTATCCACGATGGCCTAGCTCGTGGAATTCGTGAAGCTGCCAAAGC
CTTGGACAAGTATGTCTTTTATTTTACTCTAATAAAACTTAACTTCTAGTGATGTGTTCT
TCAAAACTCCCAAGTACAGTGTGAGTTTGGTAACCAGTACAAAAATTCTATCCACCTCCT
TAACTTTACAGGGATATTGATATTTACAAGTGGGAGGAAATGAAAGAATCCAGTTTAGTA
ACACAGTTTTAAGTATTTCAGGATAAGAATGCAAATTCTCCTTATAAATAAGTTGCACAT
TATTGGAAAGGGGGGAACCTTATTCTTGATGCATATAATTTCAAGTTTCAGACGCCTGTT
CAATCTAGAAGTAGATCCTTAACTGATAAATGCAAGGTTTTGTAAAATGTTACTAGCAAG
TGGGCACAGTGCTTTAATTACTGTTAATGGTTTTATTTATTGTGCATGTGGATATAATCT
GGACTGGACTGTAACAGTAATAAAAAGATATTTGGTTTTATTTTTTGGTTTATATTTACT
GTTTGGAAAACCAGGAATGAAAATAGAATTAGGTACGGTAACTCCTGCTTTTGAGATTCA
CAGAGTTTGAATGATGACTTGATTGTCGGATACCCCTACACTCCATTTATGAGTGATAAA
AAATGGTCTGACAAACCTGTGTTATTTCATTATAGATGAACAAAGTTTTAGAAGTTCTTT
ATGTGTAATGAAACACTGGCAAGTTGCTATGTTCTCTTAAAAACCCAATCTAGAATTTTG
ACTACATAAAAATGCTTTTGATTTCTTGTCTGGAACTCCTTTTGTACTTTATGGCATAAA
ATAATTGACAATTTGGTCCAACTGATGAAGAAACTAAATTTTTTTTTATAAGTCATTAAA
ATACACTTTGGGCCTAGTTGAAAGTATTTTTTCTGGACTAGTTACACTGGCAAAGTAACT
GCATGTATTAAAAAACTACCTAATTTGGATTTTTTTTTAAATTGTACATTTTGAAAGCTT
TCTAAATCAGATGAATTTCAAGTCAGTTCAATTCACTTTGGTATAGACTGGGCAGTTCAA
TGGAAACATCGACTGGATGTACTTCAGCAGTGCCTGTCATGAGTCCCTTTCAACCTTAGC
ACCTTGGGAATGCTGCACAATTTAAAAATGGATTCTAATTCGATGTCTGATCCTGCAACA
GGTAACAGCCCTCTATCTGGTGGTTGATCCTAATGTTATTGCCAACCCAGTCACCAAAGC
TGAGGGACAGGCTAAAGTTCTAAGAATGCATGCTTTGTGGATTGCCCATAAGCTTTTAGA
GCTCTTTGGTCACAACTAAATGCAGAAAATTCAAACATTGGTCAGATAAGCATGTTAGAA
CATCAAATGCCAGACTTGGACAACTATGTTGGTTTGATCTGTTACAGGACTGGATGCAAC
CTGACAGTACTCTGCTAGGTATTTTATGGTAGTATCATGCTGTTCATTGCCAATGTAGCC
AGTGCAAAAAGAAAAAACTTTCAACACTAAACTACTGCTTATGTAGGCATGACAATTTTA
TAAGCATTTCTTTTCTAGATTGTAACAAAACCTTTTTGTATGCCATTTTTAGACGCCAAG
CCCATCTTTGTGTTCTTGCTTCCAACTGTGATGAACCTATGTATGTTAAATTGGTTGAGG
CCTTGTGTGCTGAGCACCAAATCAACTTGATCAAGGTGAGATTTTTTTATAAAGTAGAAT
TTTTATGAACAATTATTAGCAACTTTAGGATTATCACATTCTTAAGACTTGTCTATTCTT
AGTTTACTACTACTAAAACCTTGGAGGGGGTGTTGGCCTTTTTTAAATTTCTGCAAACAA
GTTATAACAGGAATGCATTTTACTGCTAAATTTATAATAAGAAAGTGGAAACAAAAGGGG
CAGGAGAAAGTTGTATTGGGAATTAGTGGGATTTGATTTGAAATAATGCTGTACATGATG
ACAACTTGGCTCCCTCTACTGATAATAATGAAGAGAACAGCCATGTCACCCAACATATCT
GAGCGTACAGCCATCTACCAGCCTTTTAATATTGTGTCCCTAAAAGTGCCATATTCAACA
GGTATTTTTTTTGTAGGTTGATGACAACAAGAAGCTGGGTGAATGGGTAGGCCTCTGTAA
AATTGACAGAGAAGGAAAGCCTCGTAAGGTGGTTGGCTGCAGTTGCGTTGTTGTTAAGGT
GAGTTGATCTAATTTTTAAGAAAAATTGATTTTTGTCACCTCCAATTCAGTTGTTTTAGA
ACACTGAAAAGTTTTGAATGATTTTTTCAGAGGAAGGACTTGAGACAGAATTAACAATGT
GAGAAGGAAGGAAAATGGTGATCCAGCAAGCAATTTTGAATAAAGTTTGAGATGCTTTTA
TTTTAAATGAAGGTTTTCCTTGTTTTAATAGTTTTTAAAAATATATTGTAACTACTTTCA
GTTCTTGTTTTATTGATGTCAACAGAAAAGGGGATGCTAAAAATTCTCAAAGCCAGTACA
TTACATCTGATTTACCTGAATGTGTTTTTCAGAAGTAAAATATTGGCAATAGTACAGCCA
TGGTACGAGCCTTAAAAACTGTGAGGTCTTTAAGGTCCCTGAGAATGGCTACAGTATATC
ATTCTATAACTGAATGTTTTCATTGATTTTGAAAAGGTGCCTTTTCCTACAGTTAATTTT
TGTTAAATGTTACATTTTGCTTTACCCCCCTAATCATTTAGGTGTGTATTAATAATAGAG
AAATTAGATTTGCTTGGTGATGGGAATTAGTGTTGTGAAATGTGAGTTCCAAAATGCTTT
TCATAAATTTAAAAGTGCTCCTTGATTTCTTTTTAGGACTATGGCAAGGAATCTCAGGCC
AAAGATGTCATCGAAGAATATTTTAAATGCAAGAAATGAGTAAATAAAAGCCTTGGTCTG
ATTTGATTTGTTGTGTTAGCTGTTACTTTGGATAAAACATTACTTGATTTTGCTTAATAG
TTGGTATATTTGTCTCATTTTCAGGCTGTGAATTTTTGAACCGATCTTTCAAGGAGAAAA
GAACTTTGCCAGTAGTGCAAATCTGAGATTTCCTTATAGTTTGGGGGTCATTAACAGTTT
CCTGAAACTAGGGATTTATCTTGGGATATTTAGAGTCAGGCCTAGAGACAGGAGGTCCTA
GGTTCAAATGTGGCCTCAGACACTTCCCAACTGTGTGACCCTGGGCAAGTCACTTAACCC
CCATTGCCTAGCCCTTGCCACTCTTCTGCCTTGGAGCCAATATTTGGCTCCAAGACAGAA
GGTAAGGGTTTTAAAAAAAGTTCTGGGAACATAAAAAAAGATTTGAATCACTTTGAGGAA
TAGCCTGGGGACAAGTCAAACAGCTGGTCTTTATTACCTAACTAGATTTTGAGGATAGAA
AGTTTTAGTGTAGTATTTTGATATTGTCTTAAATAGGCTTTCATAGGTTAAAGACATTAT
AGATAGGAAAAGATTTTGCTTTGTCTAGTTACTCTTTTGAACAAGTATGAAATTCCCATA
AGGCCCCCAAGCAGAATGAAAGGTTTTATAGATTTTGAAACCTTGAAGTTGAGATATGAC
TGAACTGCTGGAGGGGAGAGATAAGGTAAGGTCCCAACCTTGGAGCACCTGCTTCCCCAG
CAACATTGGACCTGAAAGTGCACATTTTCCTCATAGTTGTGGATTTTACTGGTGCTTGTG
CAGTCTGCTAAAATACTCAGTAGGTCAGGATTTGAACTAGTTGCTATTTCTTGGGAATGT
GGCCAATTATCATTTTTCTCAAGACTAGAATAGAGGTCCCCTAAGCAAAAATCACAACTT
TTTATTATCACAAAAATTACAACTTTCTAAAATGGGATCCACCTTAGGTTGTGTCTCCCA
TTATCTTCACAAAGCTGCCAGACATATGTAATGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1056, 1392..1508, 3052..3154, 3556..3657, 4296..4375
1043..1056, 1392..1508, 3052..3154, 3556..3657, 4296..4355
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved